SNP molecular marker related to lean meat percentage on pig chromosome 2 and application thereof
By identifying SNP molecular markers and their primer pairs associated with lean meat percentage on pig chromosome 2, efficient marker-assisted selection was achieved, which improved the lean meat percentage of Duroc pigs, solved the problem of slow breeding progress, and enhanced economic benefits.
Patent Information
- Application Number
- CN202410504987.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2024-02-01
- Filing Date
- 2024-04-25
- Publication Date
- 2026-04-17
- Estimated Expiration
- 2044-04-25
AI Technical Summary
Existing technologies are insufficient to efficiently improve the lean meat percentage of pigs, resulting in slow breeding progress and insufficient economic benefits.
We provide SNP molecular markers and their primer pairs located on chromosome 2 of pigs that are associated with lean meat percentage. Using molecular marker-assisted selection technology, we screen pig breeds with high lean meat percentage traits and increase the frequency of dominant alleles generation by generation.
It significantly improved the lean meat percentage of Duroc pigs and their synthetic lines, shortened the breeding time, increased economic benefits, and enhanced the competitiveness and sales profits of enterprises.
Smart Images

Figure CN118222726B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a SNP molecular marker located on chromosome 2 of pigs that is associated with lean meat percentage and its application. Background Technology
[0002] With changes in people's dietary habits and improved living standards, pig breeding is gradually shifting towards lean-meat varieties, and increasing lean meat percentage is currently a major breeding goal. The emergence of marker-assisted selection (MAS) has further accelerated the pig breeding process. MAS utilizes molecular markers associated with specific traits as an auxiliary means of selection breeding, significantly reducing the human and material resources required for breeding and shortening the breeding timeline. Genome-wide association study (GWAS) is a method used across the entire genome to identify associations between genetic regions (locus) and traits. Based on linkage disequilibrium, it identifies marker loci closely related to phenotypic variation by comparing the phenotypic differences of a target trait among different individuals with polymorphisms at loci. By mining molecular markers associated with lean meat percentage in pigs, the genetic improvement of pork quality traits can be effectively accelerated, contributing to the sustainable development of the pig industry.
[0003] Duroc pigs, as breeding stock, directly influence the production performance of Duroc × Landrace × Large White commercial pigs. Their meat quality, lean meat percentage, and growth rate are crucial to the economic benefits of the entire pig farming industry. By improving the lean meat percentage trait of the core Duroc herd, these advantageous genetic qualities can be passed on to commercial pig offspring to a greater extent, further enhancing their production competitiveness. Summary of the Invention
[0004] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide an SNP molecular marker located on chromosome 2 of pigs that is associated with lean meat percentage.
[0005] Another object of the present invention is to provide applications of the above-mentioned SNP molecular markers.
[0006] Another object of the present invention is to provide a primer pair for identifying the above-mentioned SNP molecular markers.
[0007] A fourth objective of this invention is to provide applications of the aforementioned primer pairs.
[0008] The fifth objective of this invention is to provide a method for genetic improvement of pigs.
[0009] The objective of this invention is achieved through the following technical solution:
[0010] A molecular marker of a SNP located on chromosome 2 of pigs that is associated with lean meat percentage, the SNP site of which corresponds to the G>A mutation at 79679919 bp on chromosome 2 of the International Swine Reference Genome 11.1;
[0011] The nucleotide sequence of the SNP molecular marker located on chromosome 2 of pigs that is associated with lean meat percentage is shown in SEQ ID NO.1, where M in the sequence is G or A, which leads to differences in lean meat percentage in pigs;
[0012] The SNP site of the molecular marker related to lean meat percentage on chromosome 2 of pig is the G129-A129 nucleotide mutation at position 129 of the sequence marked in SEQ ID NO:1 (position 79679919 on chromosome 2 of the international pig genome version 11.1 reference sequence, named: g.79679919G>A);
[0013] The aforementioned SNP molecular markers located on chromosome 2 of pigs and associated with lean meat percentage are used in the identification of lean meat percentage traits and genetic breeding of Duroc pigs;
[0014] A method for detecting the lean meat percentage trait in pork includes the following steps:
[0015] The above-mentioned SNP molecular markers on pig chromosome 2 were detected, and it was determined whether the SNP site nucleotide of the SNP molecular marker was G or A.
[0016] The pigs mentioned are Duroc pigs and their synthetic lines;
[0017] The preferred pigs are the S21 Duroc strain and its synthetic strains;
[0018] A primer pair for identifying the above-mentioned SNP molecular markers, comprising primer-F and primer-R, has the following nucleotide sequence:
[0019] Upstream primer-F: 5'-CTGCTGATTTTGTGGGGACG-3';
[0020] Downstream primer primer-R: 5'-AGGAAGCTTTAGGGTCGCTC-3';
[0021] A kit for detecting the above-mentioned SNP molecular markers, comprising the above-mentioned primer pairs;
[0022] Application of the primer pairs or kits described herein in identifying traits affecting lean meat percentage in pigs;
[0023] Application of the primer pairs or kits in marker-assisted breeding of pigs;
[0024] Application of the primer pairs or kits in improving lean meat percentage in pigs;
[0025] A method for screening pig breeds with a high lean meat percentage includes the following steps:
[0026] The genotype of pigs at nucleotide 79,679,919 on chromosome 2 of the International Pig Reference Genome 11.1 was detected, and individuals with the genotype GG or AG at nucleotide 79,679,919 were selected as breeding pigs.
[0027] The method for detecting the genotype at the nucleotide site at position 79679919 bp on chromosome 2 of the International Swine Reference Genome 11.1 includes the following steps:
[0028] (1) Extract genomic DNA from the pigs to be tested;
[0029] (2) Using the primer pairs mentioned above or the primer pairs in the kit mentioned above as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification is performed to obtain PCR amplification products.
[0030] (3) Sequencing the PCR amplification products to obtain sequencing results;
[0031] (4) Based on the sequencing results, determine the genotype of the SNP molecular markers;
[0032] The pigs mentioned are Duroc pigs and their synthetic lines;
[0033] The preferred pigs are the S21 Duroc pigs and their synthetic lines;
[0034] A method for genetic improvement of pigs, comprising the following steps:
[0035] The above-mentioned SNP molecular markers of breeding pigs in the core breeding pig population were identified, and corresponding selections were made based on the molecular markers: breeding pig individuals with the GG genotype and AG genotype at nucleotide position 79679919 on chromosome 2 of the International Swine Reference Genome 11.1 were selected for succession breeding, while breeding pig individuals with the AA genotype at this position were culled, in order to increase the frequency of the G allele at this position in each generation, thereby increasing the lean meat percentage of offspring pigs;
[0036] The pigs mentioned are Duroc pigs and their synthetic lines;
[0037] The preferred pigs are the S21 Duroc strain and its synthetic strains;
[0038] The present invention has the following advantages and effects compared with the prior art:
[0039] (1) This invention studies and determines the molecular markers that affect the lean meat percentage of pigs, and verifies their effect on the lean meat percentage trait. Finally, it establishes a molecular marker-assisted selection breeding technology for rapid improvement of the lean meat percentage trait of pigs, which greatly improves the breeding process of Duroc and its synthetic lines, meets the needs of the live pig market, increases the price of meat pigs, increases the sales profit of enterprises, and enhances their core competitiveness.
[0040] (2) This invention provides a primer pair for identifying SNP molecular markers located on chromosome 2 of pigs that are related to lean meat percentage. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established, and traits can be selected quickly and accurately, thus accelerating the breeding process.
[0041] (3) This invention provides a method for pig breeding by selecting the dominant allele of the molecular marker, which can accelerate the genetic progress of Duroc pigs and shorten the time for Duroc improvement, thereby effectively improving the economic benefits of breeding pigs. If this invention selects all AA-type individuals of the molecular marker that affects the lean meat percentage trait of pigs into GG-type individuals, the lean meat percentage of each pig at 100kg body weight can be increased by 0.65%, and in a large-scale pig farm with 10,000 pigs, it can increase the lean meat by 6.5 tons. It can be seen that the potential to increase the lean meat percentage to provide benefits to the pig industry is huge, which can ultimately improve the economic benefits of commercial pigs and thus increase the profits of enterprises. Attached Figure Description
[0042] Figure 1 This is a Manhattan plot of genome-wide association analysis of the lean meat percentage trait in S21 Duroc pigs on chromosome 2 at a body weight of 100 kg; where: the horizontal axis represents the chromosome number of the pig; and the vertical axis represents the -logP value.
[0043] Figure 2 This is a graph showing the lean meat percentage of pigs with different genotypes at a weight of 100kg. Detailed Implementation
[0044] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0045] Experimental pig herd: A total of 3,692 S21 Duroc pigs were used in this experiment.
[0046] Example 1 explains in detail the process of determining the effect of lean meat percentage in this invention.
[0047] (1) Laboratory animals
[0048] The experimental pig herd used in this invention consisted of 3,692 purebred S21 Duroc pigs from Guangdong Zhongxin Seed Industry Technology Co., Ltd., representing the company's core herd. The pigs were raised under standardized conditions and had free access to feed and water.
[0049] (2) Phenotypic measurement
[0050] The lean meat percentage of live pigs weighing 100kg was determined using the New Zealand HGS (Hennessy Grading System) carcass grading system.
[0051] Example 2 provides a detailed explanation of the invention process of the gene marker in this invention.
[0052] (1) DNA was extracted from ear-like tissue of Duroc pigs of strain S21 using the phenol-chloroform method described in the standard. Whole-genome DNA was extracted using a Nanodrop-ND1000 spectrophotometer. The DNA from the purebred Duroc strain S21 was tested for quality and concentration. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 ng / μL.
[0053] (2) 50K SNP Genotyping and Genotyping of the Whole Pig Genome: DNA samples were sent to Newgene Biotech (Shanghai) Co., Ltd. Based on the GeneSeek Genomic Profiler Porcine 50K SNP genotyping platform, microarray hybridization and result scanning (i.e., genotyping) were performed using the Illumina Infinium user manual and standard procedures. Genotyping data was then read using GenomeStudio software. To increase SNP marker density, the SWIM website (https: / / quantgenet.msu.edu / swim / ) was used to fill the pig genotyping data. PLINK v1.9 was used for quality control of the filled genotyping data, removing individuals with a detection rate below 90%, a family Mendelian error rate above 0.1, a minimum allele frequency below 0.05, and a Hardy-Weinberg equilibrium significance level above 10. -6 The SNPs were identified, resulting in 456,315 SNPs for subsequent analysis.
[0054] (3) Genome-wide association analysis (GWAS): A linear mixture model using GEMMA software was used to perform association analysis on the lean meat percentage trait. The Bonferrini method was used to determine the significance threshold of the association between SNPs and the lean meat percentage trait. The significance threshold at the genomic level was 0.05 / 456315 (number of effective SNPs), which is equivalent to a significance threshold of 1.09573E-7 at the genomic level. The significance threshold at the chromosomal level was 1 / 456315 (number of effective SNPs), which is equivalent to a significance threshold of 2.19146E-6 at the chromosomal level.
[0055] GWAS analysis results are as follows Figure 1 As shown. From Figure 1 It was found that in the S21 Duroc strain, there is a locus on chromosome 2 that significantly affects the lean meat percentage per 100 kg, with the strongest association SNP being g.79679919G>A (P value 2.2×10⁻⁶). -7 (The 129th nucleotide in SEQ NO.1 corresponds to the G>A mutation at 79679919 bp on chromosome 2 in International Pig Reference Genome Version 11.1).
[0056] (4) Association analysis between different genotypes and the lean meat percentage phenotype at 100kg body weight in breeding pigs: According to Table 1, the SNP site g.79679919G>A of the molecular marker was highly significantly associated with the lean meat percentage trait (P = 7.22 × 10⁻⁶). -8 The value <0.01 indicates that this molecular marker significantly affects the lean meat percentage of the S21 Duroc pig breed. Assisted selection at this SNP site in pigs can improve the lean meat percentage of this population, thereby accelerating the breeding process of lean-type pigs. Furthermore, according to Table 1 and... Figure 2 Furthermore, it was found that the AA genotype had a lower lean meat percentage than the AG and GG genotypes, indicating that homozygous AA is the most detrimental to the lean meat percentage of breeding pigs. Lean meat percentage is an important indicator of the growth performance of breeding pigs; a high lean meat percentage indicates good growth performance. Therefore, pigs with the AA genotype have the worst growth performance. In the breeding process, we need to gradually cull AA and AG genotype breeding pigs, retaining GG genotype breeding pigs, in order to increase the frequency of the G allele at this locus generation by generation.
[0057] Table 1. Correlation between SNP sites of molecular markers g. 79679919G>A and lean meat percentage trait.
[0058]
[0059] Example 3 explains in detail the invention process of detecting SNP markers.
[0060] (1) Primer design
[0061] The DNA sequence of SEQ ID NO:1 on pig chromosome 2 was downloaded from the Ensembl website (http: / / asia.ensembl.org / index.html). Primers were then designed using the NCBI primer design software. The DNA sequences of the designed primers are shown below:
[0062] Upstream primer-F: 5'-CTGCTGATTTTGTGGGGACG-3';
[0063] Downstream primer primer-R: 5'-AGGAAGCTTTAGGGTCGCTC-3';
[0064] (2) PCR amplification system and conditions
[0065] Prepare a 10 μL system, including 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR conditions are as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 64℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 35 cycles; and a final extension at 72℃ for 5 min.
[0066] (3) DNA sequence sequencing and identification: This was performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions (positive and negative). The obtained sequences were compared with the NCBI genome sequence to identify the corresponding SNP mutations. The sequencing results are shown below:
[0067] CTGCTGATTTTGTGGGGACGGCTGTGACCACCACAAAGTGCACAGAGGACACGGGCAACCTGGAAGCAGTGAAGGGTTAGGAAGTGGGGGGGGGGGGGTCACAGCCTGTCAGGTGTGGGCTGAGTCTG M(G / A) GTGAAAGATCCAAGGAAGAGAAGGAAGAATTGTTCCTTTTCCCTTCCCCTCGGGGAGCCTCAGATCCATGGGGATCCCCTCCTGGGCTCAGTAGAGTAGAAAGTATGCCTGGAGCCCACAGCTGTCCAGAGCGACCCTAAAGCTTCCT
[0068] Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The beginning and end of the sequence are bolded to indicate the primer binding position.
[0069] Example 4: Analysis of the SNP site g.79679919G>A effect of molecular markers
[0070] This invention provides a SNP molecular marker that can significantly improve the lean meat percentage of Duroc breeding pigs. Using this SNP molecular marker for marker-assisted selection can greatly accelerate the lean meat percentage breeding process in Duroc pigs. If this invention successfully breeds all AA-type individuals with the molecular marker affecting lean meat percentage into GG-type individuals, the lean meat percentage per pig at 100kg body weight can be increased by 0.65%, resulting in an additional 6.5 tons of lean meat in a large-scale pig farm with 10,000 pigs. This demonstrates the enormous potential for increasing lean meat percentage to improve profitability in the pig farming industry. By selecting the dominant allele (G) of this SNP in the S21 line Duroc individuals, the economic benefits of commercial pigs can ultimately be improved, thereby increasing enterprise profits.
[0071] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The application of a SNP molecular marker located on chromosome 2 of pigs and associated with lean meat percentage in identifying the lean meat percentage trait and in lean meat percentage genetic breeding, characterized in that: The nucleotide sequence of the SNP molecular marker located on chromosome 2 of pigs that is associated with lean meat percentage is shown in SEQ ID NO.1, where M in the sequence is G or A, which leads to differences in lean meat percentage in pigs; the lean meat percentage of AA genotype pigs is lower than that of AG and GG genotype pigs; The pigs mentioned are Duroc strain S21 and its synthetic strains.
2. A method for detecting the lean meat percentage trait in swine, characterized in that It includes the following steps: The SNP molecular marker described in claim 1 is detected on chromosome 2 of pigs, wherein the SNP site nucleotide of the SNP molecular marker is G or A; wherein, the lean meat percentage of AA genotype pigs is lower than that of AG genotype and GG genotype pigs; The pigs mentioned are Duroc strain S21 and its synthetic strains.
3. The application of a primer pair for identifying SNP molecular markers associated with lean meat percentage located on pig chromosome 2, or a kit for detecting SNP molecular markers associated with lean meat percentage located on pig chromosome 2, in identifying the lean meat percentage trait in breeding pigs, characterized in that: The primer pair comprises primers primer-F and primer-R, and their nucleotide sequences are as follows: Upstream primer-F: 5'-CTGCTGATTTTGTGGGGACG-3'; Downstream primer primer-R: 5'-AGGAAGCTTTAGGGTCGCTC-3'; The kit contains the primer pairs described above; The SNP molecular marker is the SNP molecular marker described in claim 1; the lean meat percentage of pigs with the AA genotype at this SNP molecular marker is lower than that of pigs with the AG and GG genotypes. The pigs mentioned are Duroc strain S21 and its synthetic strains.
4. The application of a primer pair for identifying SNP molecular markers associated with lean meat percentage located on pig chromosome 2, or a kit for detecting SNP molecular markers associated with lean meat percentage located on pig chromosome 2, in marker-assisted breeding of pig lean meat percentage, characterized in that: The primer pair comprises primers primer-F and primer-R, and their nucleotide sequences are as follows: Upstream primer-F: 5'-CTGCTGATTTTGTGGGGACG-3'; Downstream primer primer-R: 5'-AGGAAGCTTTAGGGTCGCTC-3'; The kit described above contains the primer pairs described above; The SNP molecular marker is the SNP molecular marker described in claim 1; the lean meat percentage of pigs with the AA genotype at this SNP molecular marker is lower than that of pigs with the AG and GG genotypes. The pigs mentioned are Duroc strain S21 and its synthetic strains.
5. A method for genetic improvement of pigs, characterized in that... It includes the following steps: Identify the SNP molecular markers described in claim 1 for breeding pigs in the core breeding pig herd, and make corresponding selections based on the molecular markers: select breeding pigs with the SNP molecular markers described in claim 1 as GG genotype and AG genotype for successive generations, and eliminate breeding pigs with the AA genotype, so as to increase the frequency of the allele G at this locus in each generation, thereby increasing the lean meat percentage of offspring pigs. The pigs mentioned are Duroc strain S21 and its synthetic strains.