A Dactylis glomerata flowering gene DG3C00010.1 and its application

By overexpressing the DG3C00010.1 gene in duckweed, the problem of uncloned duckweed flowering regulation gene is solved, and breeding time is shortened and flowering period regulation is achieved, and breeding efficiency and flowering period regulation ability of ornamental plants are improved.

CN118240839BActive Publication Date: 2025-09-02SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410548873.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-06
Publication Date
2025-09-02
Estimated Expiration
2044-05-06

AI Technical Summary

Technical Problem

At present, the genes related to flowering regulation of duckweed have not been disclosed and cloned. The flowering period is closely related to its quality and yield. The existing technology has a long improvement cycle and low breeding efficiency.

Method used

The duckweed flowering gene DG3C00010.1 and its recombinant vector are provided. By overexpressing this gene in Arabidopsis and ornamental plants, the flowering time is regulated and early flowering is promoted.

Benefits of technology

Shorten breeding time, improve breeding efficiency, promote the development and utilization of high-quality grasses, duckweeds, and can artificially regulate the flowering period of ornamental plants, which has social and economic value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118240839B_ABST
    Figure CN118240839B_ABST
Patent Text Reader

Abstract

The present invention discloses a flowering gene DG3C00010.1 of Dactylis grass and its application. The nucleotide sequence of the gene is shown in SEQ ID NO. 3, and the amino acid sequence of the protein expressed by the gene is shown in SEQ ID NO. 4. Studies have shown that overexpressing the gene in Arabidopsis thaliana can advance the flowering time of Arabidopsis thaliana and promote flowering of Arabidopsis thaliana, indicating that the gene is a flowering-related gene and its overexpression has the function of promoting flowering. This characteristic can effectively improve the shortcomings of traditional forage improvement technologies, such as slow results and long cycles. The gene can be used to shorten breeding time, improve breeding efficiency, promote the development and utilization of high-quality grass forage Dactylis grass, and make a significant contribution to the improvement of traditional forage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, and in particular to a orchardgrass gene with a flowering-promoting function and an application thereof. Background Art

[0002] Dactylis, a member of the genus Dactylis in the subfamily Festucoideae of the Poaceae family, is a perennial, cool-season clump-forming forage grass cultivated worldwide. It boasts numerous leaves, high yield, shade tolerance, strong adaptability, good palatability, and high nutritional value. It can be used for green fodder, hay preparation, or silage, making it one of the four most widely distributed grasses in the world. Approximately 14,000 tons of Dactylis seeds are produced annually, accounting for 3.3% of the world's temperate forage seeds. Currently, Dactylis is cultivated in Qinghai, Gansu, Shaanxi, Shanxi, Henan, Jilin, Jiangsu, Hubei, Sichuan, and Xinjiang provinces for both mowing and grazing. It is a popular food for various poultry species and has achieved excellent economic and ecological benefits, demonstrating broad prospects for its utilization. Flowering period is a key agronomic trait of Dactylis, closely linked to its quality and yield. Flowering period marks the transition from vegetative to reproductive growth, and forage quality and yield also change accordingly. Duckgrass is suitable for mixed sowing with legume forages. Targeted cultivation of duckgrass varieties with different flowering periods and combination with legume forage varieties with the same maturity period can extend the grazing time of mixed grasslands and improve overall production performance and utilization efficiency.

[0003] Up to now, the genes related to flowering regulation of Duckgrass have not been disclosed and cloned, and the early or late flowering is closely related to the quality and yield of Duckgrass. Therefore, it is urgent to develop the genes related to flowering regulation of Duckgrass, which has significant value and significance in the actual production of Duckgrass. Summary of the Invention

[0004] The purpose of the present invention is to provide a Dactylis grassi flowering gene DG3C00010.1 and its application. Overexpression of this gene can advance the flowering time of Arabidopsis thaliana. This gene can effectively improve the shortcomings of traditional forage improvement technology, such as slow effect and long cycle, and can be used to shorten breeding time, improve breeding efficiency, and promote the development and utilization of high-quality Poaceae forage Dactylis grassi.

[0005] In order to achieve the above object, the present invention provides a Dactylis grassi flowering gene DG3C00010.1, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0006] The present invention also provides a protein encoded by the above-mentioned Dactylis glomerata flowering gene DG3C00010.1, the amino acid sequence of which is shown in SEQ ID NO.4.

[0007] The present invention also provides a recombinant vector containing the nucleotide sequence of the flowering gene DG3C00010.1.

[0008] The present invention also provides a recombinant engineering bacterium containing the recombinant vector.

[0009] The orchardgrass flowering gene DG3C00010.1 provided by the present invention can be used in the improvement and breeding of forage grass.

[0010] Preferably, the above-mentioned forage grass includes Dactylum and Arabidopsis thaliana.

[0011] Preferably, overexpression of gene DG3C00010.1 can be used to shorten the cycle of forage improvement, shorten the breeding time and / or improve the breeding efficiency.

[0012] The orchardgrass flowering gene DG3C00010.1 provided by the present invention can also be used to regulate the flowering period of ornamental plants. By overexpressing the gene in the ornamental plant, the flowering time of the ornamental plant can be advanced.

[0013] The present invention has the following advantages:

[0014] The present invention discloses for the first time the gene DG3C00010.1 in Dactylis grassi that regulates flowering time, and promotes the annotation work of Dactylis grassi gene functions.

[0015] By overexpressing the DG3C00010.1 gene, the flowering time of Arabidopsis thaliana can be promoted. Overexpression technology can be used to increase the expression level of DG3C01500.1 in Dactylis grass to promote early flowering. For the shortcomings of traditional forage improvement technology, which has slow effects and long cycles, this method can shorten the breeding time, improve breeding efficiency, and promote the development and utilization of high-quality Poaceae forage Dactylis grass.

[0016] At the same time, by transferring the gene DG3C01500.1 into ornamental plants for overexpression, the flowering period of the plant can be artificially controlled, which has social benefits and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 These are the expression results of gene DG3C00010.1 in the present invention at different stages of Dactylis glomerata.

[0018] Figure 2 This is the subcellular localization of the protein encoded by gene DG3C00010.1 in the present invention.

[0019] Figure 3 This is the resistance screening result of the T1 generation of Arabidopsis thaliana that overexpressed the gene DG3C00010.1 in the present invention.

[0020] Figure 4 This is the expression level of the DG3C00010.1 gene in the overexpression homozygous positive seedlings of the present invention.

[0021] Figure 5 This is a phenotypic diagram of the flowering time of the DG3C00010.1 overexpressing strain in the present invention.

[0022] Figure 6 This is the statistical result of flowering time of the DG3C00010.1 overexpressing strain in the present invention.

[0023] Figure 7 This is the fluorescence quantitative result of the flowering genes related to the overexpression DG3C00010.1 strain in the present invention. DETAILED DESCRIPTION

[0024] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0025] Note: Methods not specifically described in this application are all conventional methods in the art, and reagents and consumables not specifically given are all conventional reagents and consumables in the art.

[0026] Photorespiration is a crucial process in plant carbon metabolism, where carbon is exported as glycine and serine. Serine, a precursor of flowering substances, participates in flower formation and is deaminated by glyoxylate aminotransferase (AGXT) to form hydroxypyruvate. Hydroxypyruvate is then reduced to glycerol by hydroxypyruvate reductase 1 (HPR1), while some hydroxypyruvate can also be reduced to glycerol by hydroxypyruvate reductase 2 (HPR2). Finally, these two glycerols are transported to the chloroplasts, where they are catalyzed into glycerol triphosphate and enter the Calvin cycle. Therefore, we hypothesized that the HPR1 gene in Dactylis glomerata may be involved in regulating flowering time. Based on this, we identified the HRP1 gene in Dactylis glomerata and investigated its function by aligning the complete genome sequence.

[0027] Experimental Example 1 Gene Acquisition

[0028] 1. Selection of experimental materials

[0029] Total RNA was extracted from young leaves of the Duckgrass cultivar '2006-1', grown at the Wenjiang campus of Sichuan Agricultural University. RNA was extracted using the Tiangen (Beijing) Biochemical Technology Co., Ltd. Plant Total RNA Extraction Kit, following the included instructions. RNA integrity was assessed by 1% agarose gel electrophoresis, and RNA concentration and purity were determined using an ultra-micro spectrophotometer. Reverse transcription was performed using the TaKaRa PrimeScript II 1st Strand cDNA Synthesis Kit, following the included instructions.

[0030] 2. Amplification of target gene

[0031] (1) Cloning of gene fragments:

[0032] Using the Dactylis grassi reference genome (sequencing data in the article Huang L. Genome assembly provides insights into the genome evolution and flowering regulation of orchardgrass. Plant Biotechnol J) as a template, primers for the Dactylis grassi HPR1 gene were designed based on the full-length sequence. The specific sequences are as follows. The designed primers are as follows (5'→3'):

[0033] F(SEQ ID NO.1):ATGGCGAAGCCGATATCGATTG;

[0034] R (SEQ ID NO. 2): CTAAAGCTTGGAAGATGGCAGG.

[0035] The extracted RNA was reversed to obtain cDNA, and PCR amplification was performed using the cDNA as a template using the primers developed above. The amplification was performed using the 2×PhantaMax MasterMix (Dye Plus) kit from Vazyme. The operation procedure was referred to the enclosed instruction manual.

[0036] The PCR amplification reaction system was 50 μL, including 25 μL of 2×PhantaMax Master Mix (DyePlus), 2 μL of F primer (10 μM), 2 μL of R primer (10 μM), 4 μL of template DNA, and 17 μL of ddH2O.

[0037] The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, 35 cycles; and extension at 72°C for 5 min.

[0038] The amplified product was recovered and sequenced, and the nucleotide sequence of the gene was obtained as shown in SEQ ID NO.3, and it was named DG3C00010.1. At the same time, the amino acid sequence of the protein it encoded was shown in SEQ ID NO.4.

[0039] DG3C00010.1 full gene sequence (SEQ ID NO.3):

[0040] ATGGCGAAGCCGATATCGATTGAGGTGTGGAACCCCAGCGGTAAGTACCGCGTGGTGAGCACCAAGTCCATGCCTGGCACCCGGTGGATCCGCCTCCTCACTGAAAACGACTGCCGCCTCGAGATATGCACGGAGACGAAGACCATACTCTCGGTTGACGACATCGTGGCGCTCATTGGCGATCACTGCCACGGTGTCATCGGCCAGCTAACAGAAGACTGGGGGGATGTTCTCTTCTCTGCACTCAAGCAAGCCGGCGGCACAGCATTCAGCAACATGGCTGTCGGGTACAACAACGTAGACGTCGAGGCTGCCAACAGGAATGGCATCGCCATCGGCAACACACCTGGGGTTCTGACAGAGACAACGGCAGAGCTGGCGGCGTCGCTGTCGGTGGCGGCTGCCCGAAGGATCGTGGAAGCAGATCAGTTCATGAGGGCTGGCCTCTATGACGGATGGCTCCCGCATCTATTCGTTGGCAATTTGCTCAAGGGGCAGACTGTCGGGGTGATAGGAGCTGGCCGAATTGGGTCAGCTTATGCAAGGATGATGATTGAGGGCTTCAAGATGAACTTGATCTACTTCGACCTGTATCAGTCCACACGGCTAGAGAAGTTCGTCACAGCATATGGGCAGTTCCTGAAAGCAAACGGTGAGCCGCCTGTTACGTGGAAGAGGGCTTCCAGCATGGAGGAAGTCCTCAGGGAGGCTGATGTGATAAGCCTGCACCCTGTGCTGGACAAGACGACATACCACCTGATAAACCCTGAGAGGCTTGCTATAATGAAGAAGGAGGCGGTGCTGGTGAACGCGAGCCGTGGCCCCGTGATCGACGAAGTGGCGCTGGTGGAGCACCTGAAGGCGAACCCAATGTTCCGCGTTGGGCTGGACGTGTTCGAGGACGAGCCGTACATGAAACCGGGGCTGGCCGAGATGAAGAACGCCGTCGTTGTGCCCCACATCGCATCGGCGTCCAAGTGGACACGTGAAGGGATGGCGACTCTTGCTGCTCTCAACGTCCTTGGTAAAATCAAGGGGTATCCGGTATGGGGAAACCCGAACGTGGTGGAACCCTTCCTGGACGAGAATGCGCCGCCGCCGCTCGCTTGCCCAAGCATAGTTAACTCCAAGCAACTCGGCCTGCCATCTTCCAAGCTT。

[0041] DG3C00010.1 Amino acid sequence (SEQ ID NO.4):

[0042] MAKPISIEVWNPSGKYRVVSTKSMPGTRWIRLLTENDCRLEICTETKTILSVDDIVALIGDHCHGVIGQLTEDWGDVLFSALKQAGGTAFSNMAVGYNNVDVEAANRNGIAIGNTPGVLTETTAELAASLSVAAARRIVEADQFMRAGLYDGWLPHLFVGNLLKGQTVGVIGAGRIGSAYARMMIEGFKMNLIYFDLYQSTRLEKFVTAYGQFLKANGEPPVTWKRASSMEEVLREADVISLHPVLDKTTYHLINPERLAIMKKEAVLVNASRGPVIDEVALVEHLKANPMFRVGLDVFEDEPYMKPGLAEMKNAVVVPHIASASKWTREGMATLAALNVLGKIKGYPVWGNPNVVEPFLDENAPPPLACPSIVNSKQLGLPSSKL。

[0043] Experimental Example 2 Gene Function Analysis

[0044] 1. Analysis of the expression level of DG3C00010.1 gene in Dactylis gloeospermi at different growth stages

[0045] To verify the role of DG3C00010.1 in the growth and development of Dactylis grassi, leaf samples from different periods of Dactylis grassi were selected as materials. A total of three periods were selected, including the vernalization period, the vegetative growth period, and the flowering period. They were quickly frozen in liquid nitrogen, and 3 replicates were taken for each sample. RNA was extracted and reverse transcribed from the obtained samples. The experimental methods for RNA and reverse transcription were as above. Fluorescence quantification was performed using the Bio-RAD CFX Connet from Bio-RAD, USA, and the quantitative kit was MonAmp from Pumai Medical Technology (Beijing). TM Green qPCR Mix (None ROX).

[0046] Among them, the designed fluorescence quantitative primers (5'→3') of this gene are:

[0047] qF(SEQ ID NO.5):GCAGACTGTCGGGGTGATAG

[0048] qR(SEQ ID NO.6):TCTCTAGCCGTGGACTGA

[0049] β-Actin was used as the internal reference gene, and the fluorescence quantitative primers (5'→3') were:

[0050] Actin-F(SEQ ID NO.7):TCACGAAGCGACATACAACT

[0051] Actin-R(SEQ ID NO.8):TCCACTGAGAACAACATTACC

[0052] With 2 -ΔΔCT The expression level of the gene was calculated by the method. The expression results of the gene at different stages are as follows Figure 1 As shown, the results showed that the expression level of DG3C00010.1 gene was the highest during the flowering period, suggesting that this gene may be related to flowering.

[0053] 2. Determine the expression location of the DG3C00010.1 gene using subcellular localization

[0054] (1) Construction of clones:

[0055] The pAN580 plasmid was used as an empty vector, double-digested with XbaI and BamHI, and the DG3C00010.1 gene sequence was ligated to the digested pAN580 plasmid through cloning recombination technology. The ligation product was sent for sequencing to identify the positive clones. The positive clones were recorded as pAN580-DG3C00010.1 and transformed into Escherichia coli DH5α competent cells for preservation.

[0056] (2) Transformation of rice protoplasts

[0057] The positive clone plasmid obtained above was transformed into protoplasts as follows:

[0058] 1) Cultivate rice seedlings in the dark at approximately 30°C for 7-15 days, remove stems and leaves, rinse surface dirt with water, and remove the outermost leaf sheaths;

[0059] 2) Place the stems and leaves of the seedlings on a clean plastic board and cut them into small pieces using a sharp blade;

[0060] 3) Add 5-10 mL of enzymatic solution to completely immerse the tissue and shake slowly at 28°C for 4-5 hours.

[0061] 4) Filter the protoplasts through a 40 μm filter, transfer to a 2 mL centrifuge tube, and centrifuge at 600 rpm for 5 min until a turbid precipitate is visible.

[0062] 5) Directly aspirate the supernatant, wash twice with 10 mL of pre-cooled W5 solution, and centrifuge at 600 rpm for 5 minutes at 25°C;

[0063] 6) Add appropriate amount of MMG solution as needed to suspend the mixture to a concentration of 2*10 5 / mL, microscopic examination showed that the protoplasts were round and had few ruptures;

[0064] 7) Take 100 μL of the obtained protoplast suspension, 10 μL of plasmid DNA, and an equal volume of PEG4000 solution, mix gently and evenly, and let it stand at room temperature for 10-15 minutes;

[0065] 8) Dilute the protoplasts with 1 mL of W5 and mix well to terminate the reaction;

[0066] 9) Centrifuge at 600 rpm for 5 min to collect the protoplasts and remove the supernatant;

[0067] 10) Add 1 mL of W5 solution for washing.

[0068] After transient expression in rice protoplasts, the fluorescence of DG3C00010.1 was observed under a laser confocal microscope to obtain the subcellular localization of DG3C00010.1 protein. Figure 2As shown, it can be seen that the fluorescence signal of DG3C00010.1 protein is obvious in the cell nucleus and cytoplasm, which can confirm that the protein is localized in the cell nucleus and cytoplasm.

[0069] 3. Functional analysis of genes

[0070] (1) Construction of overexpression recombinant vector

[0071] The plasmid pHG-35S was double-digested with BamHI and PstⅠ, and the DG3C00010.1 gene sequence was ligated to the double-digested pHG-35S plasmid by cloning recombination technology. The ligation product was sent for sequencing to identify the positive clones. The positive clones were recorded as pHG-35S-DG3C00010.1 and transformed into Escherichia coli DH5α competent cells for preservation.

[0072] (2) Agrobacterium transformation of Arabidopsis thaliana

[0073] 1) Extract the recombinant vector pHG-35S-DG3C00010.1 constructed above and transform it into Agrobacterium by the following steps:

[0074] a. Take the competent Agrobacterium GV3101 stored at -80℃ and place it in the palm of your hand for a while until it partially melts. When it is in an ice-water mixture, insert it into ice;

[0075] b. Add 0.1 μg (no more than 10 μL) of plasmid DNA per 100 μL of competent medium, mix thoroughly by hand at the bottom of the tube, and incubate on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes.

[0076] c. Add 700 μL of LB liquid medium without antibiotics and culture at 28°C, 200 rpm, shaking for 2 to 3 hours;

[0077] d. Centrifuge at 6000 rpm for one minute to harvest the bacteria. Collect approximately 100 μL of the supernatant and gently pipette to resuspend the bacteria. Spread the suspension onto an LB plate containing the appropriate antibiotic and incubate the plate upside down at 28°C for 2-3 days. Randomly select a single colony and perform colony PCR to identify the correct Agrobacterium clone and label it for future use.

[0078] e. Use a sterile pipette tip to pick up a single colony of the labeled Agrobacterium and inoculate it into 1.5 mL of LB liquid medium containing the corresponding antibiotic (in a 50 mL blue-capped centrifuge tube) and culture at 30°C, 200 rpm, and shake for 24 hours.

[0079] f. The Agrobacterium culture was inoculated with a small shaker at a ratio of 1% and added to 100 mL of LB liquid medium containing antibiotics at 30°C and shaken until OD600 = 1.0;

[0080] g. Centrifuge at 20°C and 4,000 rpm for 15 min to collect the cells; pipette the cells evenly with transformation buffer and resuspend them to an OD600 of about 1.0 to obtain recombinant engineered bacteria.

[0081] 2) The obtained recombinant engineered bacterial suspension was transformed into Arabidopsis thaliana in the following steps:

[0082] a. Water the Arabidopsis plants that are about to sprout and flower one day in advance;

[0083] b. Turn the small pot upside down and place all the inflorescences into the bacterial solution pre-suspended in transformation buffer for about 30 seconds;

[0084] c. Repeat the above transformation steps once after 7 days. After 2-3 weeks, water as little nutrient solution as possible to accelerate aging. Collect the mature seeds in paper bags and place them in a desiccator for 7 days.

[0085] The conversion buffer is prepared as follows:

[0086]

[0087] 3) Screening of transgenic Arabidopsis

[0088] a. Preparation of culture medium: Arabidopsis culture medium was 1 / 2MS (0.8% agar powder, without sucrose, pH = 5.8);

[0089] b. Seed disinfection: 70% ethanol for 1 minute, add 1 mL of 7% sodium hypochlorite solution (containing 1 drop of Tween) for 10 minutes, mix by inversion for 5 minutes, and rinse 5 times with sterile water;

[0090] c. Resuspend the sterilized seeds in 100 μL of sterile water, pipette with a 1 mL pipette tip, and spot onto a 1 / 2 MS medium plate (containing the selection antibiotics: 50 μg / mL KAN, 30 μg / mL HYG, or 50 μM Glufosinate-ammonium).

[0091] d. Seal the plate and place in a refrigerator at 4°C for 48 hours for vernalization. Then place in an artificial climate chamber to begin germination and growth. The plant growth environment is 60% relative humidity, a constant temperature of 20-22°C, and a photoperiod of 16 hours light and 8 hours dark, with a light intensity of 80-200 μmol / M 2 / S;

[0092] e. Observe after 8-15 days, identify the positive ones and transplant them into planting soil;

[0093] f. Preparation of planting soil: Mix peat soil and vermiculite in a ratio of 2:1 and set aside;

[0094] g. Soil soaking: Fill the soil into the planting pot to about 1 cm from the pot mouth, and use Huawuque compound fertilizer (N, P, K = 20%, 20%, 20%) to completely soak it;

[0095] h. Transplanting: 20 days after germination, select healthy and uniform seedlings and transplant them into a culture soil soaked with flowers without missing flowers in advance, cover them with plastic wrap, and remove it after the seedlings are alive;

[0096] i. Samples were taken at the seedling stage for PCR identification to obtain Arabidopsis T1 generation resistance-positive plants.

[0097] 20-day-old seedlings were sampled and DNA was extracted using the Plant Genomic DNA Extraction Kit (DP305) according to the included instructions. PCR identification was performed on the extracted DNA. PCR primers were designed based on the DG3C00010.1 gene sequence and the vector plasmid. The specific sequences are as follows (5'→3'). The amplification product of this primer pair is 466 bp:

[0098] DG3C00010.1-F(SEQ ID NO.9):AGTTCCCATCGAGTACTG;

[0099] DG3C00010.1-R (SEQ ID NO. 10): CTGGTGGACTGATACAGGTC.

[0100] 16 seedlings were randomly selected for identification. After PCR, the electrophoresis results of their products were as follows: Figure 3 As shown in the figure, lane M is the DL2000 marker, lanes 1 to 16 are transgenic Arabidopsis seedlings numbered OE1, OE2, ..., OE16, and lane con is wild-type Arabidopsis. The electrophoresis results show that positive Arabidopsis plants overexpressing the DG3C00010.1 gene were successfully obtained.

[0101] 4) Verification of DG3C00010.1 expression in T3 transgenic lines

[0102] Seven T3 generation transgenic homozygous seedlings were selected and RNA was extracted after they grew for 3 weeks. The expression levels of the DG3C00010.1 gene in the seven homozygous positive seedlings were verified. Figure 4 As shown, since the DG3C00010.1 gene does not exist in the wild type, the OE4 strain with the lowest expression level was selected as the control group to calculate the relative expression levels of the DG3C00010.1 gene in the remaining strains.

[0103] 5) Flowering time statistics of transgenic Arabidopsis

[0104] a. Determination of flowering time:

[0105] Among the positive lines, three lines with higher gene expression levels, OE1, OE3, and OE7, were selected for statistical analysis. The flowering time of Arabidopsis thaliana was calculated when the bolt height was 0.5 cm. The phenotypes of the wild type and the three overexpressing DG3C00010.1 lines in the statistical flowering time were shown in the figure below. Figure 5 The flowering time statistics are shown in Figure 6 As shown. Figure 5 and Figure 6 It can be seen that the flowering time of the DG3C00010.1 overexpressing line is significantly earlier than that of the wild type.

[0106] b. Fluorescence quantitative determination of genes related to flowering time:

[0107] Three weeks after germination, samples were collected from the positive overexpression lines (OE1, OE3, and OE7) and wild-type Arabidopsis thaliana (WT) and subsequently frozen in liquid nitrogen. Three replicates were obtained for each sample. RNA was extracted and reverse transcribed from the obtained samples using the same experimental methods as above.

[0108] Conventional qPCR was used to perform fluorescence quantification of six genes in each sample for Arabidopsis flowering-related genes (flowering-promoting genes AtAP1, AtSOC1, AtFT, AtFUL, AtLFY; flowering-inhibiting gene AtFLC). The results are as follows: Figure 7 As shown, the results showed that the expression levels of flowering-promoting genes AtAP1, AtSOC1, AtFT, AtFUL and AtLFY in the lines overexpressing the gene DG3C00010.1 were higher than those in the wild-type plants, while the expression level of the flowering-inhibiting gene AtFLC was lower than that in the wild-type plants. It can be seen that DG3C00010.1 is a flowering-promoting gene and its overexpression has the function of promoting flowering.

[0109] In summary, DG3C00010.1 is a gene that promotes flowering. Overexpression of this gene can significantly accelerate the flowering time of plants. By constructing an overexpression vector for this gene and transferring it into plants, the flowering time of the plants can be significantly advanced. This can effectively overcome the shortcomings of traditional forage improvement techniques, which are slow to take effect and have long cycles. It can be used to shorten breeding time, improve breeding efficiency, promote the development and utilization of high-quality grass forages such as Dactylum glomerata, and make a significant contribution to the improvement of traditional forages. Furthermore, by transferring this gene into ornamental plants for overexpression, the flowering period of the plants can be artificially controlled, which has both social and economic benefits.

[0110] Although the present invention has been described in detail through the above preferred embodiments, it should be understood that the above description is not intended to limit the present invention. After reading the above description, various modifications and substitutions of the present invention will become apparent to those skilled in the art. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A Dactylis glomerata flowering gene DG3C00010.1, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

2. The protein encoded by the Dactylis grassi flowering gene DG3C00010.1 as claimed in claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

4.

3. A recombinant vector comprising the nucleotide sequence of the flowering gene DG3C00010.1 as claimed in claim 1.

4. A recombinant engineered bacterium containing the recombinant vector as claimed in claim 3.

5. The use of the orchardgrass flowering gene DG3C00010.1 in forage improvement and breeding according to claim 1, characterized in that: Overexpression of the gene DG3C00010.1 can be used to shorten the cycle of forage improvement, the breeding time, or / and improve the breeding efficiency, wherein the forage is Dactylis glomerata and Arabidopsis thaliana.

6. The use of the orchardgrass flowering gene DG3C00010.1 in regulating the flowering period of ornamental plants according to claim 1, characterized in that: By overexpressing the gene in ornamental plants, the flowering time thereof can be advanced; wherein the ornamental plants are Dactylis glomerata and Arabidopsis thaliana.