Application of oncolytic virus carrying interleukin 10 in colorectal cancer liver metastasis

Abstract

The present application relates to the application of an oncolytic virus carrying interleukin 10 in the field of colorectal cancer liver metastasis. The present application provides the use of a recombinant oncolytic virus in the preparation of a drug for treating colorectal cancer liver metastasis, wherein the recombinant oncolytic virus expresses interleukin 10. The recombinant oncolytic virus provided in the present application can overcome the immune clearance of the virus and the immunosuppression of the liver metastasis in the treatment of colorectal cancer liver metastasis, thereby improving the treatment effect of colorectal cancer liver metastasis.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to the application of an oncolytic virus carrying interleukin-10 in the field of colorectal cancer liver metastasis, and more particularly to the use and application of a recombinant oncolytic virus in the preparation of drugs for treating colorectal cancer liver metastasis. Background Technology

[0002] Colorectal cancer ranks third in incidence (10.0%) and second in mortality (9.4%) among all malignant tumors worldwide. In 2020, there were 1.93 million new cases and 940,000 deaths from colorectal cancer globally. Liver metastasis is the most common cause of death in colorectal cancer patients, affecting more than 50% of all colorectal cancer patients, and approximately 20% of colorectal cancer patients have liver metastases at the time of initial diagnosis. Although liver metastases from colorectal cancer can potentially be cured through surgical resection, more than 80% of patients cannot have their metastases completely removed, highlighting the urgent need to develop more effective treatments.

[0003] Although emerging tumor biotherapy has been widely used in human cancer treatment, only a small percentage of patients with advanced cancer have achieved long-term survival through this therapy. This is closely related to the organ specificity of the tumor immune environment. Compared to tumors that have metastasized to organs such as lymph nodes, liver metastases are more likely to develop resistance to biotherapy such as immune checkpoint inhibitors. This is because the liver induces immune tolerance through multiple mechanisms. Bone marrow-derived suppressor cells, Kupffer cells, dendritic cells, and stellate cells in the liver inhibit CD8 by promoting immunosuppressive pathways. + and CD4 + Activation of effector T cells. Recent studies have shown that monocyte-derived CD11b in liver metastases... + F4 / 80 + Macrophages induce antigen-specific CD8+ via the Fas-FasL pathway + T cell apoptosis affects the metastatic lesion microenvironment and eliminates antigen-specific CD8 cells through a "siphoning effect". + T cells cause systemic immunosuppression. Therefore, breaking the immunosuppression in liver metastases is of great significance for the biotherapy of tumors that have metastasized to the liver.

[0004] Oncolytic viruses have great potential in specifically lysing tumor cells and stimulating the body's immune response, but their therapy faces problems such as easy clearance by the body's immune system after intravenous injection and difficulty in ensuring that a sufficient amount of virus reaches the tumor site. Summary of the Invention

[0005] This invention aims to at least partially solve one of the technical problems in related technologies. To overcome the two major challenges of immunosuppression in colorectal cancer liver metastases and immune clearance of oncolytic viruses, the inventors of this invention creatively employ oncolytic viruses carrying interleukin-10 to treat colorectal cancer liver metastases. Taking vaccinia virus as an example, interleukin-10 not only inhibits the clearance of vaccinia virus by dendritic cells and macrophages, but also enhances CD8... + T-cell anti-tumor immune response. During the study, it was found that intravenous injection of IL10-expressing vaccinia virus achieved a 45.5% cure rate for colorectal cancer liver metastases in mice, surpassing all previous preclinical results. Furthermore, this virus not only infiltrated and replicated more extensively and persistently in the central part of liver metastases, but also significantly altered the tumor microenvironment of liver metastases, including increasing CD8+. + and CD4 + T cells and the reduction of F4 / 80, which cause local and systemic immunosuppression. + Macrophages. This virus can largely overcome the two major challenges of viral clearance by the body and immunosuppression of liver metastases in the treatment of colorectal cancer liver metastases, which is of great significance for the treatment and mechanistic exploration of colorectal cancer liver metastases.

[0006] Specifically, the present invention provides the following technical solution:

[0007] In a first aspect, this invention provides the use of a recombinant oncolytic virus in the preparation of a medicament for treating colorectal cancer liver metastases, wherein the recombinant oncolytic virus expresses interleukin-10. The provided recombinant oncolytic virus carries a gene encoding interleukin-10 on its genome, thereby enabling the expression of interleukin-10 and achieving a good therapeutic effect on colorectal cancer liver metastases.

[0008] According to embodiments of the present invention, the oncolytic virus is selected from modified or engineered vaccinia virus strains such as Lister, Tiantan, New York, Copenhagen, Canary, and Ankara, adenovirus, adeno-associated virus, herpes simplex virus, varicella-zoster virus, respiratory syncytial virus, Semleevirus, Epstein-Barr virus, Epstein-Barr virus, cytomegalovirus, human herpesvirus 6, smallpox virus, vaccinia virus, molluscum contagiosum virus, sheep pox virus, reovirus, rotavirus, enterovirus, Seneca virus, poliovirus, Coxsackie virus, rhinovirus, hepatitis A virus, foot-and-mouth disease virus, cloacal virus, alphavirus, Semleevirus, eastern equine encephalitis virus, Sindbis virus, rubella virus, coronavirus, and flavivirus. Hepatitis C virus, Japanese encephalitis virus, St. Louis encephalitis virus, Murray Valley fever virus, yellow fever virus, West Nile virus, Zika virus, dengue virus, Ebola virus, Marburg virus, arena virus, Lassa fever virus, lymphocytic choriomeningitis virus, Pichend virus, Junin virus, Machupo virus, Hantavirus, Rift Valley fever virus, paramyxovirus, human parainfluenza virus, mumps virus, simian virus, measles virus, vesicular stomatitis virus, rabies virus, orthomyxovirus, influenza A virus, influenza B virus, influenza C virus, hepatitis D virus, simian immunodeficiency virus, human immunodeficiency virus type 1 and human immunodeficiency virus type 2, Laureus sarcoma virus, human T-cell leukemia virus type 1, simian foamy virus, hepatitis B virus, hepatitis E virus, human papillomavirus or polyomavirus.

[0009] According to an embodiment of the present invention, the recombinant oncolytic virus is derived from oncolytic vaccinia virus, wherein the oncolytic vaccinia virus is a vaccinia virus lacking thymine kinase.

[0010] According to an embodiment of the present invention, the coding sequence (CDS) of interleukin-10 is shown in SEQ ID NO:1.

[0011] According to an embodiment of the present invention, the gene coding sequence of interleukin-10 is located in the thymidine kinase region of the oncolytic vaccinia virus.

[0012] According to embodiments of the present invention, the drug has at least one of the following properties:

[0013] (a) Add CD8 + and CD4 + T cell infiltration;

[0014] (b) Significantly inhibited F4 / 80 metastatic lesion infiltration + Macrophages;

[0015] (c) Prolong the duration of action of oncolytic viruses in liver metastases;

[0016] (d) Reduce CD8 + T cell apoptosis.

[0017] In a second aspect of the invention, a pharmaceutical composition for treating liver metastases of colorectal cancer is provided, the pharmaceutical composition comprising a recombinant oncolytic virus and a pharmaceutically acceptable vector, wherein the genome of the recombinant oncolytic virus carries interleukin-10, i.e., the recombinant oncolytic virus is capable of expressing interleukin-10.

[0018] According to embodiments of the present invention, the recombinant oncolytic virus is administered via intravenous or intratumoral route. The recombinant oncolytic virus provided by the present invention is particularly suitable for intravenous injection and for the treatment of diseases with multiple metastases and distant metastases, such as the treatment of liver metastases from colorectal cancer.

[0019] According to an embodiment of the present invention, it comprises 2-4 intravenous or intratumoral administrations of 1×10 6 ~3×10 7 The recombinant oncolytic virus was administered at a dose of pfu / kg, with an interval of 2 to 3 weeks between each administration.

[0020] The beneficial effects achieved by this invention are as follows:

[0021] Recombinant oncolytic virus carrying the interleukin-10 gene, administered intravenously, significantly prolonged the survival of mice with colorectal cancer liver metastases, achieving a cure rate of 45.5%, surpassing all previous preclinical study results. Furthermore, our tail vein injection of this recombinant oncolytic virus to treat the mouse model of colorectal cancer liver metastases more closely resembles clinical administration and facilitates future clinical translation. During the study, we found that in a mouse model of subcutaneous pancreatic cancer, intratumoral injection of vaccinia virus carrying interleukin-10 significantly delayed clearance, and this virus weakened antiviral immune responses while enhancing antitumor immune responses. Intraperitoneal injection of this recombinant oncolytic virus significantly prolonged the survival time of mutant KRAS and P53 transgenic pancreatic cancer mice, but all mice still died from pancreatic cancer. Based on existing databases of human tumors in different organs, we analyzed the specificity of IL10 expression in the tumor immune environment. We found no significant difference in IL10 expression levels between pancreatic tumors and normal pancreatic tissue, while IL10 expression levels in colorectal cancer in situ and liver metastases were significantly lower than in their corresponding normal tissues. Infecting tumor cells with vaccinia virus carrying IL10 resulted in the secretion of large amounts of IL10, which significantly altered the low-IL10 tumor microenvironment in colorectal cancer liver metastases. This is not limited by theoretical constraints and may be one of the reasons why the efficacy of this vaccinia virus in treating colorectal cancer liver metastases is significantly better than that of the previous treatment of pancreatic cancer with the same virus.

[0022] Compared to the control virus that does not express interleukin-10, the recombinant oncolytic virus expressing interleukin-10 was able to infiltrate the central liver metastases more extensively and persistently, and had a significant impact on the tumor immune microenvironment, not only increasing CD8... + and CD4 + T cell infiltration, and significantly inhibited F4 / 80 infiltration of metastatic lesions. + Macrophages. A study published in *Nature Immunology* found that IL10 upregulates CD8+. + Oxidative phosphorylation of T cell subsets enables metabolic reprogramming, thereby enhancing anti-tumor immunity. This suggests that the recombinant oncolytic virus expressing interleukin-10 in this study not only increased CD8+ in the tumor microenvironment but also... + The study published in *Nature Medicine* found that CD11b levels in liver metastases increased, and that the metabolic patterns of immune cells were altered. + F4 / 80 + Macrophage-induced antigen-specific CD8 + T cell apoptosis triggers immunosuppression in the tumor microenvironment and systemically, suggesting that the recombinant oncolytic virus expressing interleukin-10 significantly inhibited the F4 / 80 ratio in metastatic lesions in this study. + Macrophages play a crucial role in breaking this immunosuppression. Therefore, compared to the control virus, the recombinant oncolytic virus carrying IL10 not only prolonged the duration of viral activity in liver metastases but also reduced CD8+. + T cell apoptosis is of great value in breaking the tumor microenvironment and systemic immunosuppression.

[0023] This invention utilizes an oncolytic virus carrying the interleukin-10 encoding gene, enabling the oncolytic virus to express interleukin-10 after entering the body. This can largely overcome the two major challenges of viral clearance by the body's immune system and immunosuppression of liver metastases in the treatment of colorectal cancer liver metastases, thereby significantly improving the treatment effect of colorectal cancer liver metastases. Attached Figure Description

[0024] Figure 1 This is a graph showing the expression results of IL10 in tumors of different organs in humans according to an embodiment of the present invention.

[0025] Figure 2 The results of in vitro detection of the killing, replication and IL10 secretion of VVLΔTK-mIL10 and VVLΔTK-RFP on mouse colorectal cancer cell lines, provided by embodiments of the present invention.

[0026] Figure 3According to the embodiments of the present invention, a mouse colorectal cancer liver metastasis model was successfully constructed (metastatic lesions could be detected in mouse liver sections by HE staining 7 days after injection of CT26 cell line), and an oncolytic virus treatment strategy was determined based on the pathogenesis characteristics of the model.

[0027] Figure 4 The results are based on the survival time and color Doppler ultrasound examination of a mouse model of colorectal cancer liver metastasis treated with VVLΔTK-mIL10 and VVLΔTK-RFP, as provided in the embodiments of the present invention.

[0028] Figure 5 HE staining of sections from mice cured of a mouse model of colorectal cancer liver metastasis treated with VVLΔTK-mIL10 according to an embodiment of the present invention.

[0029] Figure 6 According to embodiments of the present invention, mouse livers were taken at different time points after treatment with VVLΔTK-mIL10 and VVLΔTK-RFP for immunohistochemical detection of VV, IL10 and macrophages.

[0030] Figure 7 According to embodiments of the present invention, mouse livers were taken at different time points after treatment with VVLΔTK-mIL10 and VVLΔTK-RFP for immunohistochemical detection of CD8. + and CD4 + T lymphocytes.

[0031] Figure 8 The results of detecting VV copy number and IL10 in peripheral blood of mice at different time points after VVLΔTK-mIL10 and VVLΔTK-RFP treatment, according to embodiments of the present invention, are provided. Detailed Implementation

[0032] The embodiments of the present invention are described in detail below. Examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, but should not be construed as limiting the present invention.

[0033] Oncolytic viruses possess significant potential for specifically lysing tumor cells and stimulating the body's immune response. However, when administered intravenously, they face challenges such as easy clearance by the immune system, making it difficult to ensure sufficient viral load reaches the tumor site. Vaccine virus (VV, also known as oncolytic vaccinia virus) serves as an example. VV possesses advantages such as the ability to load more exogenous genes, a strong self-promoter driving high expression of inserted therapeutic genes, natural tumor affinity, cell fusion infection to produce specific viral progeny, evasion of neutralizing antibodies and complement clearance in the circulatory system, and rapid dissemination. Thymidine kinase (TK)-deficient VV can selectively replicate in tumor cells. However, in a mouse model of colorectal cancer metastasis, VV alone only partially prolongs survival, and immunohistochemical staining shows VV concentrated at the tumor periphery. In the relevant clinical trial (NCT01387555), the oncolytic vaccinia virus JX-594 was very safe in the treatment of hepatocellular carcinoma patients, but it did not significantly improve median survival compared to best supportive care. Existing oncolytic viruses have certain limitations in cancer treatment, and new strategies are needed to enhance their anti-tumor efficacy.

[0034] One of the biggest challenges in oncolytic virus therapy is delivering a sufficient amount of virus to the tumor. In intravenous administration, the host immune system rapidly engulfs the virus through the mononuclear / macrophage system, including splenic red pulp macrophages and hepatic Kupffer cells. Secondly, neutralizing antibodies in the blood, the complement system, and resident or infiltrating leukocytes in the tumor all contribute to the attenuation of oncolytic viruses. While local inoculation of the tumor with oncolytic viruses can provide a sufficient amount, the virus remains confined to the inoculation site and does not spread to other metastatic sites. Therefore, intravenous injection is more suitable for tumors with multiple metastases or distant metastases where local injection is difficult. However, it is crucial to overcome the problem of early clearance of the oncolytic virus to ensure a sufficient amount of virus reaches the tumor to exert its oncolytic effect and promote the release of tumor-specific antigens and tumor-associated antigens to stimulate an immune response.

[0035] Interleukin-10 (IL-10) can inhibit viral clearance, thus promoting persistent viral infection. IL-10 also possesses potent anti-tumor activity and inhibits metastasis through an immune-dependent mechanism. IL-10 can inhibit infiltrating macrophages and angiogenic factors, and activate CD8+. + Cytotoxic T cells and inhibition of dendritic cell-mediated antigen-specific CD8 +T cell apoptosis. The inventors made a groundbreaking discovery: using vaccinia virus carrying IL10 allows the virus to infiltrate tumors for a longer period, facilitating its ability to lyse tumor cells and stimulate immune responses for an extended time. Simultaneously with viral replication, IL10 expression can be detected locally in the tumor. Therefore, by using vaccinia virus to carry IL10, IL10 can inhibit virus clearance while simultaneously maintaining continuous secretion through viral replication, effectively addressing the issue of IL10's short half-life. Furthermore, the IL10 secreted locally in the tumor does not affect overall IL10 levels, thus avoiding the uncertainty of systemic IL10 application's impact on the immune system and allowing IL10 to exert its effects locally in the tumor. In addition, the limited efficacy of IL10 alone in clinical trials is related to the fact that some tumors are "cold tumors," i.e., CD8+ tumors. + T cells have difficulty infiltrating the tumor microenvironment, and IL10 cannot bind to CD8. + IL10 binds to T cells and exerts its effect. Loading IL10 onto vaccinia virus allows the virus to exert its anti-tumor effect more significantly. Because vaccinia virus has high immunogenicity and releases large amounts of tumor-associated antigens and tumor-specific antigens during tumor cell lysis, it disrupts the suppressive tumor microenvironment, induces T cell infiltration, and thus enhances the anti-tumor effect of IL10. Therefore, oncolytic viruses carrying interleukin-10 can be used to treat colorectal cancer liver metastases, improving the treatment efficacy.

[0036] This invention provides the use of a recombinant oncolytic virus in the preparation of a drug for the treatment of liver metastases from colorectal cancer, wherein the recombinant oncolytic virus expresses interleukin-10.

[0037] The recombinant oncolytic viruses mentioned in this article contain nucleic acid molecules that insert one or more interleukin-10 coding genes into their genome. For example, they can carry one interleukin-10 coding gene, or, depending on the situation, two or three interleukin-10 coding genes.

[0038] The oncolytic viruses are selected from modified or engineered vaccinia virus strains such as Lister, Tiantan, New York, Copenhagen, Canary, and Ankara, as well as adenovirus, adeno-associated virus, herpes simplex virus, varicella-zoster virus, respiratory syncytial virus, Semleevirus, Epstein-Barr virus, Epstein-Barr virus, cytomegalovirus, human herpesvirus 6, smallpox virus, vaccinia virus, molluscum contagiosum virus, sheep pox virus, reovirus, rotavirus, enterovirus, Seneca virus, poliovirus, Coxsackie virus, rhinovirus, hepatitis A virus, foot-and-mouth disease virus, cloacal virus, alphavirus, Semleevirus, eastern equine encephalitis virus, Sindbis virus, rubella virus, coronavirus, flavivirus, and hepatitis C virus. Viruses, Japanese encephalitis virus, St. Louis encephalitis virus, Murray Valley fever virus, yellow fever virus, West Nile virus, Zika virus, dengue virus, Ebola virus, Marburg virus, sand virus, Lassa fever virus, lymphocytic choriomeningitis virus, Pichend virus, Junin virus, Machupo virus, Hantavirus, Rift Valley fever virus, paramyxovirus, human parainfluenza virus, mumps virus, simian virus, measles virus, vesicular stomatitis virus, rabies virus, orthomyxovirus, influenza A virus, influenza B virus, influenza C virus, hepatitis D virus, simian immunodeficiency virus, human immunodeficiency virus type 1 and human immunodeficiency virus type 2, Laureus sarcoma virus, human T-cell leukemia virus type 1, simian foamy virus, hepatitis B virus, hepatitis E virus, human papillomavirus or polyomavirus.

[0039] According to a specific implementation, the oncolytic virus is an oncolytic vaccinia virus, specifically a vaccinia virus lacking thymidine kinase. Compared to other viruses, oncolytic vaccinia viruses can carry more exogenous genes, have a strong self-promoter that drives the high expression of inserted exogenous genes, possess natural tumor-tropism, infect cells through membrane fusion to produce special forms of viral progeny, evade neutralizing antibodies and complement clearance in the circulatory system, and exhibit rapid dissemination, among other advantages.

[0040] The gene coding sequence of interleukin-10 is shown in SEQ ID NO:1 or SEQ ID NO:2.

[0041] The sequence SEQ ID NO:1 is the coding sequence for mouse interleukin-10, as shown below:

[0042] ATGCCTGGCTCAGCACTGCTATGCTGCCTGCTCTTACTGACTGGCATGAGGATCAGCAGGGGCCAGTACAGCCGGGAAGACAATAACTGCACCCACTTCCCAGTCGGCCAGAGCCACATGCTCCTAGAGCTGCGGACTGCCTTCAGCCAGGTGAAGACTTTCTTTCAAACAAAGGACCAGCTGGACAACATACTGCTAACCGACTCCTTAATGCAGGACTTTAAGGGTTACTTGGGTTGCCAAGCCTTATCGGAAATGATCCAGTTTTACCTGGTAGAAGTGATGCCCCAGGCAGAGAAGCATGGCCCAGAAATCAAGGAGCATTTGAATTCCCTGGGTGAGAAGCTGAAGACCCTCAGGATGCGGCTGAGGCGCTGTCATCGATTTCTCCCCTGTGAAAATAAGAGCAAGGCAGTGGAGCAGGTGAAGAGTGATTTTAATAAGCTCCAAGACCAAGGTGTCTACAAGGCCATGAATGAATTTGACATCTTCATCAACTGCATAGAAGCATACATGATGATCAAAATGAAAAGCTAA。

[0043] Among them, the SEQ ID NO:2 sequence is the coding sequence of human interleukin-10, as shown below:

[0044] .

[0045] According to a specific embodiment, the gene coding sequence of interleukin-10 is located in the thymidine kinase deletion region (TK) of the oncolytic vaccinia virus.

[0046] The vaccinia virus used was the Lister strain of vaccinia virus; its gene sequence can be found here.

[0047] The TK sequence at https: / / www.ncbi.nlm.nih.gov / nuccore / OR837118.1, located at 83588-84381 bp, has been replaced by the gene coding sequence for interleukin-10. Relevant literature can be found in "Suppression of Hyperglycemia in NOD Mice After Inoculation With Recombinant Vaccinia Viruses".

[0048] The drug has at least one of the following properties:

[0049] (a) Add CD8 + and CD4 + T cell infiltration;

[0050] (b) Significantly inhibited the F4 / 80 rate of colorectal cancer metastasis invasion. + Macrophages;

[0051] (c) Prolonging the duration of action of oncolytic viruses in liver metastases of colorectal cancer;

[0052] (d) Reduce CD8 + T cell apoptosis.

[0053] The present invention also provides a pharmaceutical composition for treating liver metastases of colorectal cancer, the pharmaceutical composition comprising a recombinant oncolytic virus and a pharmaceutically acceptable vector, the recombinant oncolytic virus expressing interleukin-10.

[0054] The pharmaceutical compositions mentioned also include pharmaceutically acceptable carriers. “Pharmaceutically acceptable carriers” include any and all transport media, solvents, diluents, excipients, adjuvants, dispersion media, coatings, antimicrobial and antifungal agents, absorbents, etc., which are acceptable for administration to mammals and, in particular, human subjects.

[0055] Recombinant oncolytic viruses can be placed in solvents or diluents suitable for human or animal use. The solvents or diluents mentioned can be isotonic, hypotonic, or weakly hypotonic solutions with relatively low ionic strength. Examples include sterile water, physiological saline (e.g., sodium chloride), glucose, trehalose or sucrose solutions, Hank's solution, etc.

[0056] Recombinant oncolytic viruses can also be buffered using suitable buffers. Buffers include, but are not limited to, phosphate-buffered saline (e.g., PBS), bicarbonate buffer, and / or Tris buffer, which can maintain a physiologically or slightly alkaline pH (e.g., from approximately pH 7 to approximately pH 9).

[0057] According to a specific embodiment, the recombinant oncolytic virus is administered via intravenous or intratumoral route. According to a preferred embodiment, the recombinant oncolytic virus is administered via intravenous injection.

[0058] The appropriate dose of oncolytic virus can be adjusted based on various parameters and can be determined routinely by practitioners according to relevant circumstances. The appropriate dose of oncolytic virus is approximately 10 [units unspecified] per kg of the subject. 5 To about 10 13 PFU, preferably from about 10 6 pfu to about 10 11 pfu, more preferably from about 10 6 PFU up to approximately 5x10 9 pfu; the preferred dosage is approximately 10 pfu. 6 pfu to about 108 Recombinant oncolytic virus of PFU. The oncolytic virus of the present invention can be administered in a single dose or multiple doses. If multiple doses are administered, they can be administered via the same or different routes and at the same or different sites. Continuous cyclic administration is also possible, repeated after a rest period. The interval between each administration can range from several hours to one year (e.g., 24h, 48h, 72h, weekly, bi-weekly, monthly, or annually). The interval can also be irregular (e.g., after tumor development).

[0059] In this study, oncolytic viruses can be administered once or multiple times (e.g., 2, 3, 4, 5, 6, 7, or 8 times), at a dose of 10 mg / kg of the subject. 6 Up to 5x10 7 The interval between each viral administration can vary from about 1 day to about 8 weeks, for example from about 2 days to about 6 weeks, preferably from about 2 days to about 4 weeks, and more preferably from about 2 weeks to about 3 weeks (e.g., every two or three weeks).

[0060] According to the specific implementation method, it includes 2-4 intravenous or intratumoral administrations of 1×10 6 -3×10 7 The recombinant oncolytic virus is administered at a rate of pfu (plaque forming units) / kg, with an interval of approximately 1 to 4 weeks (preferably 2 to 3 weeks). For example, approximately 1 week, 2 weeks, 3 weeks, or 4 weeks.

[0061] In some embodiments, the oncolytic virus mentioned can be prepared to improve its stability, particularly under production conditions and under long-term (i.e., at least 6 months, preferably at least 2 years) frozen (e.g., -70°C, -20°C), refrigerated (e.g., 4°C), and room temperature storage conditions. Various viral preparations commonly used in the art can be obtained, either in frozen liquid or lyophilized form, through vacuum drying and freeze-drying steps. During preservation, the addition of buffering agents containing salts or sugars is particularly suitable for preserving oncolytic viruses.

[0062] Any conventional route of administration, including enteric, local, or mucosal routes, can be used as needed. Enteric routes include injection or infusion, encompassing both systemic and local pathways. Common enteric injection types include intravenous (into a vein), intraarterial (into an artery), intradermal (into the dermis), subcutaneous (below the epidermis), intramuscular (into muscle), and intratumoral (into the tumor or very close to the tumor). Typical infusions are administered via intravenous routes. Mucosal administration includes, but is not limited to, oral / esophageal, intranasal, tracheal, intrapulmonary, intravaginal, or rectal routes. Local administration can also be achieved through transdermal means (e.g., patches, etc.). Depending on the specific implementation, the routes of administration for oncolytic viruses include intravenous and intratumoral routes.

[0063] This invention also provides a kit comprising a recombinant oncolytic virus and instructions, wherein the recombinant oncolytic virus expresses interleukin-10. The provided kit can be used to treat liver metastases from colorectal cancer.

[0064] The present invention also relates to a method for treating liver metastases of colorectal cancer, comprising administering a therapeutically effective amount of the recombinant oncolytic virus described herein to a subject in need.

[0065] The term "treatment" refers to slowing, curing, improving, or controlling the progression of a target pathological condition. For example, if a subject exhibits an observable improvement in their clinical condition after administration of a recombinant oncolytic virus as described herein, then the subject's colorectal cancer liver metastases are successfully treated. According to specific implementations, the term "therapeuticly effective dose" may refer to a therapeutic effect of at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% compared to treatment without recombinant oncolytic virus therapy.

[0066] Of course, in addition to the above-mentioned single application of recombinant oncolytic virus, it can also be used in combination with other therapies, such as radiotherapy or chemotherapy, to achieve the purpose of disease treatment. The recombinant oncolytic virus provided by this invention can also be used in combination with radiotherapy.

[0067] The technical solution of the present invention will be described below through specific embodiments. It should be noted that these specific embodiments are only used to facilitate understanding by those skilled in the art and should not be considered as limiting the scope of protection of the present invention. Unless otherwise specifically described, the reagents used in the embodiments can be obtained commercially or prepared using common knowledge known to those skilled in the art.

[0068] Example 1

[0069] In Example 1, VVLΔTK-mIL10 and VVLΔTK-RFP were prepared according to the following methods. VVLΔTK-mIL10 represents a recombinant vaccinia virus expressing mouse IL10, with the coding gene sequence of mouse IL10 shown in SEQ ID NO:1. VVLΔTK-RFP served as a control, representing a recombinant vaccinia virus expressing red fluorescent protein, with the coding gene sequence of red fluorescent protein shown in SEQ ID NO:3.

[0070] The sequence of SEQ ID NO:3 is shown below:

[0071] .

[0072] Using genetic engineering techniques, the sequence shown in SEQ ID NO:1 or SEQ ID NO:3 was inserted into the thymine kinase deletion region of vaccinia virus. The vaccinia virus used was the Lister strain, whose gene sequence can be found at https: / / www.ncbi.nlm.nih.gov / nuccore / OR837118.1. The TK sequence, located at 83588-84381 bp, was replaced with the gene coding sequence for interleukin-10. Recombinant oncolytic viruses expressing mouse IL10 or red fluorescent protein were obtained.

[0073] African monkey kidney CV1 cell lines were expanded, and the recombinant oncolytic virus seed virus was added to the cell culture medium for infection for 2 days. Cells were then collected, subjected to three freeze-thaw cycles, homogenized, and sonicated to fully release the virus. The virus was purified by density gradient centrifugation. TCID45 was then used to purify the virus. 50 The titer is determined by a method.

[0074] Example 2

[0075] Example 2 investigated the expression of IL10 in tumors of different human organs based on existing databases.

[0076] The results are as follows Figure 1 As shown. Among them Figure 1 In the table, a represents the pancreas, b represents the colon, c represents the rectum, and d represents the liver. The comparison of IL10 TPM (transcript per million) values ​​in normal tissues and corresponding tumor tissues from the TCGA database shows that there is no significant difference in IL10 expression between pancreatic cancer and normal pancreas, while the expression levels of IL10 in colon cancer, rectal cancer, and liver cancer are significantly lower than in their corresponding normal tissues. Therefore, infection of colorectal and liver tumors with IL10-carrying vaccinia virus followed by the secretion of large amounts of IL10 is beneficial in significantly altering the low-IL10 tumor microenvironment.

[0077] Example 3

[0078] Example 3 shows the results of in vitro detection of killing, replication, and IL10 secretion of mouse colorectal cancer cell lines using VVLΔTK-mIL10 and VVLΔTK-RFP.

[0079] The results are as follows Figure 2 As shown in the figure. Figure a represents the killing effect of VVLΔTK-RFP and VVLΔTK-mIL10 on the mouse colorectal cancer cell line CT26. Cell death was detected by the MTS assay 144 h after viral infection. Figure B represents the replication status of VVLΔTK-RFP and VVLΔTK-mIL10 in CT26 cells. Viral replication titer was determined by the TCID values ​​of CV1 cells. 50 Experimental determination. C represents the expression level of mIL10 at different time points after VVLΔTK-mIL10 injection. CT26 cells were infected with VVLΔTK-mIL10 at 1 pfu / cell, and supernatant was collected every 24 hours until 96 hours. IL10 levels were detected by ELISA. Data were normalized to the number of infected cells and displayed as pg IL10 / 1×10⁻⁶. 4 The results showed that VVLΔTK-mIL10 has a certain killing ability against CT26 in vitro, and can secrete a large amount of IL10 after infection.

[0080] Example 4

[0081] Example 4 established a mouse model of colorectal cancer liver metastasis. (As...) Figure 3 As shown.

[0082] in Figure 3 In Figure a, 7-8 week old male BALB / c rats were injected intrasplenically with 1.4 × 10⁻⁶ mg / L of the solution. 5 Seven days after CT26 cell culture, three mice were sacrificed, and their livers were harvested for sectioning and HE staining. The left image is magnified 10×4 with a scale bar of 500 μm; the right image is magnified 10×40 with a scale bar of 50 μm. The results showed that liver metastasis had occurred in all three mice. Figure 3 In case b, since multiple metastatic lesions had formed on the liver of this animal model 7 days after CT26 injection, a treatment plan was formulated to administer oncolytic virus via tail vein injection on days 7, 9, 11, 21, 23, and 25 after CT26 injection, and to observe the liver metastatic lesions by color Doppler ultrasound on day 28.

[0083] Example 5

[0084] Example 5 characterized the survival time, color Doppler ultrasound results, and HE staining results of relevant organ tissue sections from cured mice in a mouse model of colorectal cancer liver metastasis treated with VVLΔTK-mIL10 and VVLΔTK-RFP. Figure 4 , Figure 5 As shown.

[0085] in, Figure 4 Table a shows the survival of CT26 mice with colorectal cancer liver metastases after tail vein injection of oncolytic virus. Log-rank test showed that VVLΔTK-mIL10 significantly prolonged survival compared to the PBS group (P<0.0001). There was no significant difference in survival between the control virus VVLΔTK-RFP treatment group and the PBS group (P=0.95). Table b shows three mice from each group of CT26 mice with colorectal cancer liver metastases performed ultrasound 4 weeks after CT26 inoculation. Liver metastases are circled in red in the figure. It can be seen that the VVLΔTK-mIL10 treatment group had fewer and smaller liver metastases. Figure 5 For the HE staining experiment, five mice cured in the VVLΔTK-mIL10 group were sacrificed after 450 days of observation following CT26 inoculation. Liver, spleen, large intestine, and kidney tissues were collected, embedded, and sectioned. No tumor tissue was observed on the HE-stained sections. The section scale bar is 5mm, see the lower left corner of the image.

[0086] Example 6

[0087] Example 6 characterizes the VV / IL10 and macrophage status of mouse livers at different time points after VVLΔTK-mIL10 and VVLΔTK-RFP treatment.

[0088] like Figure 6As shown. Figure 6 In Figure 'a', mouse liver metastases with colorectal cancer are treated with vaccinia virus via tail vein injection at days 7, 9, and 11 after intrasplenic inoculation with CT26 cells, and tissue samples are collected at days 14 and 18 for mechanistic investigation. Figure 'b' shows the immunohistochemical staining of liver tissue from mice treated according to the protocol in Figure 'a', detecting VV, IL10, and F4 / 80. The magnification of the first, third, and fifth columns is 10×4, and the scale bar is 500 μm; the magnification of the second, fourth, sixth, and seventh columns is 10×40, and the scale bar is 50 μm. On the immunohistochemical sections 18 days after CT26 inoculation, the VVLΔTK-mIL10 treatment group showed significant VV infiltration into the center of the liver metastases, and macrophages (F4 / 80) were present in the VV-infiltrated metastases. + The number of macrophages in liver metastases was significantly lower than that in metastases without VV infiltration. c represents the total number of liver metastases and the number of VV-positive metastases on each group's sections, calculating the proportion of VV-infiltrating metastases to the total number of metastases at the corresponding time point. d represents the number of macrophages in liver metastases on each group's sections. Because significant VV infiltration into the center of metastases was observed in the VVLΔTK-mIL10 treatment group 18 days after CT26 intrasplenic inoculation, and a significant difference in F4 / 80 was observed between metastases with and without VV infiltration, the macrophage count at 18 days was divided into two groups. The statistics showed a significant decrease in the number of macrophages in VV-infiltrating metastases in the 18-day VVLΔTK-mIL10 treatment group. (F4 / 80 under ×400 microscope) + Macrophages were counted and graded according to the following criteria: Grade 1: 0-25 positive cells; Grade 2: 26-50 positive cells; Grade 3: 51-75 positive cells; Grade 4: more than 75 positive cells. These results show that, compared to the control virus, VVLΔTK-mIL10 can infiltrate the central part of liver metastases more extensively and persistently, while significantly inhibiting the F4 / 80 ratio of metastatic invasion. + Macrophages.

[0089] Example 7

[0090] Example 7 characterized the immunohistochemical detection of CD8 in mouse liver samples taken at different time points after VVLΔTK-mIL10 and VVLΔTK-RFP treatment. + and CD4 + T lymphocyte status.

[0091] like Figure 7 As shown. 'a' represents the order of... Figure 6 The experimental protocol in China involved taking mouse liver tissue, performing immunohistochemistry, and detecting indicators such as CD8 and CD4. Figure 7 In image a, the magnification is 10×40, and the scale bar is 50μm. Images b and c show the CD8 values ​​under high magnification for each group of metastatic lesions. + / CD4+ T cell counts were performed in at least several dozen high-power fields at each time point in each group. Statistical analysis showed that in the VVLΔTK-mIL10 treatment group, CD8+ levels in liver metastases were significantly increased 14 and 18 days after intrasplenic injection on CT26. + T cells and CD4 + T cell infiltration was significantly increased.

[0092] Example 8

[0093] Example 8 compared the results of VV copy number and IL10 in peripheral blood of mice at different time points after VVLΔTK-mIL10 and VVLΔTK-RFP treatment.

[0094] like Figure 8 As shown, mice with colorectal cancer liver metastases were treated with vaccinia virus via tail vein injection on days 7, 9, and 11 after intrasplenic inoculation with CT26. Peripheral blood was collected on days 14 and 18. Figure a shows the extraction of genome from a portion of peripheral blood, and the detection of VV copy number using a probe method. The results showed that the content of the control virus VVLΔTK-RFP in peripheral blood was significantly higher than that of VVLΔTK-mIL10. Figure b shows the collection of serum from another portion of peripheral blood after coagulation, and the detection of IL10 content using ELISA. The results showed that VVLΔTK-mIL10 did not significantly affect the IL10 level in peripheral blood. These results indicate that VVLΔTK-mIL10 has high safety.

[0095] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "implementation," and "specific implementation" refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0096] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. The use of a recombinant oncolytic virus in the preparation of a medicament for treating liver metastases of colorectal cancer, characterized in that, The recombinant oncolytic virus expresses interleukin-10; the coding sequence of interleukin-10 is shown in SEQ ID NO:2; The recombinant oncolytic virus is derived from oncolytic vaccinia virus, which is a vaccinia virus lacking thymine kinase; the interleukin-10 coding sequence is located in the thymine kinase-deficient region of the oncolytic vaccinia virus.

Images