CRISPR / dCas9-based DNA methylation editing system for Cynoglossus semilaevis and its application

Abstract

The present invention relates to a DNA methylation editing system and application thereof based on CRISPR / dCas9 and applicable to half-smooth tongue sole, belonging to the field of gene editing technology, wherein the system comprises a Fuw-UbC-dCas9-dnmt3a plasmid and a pGL3-U6-sgRNAs plasmid, wherein the dnmt3a gene sequence is shown in SEQ ID NO.1. The present invention also provides an editing system and application of the system in the half-smooth tongue sole emx2 gene, as well as guide RNAs sgRNA1 and sgRNA3. Both single transfection sgRNA and mixed transfection sgRNAs can effectively increase the promoter DNA methylation level of the emx2 gene, which increases by about 30%, 15.63% and 17.51%, respectively.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and relates to a CRISPR / dCas9-based DNA methylation editing system suitable for half-smooth tongue sole and an application thereof, and in particular to a CRISPR / dCas9-based system for performing DNA methylation editing on the half-smooth tongue sole emx2 gene. Background Art

[0002] DNA methylation is considered to be one of the key epigenetic modifications. It is widely distributed in the genome, with 5mC being the most common. The DNA methylation process is usually achieved through DNA methyltransferases (DNMTs) and DNA demethylases (TETs), which is usually a dynamic process that changes with environmental changes. With the development of high-throughput sequencing technology, the role of DNA methylation in the life process has gradually been revealed. DNA methylation is widely present in the genome of organisms. It changes chromosome accessibility through modification of histones and other epigenetic modifications, thereby inhibiting or promoting gene expression, and then regulating the life process during biological growth and development. It is one of the important foundations of biological development, aging, and disease. And the study shows that this modification of DNA methylation is heritable and can be passed between parents and offspring. For example, researchers found that the methylation pattern of the sex-reversed pseudo-male fish (ZW) of the half-smooth tongue sole is very different from that of the male fish (ZZ), and in the fertile offspring of the pseudo-male fish (ZW), its methylation landscape is similar to that of the parent pseudo-male fish (ZW), and the offspring fish with the genotype ZW are more likely to undergo sex reversal and become pseudo-male fish (ZW) compared with the offspring fish with male fish (ZZ) as parents. dnmt1 is an enzyme that maintains DNA methylation between different generations. During the replication of DNA, it first acts on the hemimethylated position, copies the DNA methylation pattern in the DNA chain to the daughter chain, realizes the persistence of DNA methylation, and thus realizes the transmission of DNA methylation between generations. However, the two enzymes dnmt3a and dnmt3b do not show this substrate preference, but are believed to be responsible for de novo methylation during environmental changes, thereby achieving biological adaptation to the environment.

[0003] CRIPSPR / dCas9 technology derived from CRISPR / Cas9 has emerged in epigenetic research. While achieving gene regulation, it can well circumvent the problems related to gene editing technology and make up for the shortcomings of gene editing technology. At present, epigenetic editing research applied to mammals, especially humans and mice, and plants has achieved very fruitful results. However, in fish that are deeply affected by epigenetics, relevant tools have not been established and related research is very few. Therefore, it is urgent to develop a set of epigenetic editing systems suitable for fish and apply them to fish gene research, which is of great significance to the research of marine fish. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a CRISPR / dCas9-based DNA methylation editing system suitable for half-smooth tongue sole and its application; through this system, the half-smooth tongue sole emx2 gene is targeted and edited, the DNA methylation level of its promoter region is changed, and its expression is further affected.

[0005] The technical solution provided by the present invention is as follows:

[0006] One of the technical solutions of the present invention is to provide a CRISPR / dCas9-based DNA methylation editing system suitable for Cynoglossus semilaevis, the system comprising a Fuw-UbC-dCas9-dnmt3a plasmid and a pGL3-U6-sgRNAs plasmid, the dnmt3a gene sequence is shown in SEQ ID NO.1. The Fuw-UbC-dCas9-dnmt3a plasmid is a promoter (Fuw-UbC), an anchor element (dCas9) and an editing effector element (dnmt3a); the pGL3-U6-sgRNAs plasmid is a guide element;

[0007] The second technical solution of the present invention is to provide the application of the editing system in editing the emx2 gene of Cynoglossus semilaevis.

[0008] The third technical solution of the present invention is to provide a CRISPR / dCas9-based DNA methylation editing system for editing the emx2 gene of the semi-smooth tongue sole, the system comprising a Fuw-UbC-dCas9-dnmt3a recombinant plasmid and a pGL3-U6-sgRNAs plasmid, wherein the nucleotide sequence of the sgRNAs is SEQ ID NO.2 and SEQ ID NO.3 and / or SEQ ID NO.4 and SEQ ID NO.5, the dnmt3a The nucleotide sequence of the gene is SEQ ID NO.1

[0009] As one of the preferred embodiments, the usage ratio of the two plasmids is 1:1.

[0010] The fourth technical solution of the present invention is to provide the application of sgRNA1 and / or sgRNA3 in the DNA methylation editing system for editing the emx2 gene of the semi-smooth tongue sole based on CRISPR / dCas9.

[0011] A fifth technical solution of the present invention is to provide a kit, which comprises the editing system described in one of the technical solutions or the editing system described in the third technical solution or sgRNA1 and / or sgRNA3.

[0012] The fifth technical solution of the present invention is to provide the application of the kit in DNA methylation editing of Cynoglossus semilaevis.

[0013] Beneficial effects of the present invention compared with the prior art: At present, the DNA methylation editing system based on CRISPR / dCas9 has been widely studied, however, the DNA methylation editing tool suitable for marine fish is still blank, which to a certain extent hinders the targeted study of DNA methylation in marine fish. The dnmt3a gene with the AdoMet_MTases superfamily as the catalytic domain is widely present in marine fish, especially in flatfish and sole marine fish. The present invention provides a DNA methylation editing system based on CRISPR / dCas9 for marine fish, especially for Cynoglossus semilaevis, and specifically provides a methylation editing system and application of the emx2 gene of Cynoglossus semilaevis, and designs guide RNA for the emx2 gene of Cynoglossus semilaevis, which are sgRNA1 and / or sgRNA3, respectively, to provide a tool for studying the targeted study of DNA methylation in marine fish. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Figure 1 is a diagram of the construction of the Fuw-UbC-dCas9-dnmt3a recombinant plasmid, wherein Figure A is an electrophoresis diagram of dnmt3a fragments, Figure B is an electrophoresis diagram of dnmt3a fusion fragments, and Figure C is a schematic diagram of the construction structure of the Fuw-UbC-dCas9-dnmt3a recombinant plasmid.

[0015] Figure 2 A is a construction verification diagram of the pGL3-U6-sgRNA recombinant plasmid, A is an electrophoresis diagram of the construction of the pGL3-U6-sgRNA recombinant plasmid, and B is a schematic diagram of the construction structure of the pGL3-U6-sgRNA recombinant plasmid;

[0016] Figure 3 A schematic diagram of a DNA methylation editing system applicable to Cynoglossus semilaevis;

[0017] Figure 4 The expression of emx2 gene under the guidance of different sgRNAs ( , p<0.001; , p <0.0001);

[0018] Figure 5 Figure 2 shows the DNA methylation level of the emx2 gene under the guidance of different sgRNAs. Figure A shows the DNA methylation of the blankcontrol group; Figure B shows the DNA methylation of the Fuw-UbC-dCas9-dnmt3a group; Figure C shows the DNA methylation of the Fuw-UbC-dCas9-dnmt3a + pGL3-U6-sgRNA1 group; Figure D shows the DNA methylation of the Fuw-UbC-dCas9-dnmt3a + pGL3-U6-sgRNA3 group; Figure E shows the DNA methylation of the Fuw-UbC-dCas9-dnmt3a + pGL3-U6-sgRNA1 / sgRNA3 group. DETAILED DESCRIPTION

[0019] The technical solution of the present invention is further studied below through examples, but the protection scope of the present invention is not limited in any form by the examples.

[0020] Example 1

[0021] The present invention constructs a CRISPR / dCas9-based DNA methylation editing system suitable for half-smooth tongue sole, comprising a Fuw-UbC-dCas9-dnmt3a plasmid and a pGL3-U6-sgRNAs plasmid that can act in sequence. The dCas9-dnmt3a plasmid comprises an anchor element and an editing effect element; the pGL3-U6-sgRNAs plasmid is a guide element.

[0022] Construction of a Fuw-UbC-dCas9-dnmt3a plasmid for a DNA methylation editing system in Cynoglossus semilaevis Figure 1 As shown, the steps are as follows:

[0023] (1) Using cDNA of gonadal tissue of Semilaevis semilaevis as a template, PCR amplification was performed using primers dnmt3a F and dnmt3a-1 R to obtain fragment 1; the nucleotide sequence of the primer dnmt3a F is shown in SEQ ID NO. 11 (5'-ATGATGCCGTCCAACGCCGT-3'), and the nucleotide sequence of the primer dnmt3a-1 R is shown in SEQ ID NO. 12 (5'-ACTTAGGGCAGGTCTTGTCTCC-3');

[0024] (2) Using cDNA of gonadal tissue of Cynoglossus semilaevis as a template, PCR amplification was performed using primers dnmt3a-2 F and dnmt3a-2 R to obtain fragment 2; the nucleotide sequence of the primer dnmt3a-2 F is shown in SEQ ID NO. 13 (5'-GACAAGGACGAAGACAGCCTG-3'), and the nucleotide sequence of the primer dnmt3a-2 R is shown in SEQ ID NO. 14 (5'-CCACGTAGCGGTCCACCTGA-3');

[0025] (3) Using cDNA of gonadal tissue of Cynoglossus semilaevis as a template, PCR amplification was performed using primers dnmt3a-3 F and dnmt3a R to obtain fragment 3; the nucleotide sequence of the primer dnmt3a-3 F is shown in SEQ ID NO. 15 (5'-AGGATTTTCAACCCCCAAAG-3'), and the nucleotide sequence of the primer dnmt3a R is shown in SEQ ID NO. 16 (5'-TCAAACACAGGCAAAGTATTCT-3');

[0026] (4) Fragment 1 obtained in step (1), fragment 2 obtained in step (2), and fragment 3 obtained in step (3) were mixed, and PCR cloned and amplified using primers dnmt3a F and dnmt3a R to obtain fusion fragment 4, the sequence of which is as shown in SEQ ID NO. 1; the mixed fragment was diluted to 100 times with sterile enzyme-free water as a template.

[0027] (5) The fusion fragment obtained in step (4) and the Fuw-UbC-dCas9 vector (commercial plasmid purchased from Addgene) were double-digested, and the fusion fragment 4 and the Fuw-UbC-dCas9-dnmt3a vector were double-digested with EcoR Ⅰ and BamH Ⅰ, respectively. The digested fusion fragment 4 and the digested vector were reacted at a molar ratio of 1:1 under the action of T4 ligase at 37°C for 1 hour to obtain the Fuw-UbC-dCas9-dnmt3a recombinant plasmid containing the semilaevis dnmt3a gene, as shown in Figure 1 C in.

[0028] Example 2

[0029] A pGL3-U6-sgRNA plasmid for the DNA methylation editing system of Cynoglossus semilaevis is constructed, and the steps are as follows:

[0030] Using pGL3-U6-sgRNA plasmid (purchased from Addgene, with a universal series of sgRNA) as a template, primers sgRNA F and sgRNA R were used, and TOYOBO KOD high-fidelity enzyme was used for reverse PCR amplification; the system used was: KOD 2×Master Mix 12.5 μL, primers 0.7 μL each, Pgl3-U6-sgRNA 20 ng, and sterile enzyme-free water to make up the system to 25 μL.

[0031] When the first base of the designed sgRNA sequence is not G, the sequence of primer sgRNA F is: ACCG--------------------GTTTTAGAGCTAGAAATAGCAAG (SEQ ID NO.19, where - represents the designed sgRNA sequence, a total of 20 bases); the sequence of primer sgRNA R is--------------------CGGTGTCCTTTCCACAAGATATATAAAG (SEQ ID NO.20, where - represents the reverse complementary sequence of the designed sgRNA sequence, a total of 20 bases); when the first base of the designed sgRNA sequence is G, the sequence of primer sgRNA F is: ACC--------------------GTTTTAGAGCTAGAAATAGCAAG (SEQ ID NO.21, where - represents the designed sgRNA sequence, a total of 20 bases); the sequence of primer sgRNA R is--------------------GGTGTCCTTTCCACAAGATATATAAAG (SEQ ID NO.22, where - represents the reverse complementary sequence of the designed sgRNA sequence, a total of 20 bases);

[0032] (2) The obtained PCR product was digested with Dpn Ⅰ, with the volume ratio of PCR product to Dpn1 enzyme being 10:1, and the digestion was carried out at 37°C for 30 minutes. The recombinant plasmid was obtained;

[0033] (3) The recombinant plasmid was transformed into competent cells, and a single clone was selected for sequencing verification. The sequencing primer used was universal primer RV3 (SEQ ID NO. 10) (CTAGCAAATAGGCTGTCCC) for unidirectional sequencing.

[0034] Example 3

[0035] A CRISPR / dCas9-based DNA methylation editing system for Cynoglossus semilaevis, taking the emx2 gene of Cynoglossus semilaevis as an example, comprises the following steps:

[0036] (1) Cloning the dnmt3a gene of Cynoglossus semilaevis, and ligating the dnmt3a gene with the linearized Fuw-UbC-dCas9-dnmt3a plasmid using T4 ligase to construct a recombinant plasmid;

[0037] (2) Using the inverse PCR method, the sequences of sgRNAs targeting different sites of the emx2 gene (20 nt) were recombined into the pGL3-U6-sgRNA plasmid;

[0038] (3) The Fuw-UbC-dCas9-dnmt3a plasmid and pGL3-U6-sgRNA plasmid of the DNA methylation editing system were transfected into the testicular cells of Semiloach semilaevis;

[0039] (4) Determine the expression level of emx2 gene using qPCR method;

[0040] (5) Determine the DNA methylation level of the promoter region of the emx2 gene using bisulfite sequencing;

[0041] The effect of the above system on the emx2 gene in Cynoglossus semilaevis cells is specifically described by the following examples.

[0042] Example 4: Design of pGL3-U6-sgRNA vectors targeting different sites of the emx2 gene.

[0043] In order to obtain a sgRNA sequence that can target the emx2 gene, the present invention analyzes the CpG island of the emx2 gene by using the online tool MethPrimer () for the promoter sequence of the emx2 gene, and designs two sequences specifically targeting emx2, sgRNA1 sense sequence: GCGGACTCGAGCGCGCAACA (SEQ ID NO.2); sgRNA1 antisense sequence: TGTTGCGCGCTCGAGTCCGC (SEQ ID NO.3); sgRNA3 sense sequence: CGCGGTCCCTGTGCATCCCG (SEQ ID NO.4): sgRNA3 antisense sequence: CGGGATGCACAGGGACCGCG (SEQ ID NO.5).

[0044] The primer sequences for constructing pGL3-U6-sgRNA plasmid were artificially synthesized, the forward primer of sgRNA1 (SEQ ID NO.6): accGCGGACTCGAGCGCGCAACAgttttagagctagaaatagcaag; the reverse primer of sgRNA1 (SEQ ID NO.7): TGTTGCGCGCTCGAGTCCGCggtgtcctttccacaagatatataaag; the forward primer of sgRNA3 (SEQ ID NO.8): accgCGCGGTCCCTGTGCATCCCGgttttagagctagaaatagcaagttaaaa; the reverse primer of sgRNA3 (SEQ ID NO.9): CGGGATGCACAGGGACCGCGcggtgtcctttccacaagatatataaagcc.

[0045] The designed sgRNAs primers were connected to the vector pGL3-U6-sgRNA (purchased from Addgene, a universal series with sgRNA) using the inverse PCR method, and TOYOBO KOD (2 × Master Mix) high-fidelity enzyme was used for PCR. The specific steps are as follows:

[0046] ;

[0047] Inverse PCR amplification was performed in a PCR instrument, and the reaction procedure was as follows:

[0048] ;

[0049] The PCR product and Dpn1 enzyme were mixed at a volume ratio of 10:1 and digested at 37°C for 30 minutes.

[0050] The plasmid after enzyme digestion was verified by electrophoresis. Figure 2 shown.

[0051] The verified plasmid was sequenced and the universal primer RV3 (CTAGCAAATAGGCTGTCCC, SEQ ID NO. 10) was selected as the sequencing primer for unidirectional sequencing.

[0052] Example 5

[0053] The DNA methylation editing system targeting emx2 prepared in Examples 3 and 4 was transfected into the testicular cells of Cynoglossus semilaevis. The process of DNA methylation is as follows Figure 3 As shown, the specific steps are as follows:

[0054] (1) Use a spectrophotometer to measure the concentration of the two plasmids in the DNA methylation editing system;

[0055] (2) The cells were seeded into a six-well plate and cultured at 24°C for about 24 hours. When the cell mass grew to 70%-80%, transfection was performed.

[0056] (3) Replace the cell culture medium with a medium containing 50% serum, while keeping other culture conditions unchanged;

[0057] (4) Lipofectamine™ 3000 reagent was used for transfection according to the instructions. Two control groups were designed, namely, the control group without plasmid transfection and the control group with only Fuw-UbC-dCas9-dnmt3a editing plasmid transfection but no pGL3-U6-sgRNA targeting plasmid transfection; three treatment groups were designed, namely, the pGL3-U6-dCas9-dnmt3a + pGL3-U6-sgRNA1 co-transfection group, the pGL3-U6-dCas9-dnmt3a + pGL3-U6-sgRNA3 co-transfection group, and the pGL3-U6-dCas9-dnmt3a + pGL3-U6-sgRNA1 + pGL3-U6-sgRNA3 co-transfection group. Among them, the transfection amount of pGL3-U6-dCa9-dnmt3 plasmid was 1000 ng, the transfection amount of sgRNA plasmid was 1000 ng, and 500 ng GFP plasmid was added to characterize the transfection efficiency;

[0058] (5) After transfection, culture for about 6-8 hours and replace with whole blood culture medium;

[0059] (6) Continue the culture for 3 days.

[0060] Example 6: Determination of the expression level of the emx2 gene under the guidance of different sgRNAs

[0061] The edited half-smooth tongue sole cells in Example 5 were collected, and total RNA of the cells was extracted by Trizol method, and reverse transcribed by Takara Primescript RT Reagent kit with gDNA Eraser kit to obtain cDNA. qPCR was performed using QuantiNova SYBR PCR Mix Kit, and the results were as follows: Figure 4 The qPCR results showed that emx2 Gene expression was significantly suppressed ( p <0.01). The expression of genes targeted by sgRNA1 and sgRNA3 were both downregulated by about 2-fold. The expression of genes targeted by a mixture of sgRNA1 and sgRNA3 was downregulated by about 1.35-fold.

[0062] Example 7: Determination of DNA methylation levels in the promoter region of the emx2 gene guided by different sgRNAs

[0063] A portion of the cells collected in Example 6 was separated, and the cell genomic DNA was extracted using a DNA extraction kit. The genomic DNA was treated with bisulfite, and the promoter region of the emx2 gene was amplified by DNA methylation-specific PCR. The DNA methylation status of the promoter region of the emx2 gene was determined by Sanger sequencing. The DNA methylation-specific PCR positive primer used was BS-F: 5'-TTTTTTTGATTAAAGGGAATAAATTAAA-3' (SEQ ID NO.17), and the antisense primer was BS-R: 5'-TCCCCATTTAATACTATTTAATAACCAC-3' (SEQ ID NO.18). The bisulfite sequencing results are shown in FIG. Figure 5 As shown, both single transfection of sgRNA and mixed transfection of sgRNAs can effectively increase emx2 The promoter DNA methylation levels of the genes increased by approximately 30%, 15.63% and 17.51%, respectively.

[0064] dnmt3a-DNA (SEQ ID NO.1)

[0065]

Claims

1. A CRISPR / dCas9-based DNA methylation editing system for editing the emx2 gene of Cynoglossus semilaevis, characterized in that: The system includes a Fuw-UbC-dCas9-dnmt3a recombinant plasmid and a pGL3-U6-sgRNAs plasmid; the dosage ratio of the two plasmids is 1:1; The Fuw-UbC-dCas9-dnmt3a recombinant plasmid includes the dnmt3a gene, and the nucleotide sequence of the dnmt3a gene is SEQ ID NO.1; The pGL3-U6-sgRNAs plasmid includes sgRNA1 and / or sgRNA3, the nucleotide sequence of the sgRNA1 is SEQ ID NO.2 and SEQ ID NO.3, and the nucleotide sequence of the sgRNA3 is SEQ ID NO.4 and SEQ ID NO.

5.

2. Application of sgRNA1 and / or sgRNA3 in a DNA methylation editing system for editing the emx2 gene of Cynoglossus semilaevis based on CRISPR / dCas9, characterized in that: The nucleotide sequence of sgRNA1 is SEQ ID NO.2 and SEQ ID NO.3, the nucleotide sequence of sgRNA3 is SEQ ID NO.4 and SEQ ID NO.5, and the DNA methylation editing system also includes a Fuw-UbC-dCas9-dnmt3a recombinant plasmid, the Fuw-UbC-dCas9-dnmt3a recombinant plasmid includes a dnmt3a gene, and the nucleotide sequence of the dnmt3a gene is SEQ ID NO.

1.

3. A kit, characterized in that: The kit comprises the editing system of claim 1.

4. Use of the kit according to claim 3 in DNA methylation editing of the emx2 gene for non-therapeutic purposes in Cynoglossus semilaevis.

Images