RNA Combinations and Their Application in Diagnostic Markers for Recurrent Miscarriage

Abstract

The present invention provides the application of RNA in the diagnosis and treatment of recurrent miscarriage, belonging to the technical fields of biomedicine and molecular biology. The present invention discovers for the first time that the expression levels of lncRNA lnc-SLC5A8-3, lncRNA MYCBP and lncRNA LOC100190940 or has_circ_0054403, hsa_circ_0020897 and hsa_circ_0072745 are closely related to recurrent miscarriage, and their sensitivity and specificity in the diagnosis of recurrent miscarriage are relatively high, and it is determined that they can be used as markers for predicting recurrent miscarriage. At the same time, it also provides treatment targets for the subsequent treatment of recurrent miscarriage. Therefore, it has good practical application value.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to the application of lncRNAs or circRNAs as markers for recurrent spontaneous abortion. Background Art

[0002] The statements in this part merely provide background technical information related to the present invention and do not necessarily constitute prior art.

[0003] Recurrent spontaneous abortion (RSA) refers to the clinical loss of pregnancy that occurs 2 or more times before 20 weeks of gestation or with a fetal weight of less than 500 g, and its incidence accounts for about 1% - 3% of pregnancy outcomes. The etiology of RSA is extremely complex. In addition to clear etiologies such as genetic factors, uterine anatomical structure abnormalities, and infections, there are also cases of recurrent spontaneous abortion with unknown causes. Due to the lack of effective clinical treatment measures, RSA has currently become one of the important causes of infertility. Therefore, it is crucial to explore the etiology and pathogenesis of RSA, detect RSA as early as possible, and take certain intervention measures.

[0004] In existing detection methods, most directly detect proteins or cytokines in placental tissue, villous tissue, serum, or urine to characterize RSA, and there are few reports on detecting the expression levels of substances in extracellular vesicles in serum to predict RSA. Extracellular vesicles (EVs) are nanoparticles coated with a phospholipid bilayer, containing different substances such as proteins, lipids, nucleic acids, and small molecule metabolites, and are natural nanoparticles produced by cells and can be obtained from almost all biological fluids.

[0005] Long non-coding RNA (lncRNA) is a non-coding RNA with a transcript length greater than 200 nt. Although lncRNA does not participate in the protein coding process, it plays an important role in gene transcription and post-transcriptional regulation. Studies have found that there are hundreds of lncRNAs in serum, which are relatively stable in nature, abundant in expression, highly specific, and easy to quantitatively detect. It has been reported that the expression profile of plasma lncRNA has a certain suggestive effect on early diagnosis in diseases such as lung cancer and colon cancer and can be used as a potential biomarker for these diseases. However, there are still few relevant studies on the role of lncRNA in recurrent spontaneous abortion. Therefore, it is necessary to explore more effective lncRNAs as markers for clinical diagnosis, treatment, and detection of RSA, providing a basis for the diagnosis, treatment of RSA, and the development of related drugs.

[0006] Circular RNA (circRNA) is a novel class of regulatory competitive endogenous non-coding RNA molecules that widely exist in the eukaryotic cytoplasm. Different from traditional linear RNA (linear RNA, containing 5' and 3' ends), circRNA presents a closed circular structure, is not easily degraded by exonucleases, has more stable expression, and has characteristics such as high abundance, stable structure, and tissue specificity. Research shows that circRNA can bind to miRNA, relieve the inhibitory effect of miRNA, and increase the expression level of target genes; by interacting with disease-associated miRNA, circRNA plays an important regulatory role in diseases. At the same time, circRNA has characteristics such as universality, conservativeness, tissue specificity, and stability, making it have great potential as a marker for disease screening and treatment. With the rapid development of high-throughput sequencing and molecular bioinformatics technologies, it indicates that it will become a new type of biomarker in the future. Currently, many studies have suggested that circRNA may have unique and important functions during embryonic development and pregnancy establishment. However, circRNA as a candidate molecule for identifying RSA has less clinical application. Therefore, it is necessary to explore effective circRNA as a marker for clinical diagnosis, treatment, and detection of RSA, providing a basis for the diagnosis, treatment of RSA, and the development of related drugs. Summary of the Invention

[0007] To overcome the deficiencies of the above-mentioned prior art, the present invention provides a diagnostic marker for recurrent spontaneous abortion. The present invention first discovers that the expression levels of lncRNA lnc-SLC5A8-3, lncRNA MYCBP, and lncRNA LOC100190940 are closely related to recurrent spontaneous abortion, and the sensitivity and specificity of the above lncRNA in the diagnosis of recurrent spontaneous abortion are very high; at the same time, the present invention also discovers that the expression levels of has_circ_0054403, hsa_circ_0020897, and hsa_circ_0072745 are closely related to recurrent spontaneous abortion, and the sensitivity and specificity of the above circRNA in the diagnosis of recurrent spontaneous abortion are very high. Therefore, lncRNA lnc-SLC5A8-3, lncRNA MYCBP, and lncRNA LOC100190940 or has_circ_0054403, hsa_circ_0020897, and hsa_circ_0072745 can be used as predictive diagnostic markers and potential therapeutic targets for recurrent spontaneous abortion, thus completing the present invention.

[0008] To achieve the above object, one or more embodiments of the present invention provide the following technical solutions:

[0009] In the first aspect of the present invention, there is provided the use of a substance for detecting lncRNA markers in the preparation of a product for predicting recurrent miscarriage, wherein the lncRNA markers include lncRNA lnc-SLC5A8-3, lncRNA MYCBP, and lncRNA LOC100190940; specifically, the sequence of the lncRNA lnc-SLC5A8-3 is as shown in SEQ ID NO.1; the sequence of the lncRNA MYCBP is as shown in SEQ ID NO.2; and the sequence of the lncRNA LOC100190940 is as shown in SEQ ID NO.3.

[0010] In yet another specific embodiment of the present invention, the substance for detecting lncRNA markers includes a primer set for detecting lncRNA markers, and the primer set consists of the following primers:

[0011] The upstream primer for detecting lncRNA lnc-SLC5A8-3 has the nucleotide sequence shown in SEQ ID NO.7, and the downstream primer has the nucleotide sequence shown in SEQ ID NO.8;

[0012] The upstream primer for detecting lncRNA MYCBP has the nucleotide sequence shown in SEQ ID NO.9, and the downstream primer has the nucleotide sequence shown in SEQ ID NO.10;

[0013] The upstream primer for detecting lncRNA LOC 100190940 has the nucleotide sequence shown in SEQ ID NO.11, and the downstream primer has the nucleotide sequence shown in SEQ ID NO.12;

[0014] The upstream primer for detecting the internal reference gene 18S has the nucleotide sequence shown in SEQ ID NO.19, and the downstream primer has the nucleotide sequence shown in SEQ ID NO.20.

[0015] In yet another specific embodiment of the present invention, the lncRNA is selected from the blood of the subject; preferably serum; further, the lncRNA is selected from the extracellular vesicles of the subject; and the product is a detection kit.

[0016] In the second aspect of the present invention, there is provided a system, which includes:

[0017] i) An analysis module, which is used to determine the expression level of the lncRNA selected from the first aspect in the test sample of the subject, and;

[0018] ii) An evaluation module, which is used to predict whether the subject is a patient with recurrent miscarriage according to the expression level of the lncRNA determined in i);

[0019] Furthermore, the system further includes a result output module for outputting the results analyzed by the evaluation module.

[0020] Preferably, the subject is or is a candidate for a recurrent miscarriage patient; conversely, the subject is not or is not a candidate for a recurrent miscarriage patient; the test product is extracellular vesicle RNA of the subject's blood cells, and further is extracellular vesicle RNA in serum.

[0021] In a third aspect of the present invention, there is provided the use of lncRNA as a target in the treatment of recurrent miscarriage and / or screening of drugs for recurrent miscarriage.

[0022] The lncRNA includes lncRNA lnc-SLC5A8-3, lncRNA MYCBP, and lncRNA LOC100190940.

[0023] Preferably, the method for screening drugs for recurrent miscarriage includes:

[0024] 1) Treat a system expressing and / or containing the lncRNA with a candidate substance; set up a parallel control without treating with the candidate substance.

[0025] 2) After completing step 1), detect the expression level of the lncRNA in the system; compared with the parallel control, if the expression of lncRNA lnc-SLC5A8-3 in the system treated with the candidate substance is significantly decreased, and the expressions of lncRNA MYCBP and lncRNA LOC100190940 are significantly increased, the candidate substance can be used as a candidate drug for recurrent miscarriage.

[0026] In a fourth aspect of the present invention, there is provided the use of a substance for detecting circRNA markers in the preparation of a product for predicting recurrent miscarriage. The circRNA markers include has_circ_0054403, hsa_circ_0020897, and hsa_circ_0072745. Specifically,

[0027] The sequence of Has_circ_0054403 is as shown in SEQ ID NO.4.

[0028] The sequence of hsa_circ_0020897 is as shown in SEQ ID NO.5.

[0029] The sequence of hsa_circ_0072745 is as shown in SEQ ID NO.6.

[0030] In yet another specific embodiment of the present invention, the detection of circRNA markers includes a primer set for detecting circRNA markers, and the primer set consists of the following primers:

[0031] The upstream primer for detecting Has_circ_0054403 has the nucleotide sequence shown in SEQ ID NO.13, and the downstream primer has the nucleotide sequence shown in SEQ ID NO.14;

[0032] The upstream primer for detecting hsa_circ_0020897 has the nucleotide sequence shown in SEQ ID NO.15, and the downstream primer has the nucleotide sequence shown in SEQ ID NO.16;

[0033] The upstream primer for detecting hsa_circ_0072745 has the nucleotide sequence shown in SEQ ID NO.17, and the downstream primer has the nucleotide sequence shown in SEQ ID NO.18;

[0034] The upstream primer for detecting the reference gene 18S has the nucleotide sequence shown in SEQ ID NO.19, and the downstream primer has the nucleotide sequence shown in SEQ ID NO.20.

[0035] In yet another specific embodiment of the present invention, the circRNA is selected from the blood of the subject; preferably serum; further, the circRNA is selected from the extracellular vesicles of the subject; the product is a detection kit.

[0036] In the fifth aspect of the present invention, there is provided a system, which includes:

[0037] i) An analysis module, which is used to determine that the sample to be tested of the subject is selected from the expression level of the circRNA described in claim 6, and;

[0038] ii) An evaluation module, which is used to predict whether the subject is a recurrent miscarriage patient according to the expression level of the circRNA determined in i);

[0039] Further, the system further includes a result output module, which is used to output the result analyzed by the evaluation module;

[0040] Preferably, the subject is or is a candidate for a recurrent miscarriage patient; conversely, the subject is not or is not a candidate for a recurrent miscarriage patient; the sample to be tested is the extracellular vesicle RNA of the subject's blood cells; further it is the extracellular vesicle RNA in serum.

[0041] In the sixth aspect of the present invention, there is provided the application of circRNA as a target in the treatment of recurrent miscarriage and / or screening of drugs for recurrent miscarriage;

[0042] The circRNAs include has_circ_0054403, hsa_circ_0020897, and hsa_circ_0072745;

[0043] Preferably, the method for screening drugs for recurrent miscarriage includes:

[0044] 1) Treating a system expressing and / or containing the circRNAs with a candidate substance; setting up a parallel control without treating with the candidate substance;

[0045] 2) After completing step 1), detecting the expression level of the circRNAs in the system; compared with the parallel control, if the expression of has_circ_0054403 in the system treated with the candidate substance is significantly decreased, and the expressions of hsa_circ_0020897 and hsa_circ_0072745 are significantly increased, the candidate substance can be used as a candidate drug for recurrent miscarriage.

[0046] The above one or more technical solutions have the following beneficial effects:

[0047] The above technical solutions are proved by experiments that high expression of lncRNA lnc-SLC5A8-3, low expressions of lncRNA MYCBP and lncRNA LOC100190940 are closely related to recurrent miscarriage, and the above lncRNAs have high sensitivity and specificity in the diagnosis of recurrent miscarriage.

[0048] The above technical solutions are proved by experiments that up-regulated expression of has_circ_0054403, down-regulated expressions of hsa_circ_0020897 and hsa_circ_0072745 are closely related to recurrent miscarriage, and the above circRNAs have high sensitivity and specificity in the diagnosis of recurrent miscarriage.

[0049] The present invention uses 18S as an internal reference gene for detecting lncRNAs or circRNAs in serum extracellular vesicles, and develops a corresponding detection kit. The kit has high detection sensitivity, high specificity, and convenient detection, meets the detection requirements for predicting patients with recurrent miscarriage, and has a high diagnostic accuracy through clinical verification.

[0050] Advantages of additional aspects of the present invention will be partly given in the following description, partly will become obvious from the following description, or will be understood through the practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] The accompanying drawings of the specification, which form a part of the present invention, are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention.

[0052] Figure 1 It is the volcano plot of differential gene expression in the first embodiment of the present invention; Figure 1 A represents the volcano plot of differential expression of lncRNAs; Figure 1 B represents the volcano plot of differential expression of circRNAs.

[0053] Figure 2 It is the expression level diagram of lncRNA lnc-SLC5A8-3, lncRNA MYCBP and lncRNA LOC100190940 in the serum extracellular vesicles of recurrent miscarriage patients and normal pregnancies in the embodiment of the present invention; where A is lncRNA lnc-SLC5A8-3, B is lncRNA MYCBP; C is lncRNA LOC100190940; 0.01 < P < 0.05 indicates significant difference; P < 0.01 indicates extremely significant difference.

[0054] Figure 3 It is the expression level diagram of has_circ_0054403, hsa_circ_0020897 and hsa_circ_0072745 in the serum extracellular vesicles of recurrent miscarriage patients and normal pregnancies in the embodiment of the present invention; where A is has_circ_0054403, B is hsa_circ_0020897; C is hsa_circ_0072745; 0.01 < P < 0.05 indicates significant difference; P < 0.01 indicates extremely significant difference.

[0055] Figure 4 It is the ROC analysis diagram of the diagnosis of recurrent miscarriage by lncRNAs in the serum extracellular vesicles in the embodiment of the present invention; where A is lncRNA lnc-SLC5A8-3, B is lncRNA MYCBP; C is lncRNA LOC100190940; D is the combined ROC curve of 3 LncRNAs.

[0056] Figure 5 It is the ROC analysis diagram of the diagnosis of recurrent miscarriage by circRNAs in the serum extracellular vesicles in the implementation of the present invention; where A is has_circ_0054403, B is hsa_circ_0020897; C is hsa_circ_0072745; D is the combined ROC curve of 3 circRNAs. Detailed implementation manners

[0057] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are generally carried out under conventional conditions or according to the conditions recommended by the manufacturers.

[0058] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should also be understood that when the terms "comprising" and / or "including" are used in this specification, they specify the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0059] The terms "indicator" and "marker" are used interchangeably in the present invention and refer to signs or signals of a disorder or for monitoring a disorder. Such a "disorder" refers to the biological state of a cell, tissue or organ, or to the health and / or disease state of an individual. An indicator can be the presence or absence of a molecule including but not limited to a peptide, protein and nucleic acid, or can be a change in the expression level or pattern of such a molecule in a cell, or tissue, organ or individual. An indicator can be a sign of the occurrence, development or presence of a disease in an individual or the further progression of such a disease. An indicator can also be a sign of the risk of developing a disease in an individual.

[0060] In principle, a reference quantity can be calculated for the object groups or populations specified by the present invention based on the mean or median of a given marker by applying standard statistical methods. In particular, for example, the precision of a test, whether it is a method aimed or not aimed at judging an event, is best described by its receiver-operating characteristic (ROC) (see especially Zweig 1993, Clin.Chem. 39: 561-577). An ROC plot is a plot of all sensitivity-versus-specificity pairs obtained by varying the decision threshold continuously over the entire observed data range. The clinical performance of a diagnostic method depends on its precision, i.e., its ability to correctly assign an object to a certain prognosis or diagnosis. The ROC plot represents the overlap between two distributions by plotting sensitivity versus 1-specificity over the complete threshold range suitable for discrimination. On the y-axis is the sensitivity or true positive fraction, which is defined as the ratio of the number of true positive test results to the sum of the number of true positive and false negative test results. This is also called positive in the presence of a disease or disorder. It is calculated separately for the affected subgroup. On the x-axis is the false positive fraction or 1-specificity, which is defined as the ratio of the number of false positive results to the sum of the number of true negative and false positive results. It is an index of specificity and is calculated entirely from the unaffected subgroup. Since the true and false positive fractions are calculated completely separately, the ROC plot is independent of the prevalence of the event in the population by using test results from two different subgroups. Each point on the ROC plot represents a sensitivity / -specificity pair corresponding to a particular decision threshold. A test with perfect discrimination (no overlap in the two outcome distributions) has an ROC plot passing through the upper left corner, where the true positive fraction is 1.0 or 100% (perfect sensitivity) and the false positive fraction is 0 (perfect specificity). The theoretical plot of a test with no discrimination (identical distribution of the two sets of results) is a 45° diagonal line from the lower left corner to the upper right corner. Most plots fall between these two extremes. If the ROC plot falls completely below the 45° diagonal line, this can be easily corrected by reversing the "positive" criterion from "greater than" to "less than" and vice versa. Qualitatively, the closer the plot is to the upper left corner, the higher the overall precision of the test. Depending on the desired confidence interval, a threshold can be derived from the ROC curve, allowing the diagnosis or prediction of a given event with an appropriate balance of sensitivity and specificity, respectively. Thus, a reference for the method of the present invention can preferably be generated by establishing the ROC for the population as described above and deriving a threshold quantity therefrom. Depending on the desired sensitivity and specificity of the diagnostic method, the ROC plot allows the derivation of a suitable threshold. Preferably, the reference quantity lies within a value range that represents at least 75% sensitivity and at least 45% specificity, or at least 80% sensitivity and at least 40% specificity, or at least 85% sensitivity and at least 33% specificity, or at least 90% sensitivity and at least 25% specificity.

[0061] The term "kit" refers to a collection of the above components provided preferably separately or in a single container. The container also preferably contains instructions for carrying out the method of the present invention. Examples of these components of the kit and their usage methods have been given in this specification. Preferably, the kit contains the above components in a ready-to-use formulation. Preferably, the kit may additionally include instructions, such as a user manual for adjusting the components (e.g., the concentration of the detection agent) and for interpreting the results of any assays regarding the diagnosis provided by the method of the present invention. In particular, such a manual may include information for assigning the determined amount of the gene product to a diagnostic type. Details are found elsewhere in this specification. In addition, such a user manual may provide instructions on the correct use of the kit components for determining the amount of the corresponding biomarker. The user manual may be provided in paper or electronic form (e.g., stored on a CD or CD ROM). The present invention also relates to the use of the said kit in any method according to the present invention.

[0062] The following further elaborates on the present invention in conjunction with specific embodiments. It should be noted that the said specific embodiments are interpretations rather than limitations of the present invention.

[0063] Example 1

[0064] I. Inclusion and exclusion criteria for experimental subjects

[0065] (I) Source of cases

[0066] All cases were from patients who visited Qilu Hospital of Shandong University from May 2021 to March 2023. Blood samples of the normal control group were all from normal pregnant women undergoing physical examinations at Qilu Hospital of Shandong University, all of whom had no history of spontaneous abortion and no systemic diseases such as diabetes and autoimmune diseases.

[0067] (II) Diagnostic criteria

[0068] Inclusion criteria for the recurrent spontaneous abortion (RSA) group: ① Age > 18 years old; ② Normal karyotypes of both husband and wife; ③ Normal development of the reproductive system; ④ At least 2 consecutive spontaneous abortions in the early pregnancy; ⑤ No use of anticoagulants or fibrinolytic drugs, hormones or immunosuppressants within 2 months; ⑥ More than 3 months since the last abortion and in a non-pregnant state at the time of visit; ⑦ Complete clinical data;

[0069] Exclusion criteria for the RSA group: ① Those who had an induced abortion for other reasons; ② Suffering from diabetes, cardiovascular diseases or immune system diseases, etc.; ③ Use of anticoagulants or fibrinolytic drugs, hormones or immunosuppressants within 2 months; ④ Malformations or infections of the reproductive organs; ⑤ Incomplete clinical data.

[0070] The control group (normal pregnancy) consisted of those in the early stage of pregnancy confirmed by B-ultrasound and HCG, all without a history of spontaneous abortion and without systemic diseases such as diabetes and autoimmune diseases.

[0071] II. Screening of differentially expressed RNAs

[0072] Three patients with recurrent spontaneous abortion and three patients in the early stage of normal pregnancy were selected. Fasting venous blood was collected and centrifuged at 3000 g for 10 minutes to collect the serum.

[0073] 1. RNA extraction and quality control

[0074] The total RNA in the extracellular vesicles EVs of the serum was extracted using the Plasma / Serum / Exosomal RNA Purification Kit (Norgen, N-51000), and then purified using the RNeasy Mini Kit (QIAGEN, 74106).

[0075] 2. Transcription and microarray hybridization

[0076] The RNA obtained in step 1 was reverse transcribed into cDNA using the Low Input Quick-Amp Labeling Kit one-color (Agilent, 5190-2305). Then, T7 RNA polymerase was added, and after transcription into cRNA, it was labeled with the dye Cyanine-3-CTP. Then, 10X Blocking Agent and 25X Fragmentation Buffer (Gene Expression Hybridization Kit Agilent 5188-5242) were added, incubated at 60 °C for 30 minutes, hybridized with the LC HumanceRNA array V1.0 (4*180K, Design ID: 085202) at 65 °C for 17 hours, and then scanned using the Agilent Scanner G5761A.

[0077] 3. Data analysis

[0078] Data was extracted using the software Feature Extraction software 12.0.3.1 (Agilent technologies), then normalized using Genespring software (version 14.8, Agilent Technologies), and the differential gene volcano plot was drawn using the R package “ggplot2”. According to the criteria of P value ≤ 0.05 and |log2FoldChange| ≥ 1, differentially expressed lncRNA molecules and circRNA molecules were screened, and 931 up-regulated and 549 down-regulated lncRNAs, 2377 up-regulated and 1139 down-regulated circRNAs were obtained, as shown in Figure 1 . On this basis, combined with the signal value expression level (the most obvious difference), 3 lncRNA molecules (lnc-SLC5A8-3, MYCBP, LOC100190940) and 3 circRNA molecules (has_circ_0054403, hsa_circ_0020897, hsa_circ_0072745) were screened.

[0079] Example 2

[0080] Verification of lncRNAs expression by qRT-PCR

[0081] 1. 80 recurrent spontaneous abortion patients and 64 normal pregnant women were collected, and serum extracellular vesicle RNA was extracted by the method as in Example 1.

[0082] 2. Primers for the above lncRNAs and internal references were designed as follows:

[0083] lncRNA type sequence SEQ ID NO. lnc-SLC5A8-3 Forward CTGGGTCTGCCTACTGCTACT 7 Reverse ACCCCAAACAGATTCGCACTT 8 MYCBP Forward CATTACAAAGCCGCCGACTC 9 Reverse GCTCCTAAGTGATGCCTTGGT 10 LOC100190940 Forward CTGGCTGTAAGTCCACCCTC 11 Reverse CCTGGTGCCGAAGAAGTGTA 12 18S Forward AGGGACAAGTGGCGTTCAGC 19 Reverse CGGACATCTAAGGGCATCAC 20

[0084] 3. Reverse transcription and PCR of lncRNAs

[0085] For reverse transcription, the kit HifairHⅢ 1st Strand cDNA Synthesis SuperMix for qPCR (Yeasen, 11141ES60) was used. 5×gDNA digester Mix was added, and the residual genomic DNA was removed at 42°C for 2 min. Then 4×HifairHⅢ SuperMix plus was added, and the RNA was reverse transcribed into cDNA. The reverse transcription program was: 25°C for 5 min, 55°C for 15 min, 85°C for 5 min.

[0086] Amplification was performed using the kit Hieff UNICONH Universal Blue qPCR SYBR Green Master Mix (Yeason, 11184ES08). PCR reaction conditions: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 10 s, annealing / extension at 60°C for 30 s, for a total of 40 cycles. Data were calculated using the 2 -ΔΔ -Ct method to calculate the relative expression level, with 18S as the internal reference.

[0087] 4. Results

[0088] The results of qRT-PCR showed that compared with the control group (early normal pregnancy group), the expression of lncRNA molecule lnc-SLC5A8-3 in serum extracellular vesicles of recurrent miscarriage patients increased, while the expressions of lncRNA MYCBP and lncRNA LOC100190940 decreased, P≤0.01( Figure 2 ).

[0089] According to the expressions of the above lncRNAs in extracellular vesicles, the receiver operating characteristic curve (ROC curve) was drawn and the area under the curve (AUC) was calculated to judge the diagnostic role of lncRNA lnc-SLC5A8-3, lncRNA MYCBP and lncRNA LOC100190940 in recurrent miscarriage (see Figure 4 ), and the AUC, sensitivity and specificity of the diagnosis are shown in Table 1. The results showed that their diagnostic sensitivity and specificity in recurrent miscarriage were very high.

[0090] Table 1

[0091] cut-off Sensitivity (95% CI) Specificity (95% CI) AUC (95% CI) lnc-SLC5A8-3 2.15 83.7(73.8-91.0) 79.7(67.8-88.7) 0.879(0.814-0.927) LOC100190940 0.56 62.5(51.0-73.1) 73.4(60.9-83.7) 0.724(0.643-0.795) MYCBP 0.41 57.5(45.9-68.5) 89.1(78.7-95.5) 0.773(0.696-0.838) The combination of 3lncRNAs 78.7(68.2-87.1) 90.6(80.7-96.5) 0.913(0.854-0.953)

[0092] 5. Statistical analysis: Statistical analysis was performed using SPSS 25.0 software. The expression results of lncRNAs molecules were expressed as [median (lower quartile, upper quartile)]. The Mann-Whitney U test was used for comparison between the recurrent miscarriage group and the control group (early normal pregnancy group), and the diagnostic ability was judged by drawing the receiver operating characteristic (ROC) curve and calculating the corresponding area under the curve (AUC). The optimal cutoff value was selected as the value corresponding to the maximum sum of sensitivity and specificity. P<0.05 (two-sided) was considered statistically significant.

[0093] Example 3

[0094] Verification of lncRNAs expression by qRT-PCR

[0095] 1. Use the serum extracellular vesicle RNA in Example 2.

[0096] 2. Design primers for the above circRNAs as follows:

[0097] circRNA type sequence SEQ ID NO. hsa_circ_0054403 Forward TGAAGGTGCCAGACATGCTC 13 Reverse ATCTCAGCAGGGCTGCCAT 14 hsa_circ_0020897 Forward CCCAGAAGGCTCTTACTACACC 15 Reverse TCCAAATAATCCTTGGGCATGAAT 16 hsa_circ_0072745 Forward CTCTTACACTAAGGTGAAGCTCGT 17 Reverse CTGGCTTCCTTTTCAGCAACT 18 18S Forward AGGGACAAGTGGCGTTCAGC 19 Reverse CGGACATCTAAGGGCATCAC 20

[0098] 3. Reverse transcription and PCR of circRNAs

[0099] For reverse transcription, use the kit HifairHⅢ 1st Strand cDNA Synthesis SuperMix for qPCRKit (Yeasen, 11141ES60). Add 5×gDNA digester Mix and incubate at 42°C for 2 min to remove residual genomic DNA. Then add 4×HifairHⅢ SuperMix plus to reverse transcribe RNA into cDNA. The reverse transcription program is: 25°C for 5 min, 55°C for 15 min, 85°C for 5 min.

[0100] For amplification, use the kit Hieff UNICONH Universal Blue qPCR SYBR Green Master Mix (Yeason, 11184ES08). PCR reaction conditions: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 10 s, annealing / extension at 60°C for 30 s, for a total of 40 cycles. Data was calculated using the 2 -ΔΔ Ct method to calculate the relative expression level, with 18S as the internal reference.

[0101] 4. Results

[0102] The results of qRT-PCR showed that compared with the control group (early normal pregnancy group), the expression of has_circ_0054403 in serum extracellular vesicles of recurrent miscarriage patients increased, while the expressions of hsa_circ_0020897 and hsa_circ_0072745 decreased, P≤0.01( Figure 3 ).

[0103] According to the expression of the above circRNAs in extracellular vesicles, a receiver operating characteristic curve (ROC curve) was drawn and the area under the curve (AUC) was calculated to judge the diagnostic role of has_circ_0054403, hsa_circ_0020897 and hsa_circ_0072745 in recurrent miscarriage (see Figure 5 ). The AUC, sensitivity and specificity of the diagnosis are shown in Table 2. The results showed that their sensitivity and specificity in the diagnosis of recurrent miscarriage were very high.

[0104] Table 2

[0105] cut-off Sensitivity (95% CI) Specificity (95% CI) AUC (95% CI) hsa_circ_0054403 2.16 47.5(36.2-59.0) 100.0(94.3-100.0) 0.758(0.680-0.825) hsa_circ_0020897 0.31 50.0(38.6-61.4) 81.2(69.5-89.9) 0.666(0.582-0.742) hsa_circ_0072745 0.65 62.5(51.0-73.1) 70.3(57.6-81.1) 0.664(0.581-0.741) The combination of 3circRNAs 73.7(62.7-83.0) 79.7(67.8-88.7) 0.842(0.772-0.897)

[0106] 5. Statistical analysis: Statistical analysis was performed using SPSS 25.0 software. The expression results of circRNAs molecules were expressed as [median (lower quartile, upper quartile)]. The Mann-Whitney U test was used for comparison between the recurrent miscarriage group and the control group (early normal pregnancy). The diagnostic ability was judged by plotting the receiver operating characteristic (ROC) curve and calculating the corresponding area under the curve (AUC). The optimal cutoff value was selected as the value corresponding to the maximum sum of sensitivity and specificity. P < 0.05 (two-sided) was considered statistically significant.

[0107] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or perform equivalent replacements for some of the technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of a substance for detecting LncRNA markers in the preparation of a product for predicting recurrent miscarriage, wherein the LncRNA markers include lncRNA lnc-SLC5A8-3, lncRNA MYCBP, and lncRNA LOC100190940; specifically, the sequence of the lncRNA lnc-SLC5A8-3 is as shown in SEQ ID NO.1; the sequence of the lncRNA MYCBP is as shown in SEQ ID NO.3; the sequence of the lncRNA LOC100190940 is as shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The substance for detecting LncRNA markers includes a primer set for detecting LncRNA markers, and the primer set consists of the following primers: The nucleotide sequence of the upstream primer for detecting lncRNA lnc-SLC5A8-3 is as shown in SEQ ID NO.7, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.8; The nucleotide sequence of the upstream primer for detecting lncRNA MYCBP is as shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.10; The nucleotide sequence of the upstream primer for detecting lncRNA LOC100190940 is as shown in SEQ ID NO.11, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.12; The nucleotide sequence of the upstream primer for detecting the internal reference gene 18S is as shown in SEQ ID NO.19, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.

20.

3. The application according to claim 1, wherein The product includes a substance for detecting the LncRNA markers in a test sample, and the test sample is the blood of a subject; or, the test sample is serum; or, the test sample is extracellular vesicles of a subject.

4. The application according to claim 1, wherein The product is a detection kit.

5. A system, characterized in that, The system includes: i) an analysis module for determining the expression level of the LncRNA markers in the test sample of a subject as claimed in claim 1, and; ii) an evaluation module for predicting whether the subject is a recurrent miscarriage patient based on the expression level of the LncRNA markers determined in i).

6. The system according to claim 5, wherein The system further includes a result output module for outputting the result analyzed by the evaluation module.

7. The system according to claim 5, wherein The test sample is extracellular vesicle RNA of the blood cells of a subject.

8. The system according to claim 5, wherein The test sample is extracellular vesicle RNA in serum.

Images