A SNP site associated with M variant in MNS blood group system and its application

Abstract

The present invention provides SNP sites associated with the M variant in the MNS blood type system and their applications, wherein the SNP site is located at the 154th position of the nucleic acid fragment having the nucleotide sequence of SEQ ID NO: 1 and is A or T. Another aspect of the present invention also provides the application of a preparation for detecting the above-mentioned SNP site in the preparation of a product for detecting the MNS blood type of red blood cells. The present invention provides an effective MNS blood type gene diagnosis approach by detecting and screening the obtained SNP sites, and improves the MNS gene database. The application effect shows that the gene SNP sites and detection primers provided by the present invention can be effectively used for rapid detection of MNS blood type M variant gene mutation sites in the peripheral blood of clinical patients.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection services in the biomedical industry, and specifically relates to a SNP site associated with an M variant in an MNS blood type system and an application thereof. Background Art

[0002] As of June 30, 2021, the International Society of Blood Transfusion (ISMT) has confirmed 378 human red blood cell antigens, of which 345 red blood cell antigens constitute 43 human red blood cell blood group systems. In addition to the 345 antigens in the 43 blood group systems, other red blood cell blood group antigens confirmed by the ISMT include 14 antigens from 5 blood group sets; 16 antigens of low frequency (700 series) and 3 antigens of high frequency (901 series) in 2 blood group series. As of June 30, 2021, there are two newly confirmed human red blood cell blood group system antigens by the ISMT, including the CETW antigen (number 063) of the RH blood group system (a total of 56 antigens), and the DIST antigen (number 023) of the Diego blood group system (a total of 23 antigens).

[0003] The numerical sequence of the MNS blood group system named by ISMT is 002. The MNS blood group antigens are already mature at birth, and the complexity of its antigens is reflected in serology, genetics and biology. At present, the MNS blood group system has 50 antigens, and its polymorphism is second only to the Rh blood group system (56 antigens), making it the blood group system with the second largest number of antigens among the 43 blood group systems. This blood group system has important application value in clinical blood transfusion, diagnosis of neonatal hemolytic disease, organ transplantation, parent-child, forensic identification and other aspects.

[0004] In 1927, Landsteiner and Levine used human red blood cells to immunize rabbits while conducting experiments on hemolytic disease of the newborn. The rabbits produced antibodies, and through these antibodies, human red blood cell M and N antigens were discovered. In 1947, Walsh and Monotgomey discovered the S antigen that is closely related to M and N. In 1951, Levine discovered the s antigen that is dual to the S antigen. Later, Sanger confirmed that the MN gene is a linked gene and the Ss gene is a pair of codominant alleles. The polymorphism of the Ss antigen is not strong in the Asian population.

[0005] The distribution of MN antigen varies in different regions, and neonatal hemolytic disease and blood incompatibility caused by anti-M occur from time to time in clinical practice. Therefore, accurate typing of MN antigen is of great significance to ensure blood transfusion safety and prevent and treat neonatal hemolytic disease. However, in the presence of some interfering factors (such as a recent history of blood transfusion or autoantibodies, etc.), accurate blood typing cannot be performed using serological methods. At this time, molecular biological methods can be used for genotyping. Summary of the invention

[0006] The purpose of the present invention is to provide SNP sites related to the M variant in the MNS blood group system and their application, which can improve the data of the MNS gene library and thus make up for the shortcomings of the prior art.

[0007] The applicant sequenced a variant blood type gene family member of the MNS blood type system and found that the M-type variant gene of the family member had a genetic mutation, which caused the mutation of the M antigen.

[0008] The present invention first provides a SNP site associated with the M variant in the MN blood type system. The SNP site is located at the 154th position starting from the ATG coding region of the MN blood type M allele and is A or T, that is, the 154th position of the nucleic acid fragment with the nucleotide sequence of SEQ ID NO:1.

[0009] ATGTATGGAAAAATAATCTTTGTATTACTATTGTCAGAAATTGTGAGCATATCAGCATTAAGTACCACTGAGGTGGCAATGCACACTTCAACTTCTTCTTCAGTCACAAAGAGTTACATCTCATCACAGACAATGATACGCACAAACGGGAC T C

[0010] ATATGCAGCCACTCCTAGAGCTCATGAAGTTTCAGAAATTTCTGTTAGAACTG

[0011] TTTACCCTCCAGAAGAGGAAACCGGAGAAAGGGTACAACTTGCCCATCATTT

[0012] CTCTGAACCAGAGATAACACTCATTATTTTTGGGGTGATGGCTGGTGTTATTG

[0013] GAACGATCCTCTTAATTTCTTACGTATTCGCCGACTGATAAAGAGACAAGTG

[0014] ATCAATGAGAATCTGTTCACCAAACCAAATGTGGAAAGAACACAAAGAAGACATAAGACTTCAGTCAAGTGA (SEQ ID NO: 1).

[0015] Another aspect of the present invention also provides the use of the preparation for detecting the above-mentioned SNP site in the preparation of a product for detecting the MNS blood type of red blood cells.

[0016] The preparation, as a specific record of an embodiment, is a high resolution melting curve (HRM) detection PCR primer or a PCR amplification sequencing primer;

[0017] In another aspect, the present invention further provides a detection kit for the SNP site, which comprises primers for detecting the SNP site;

[0018] The sequence information of the high-resolution melting curve detection primer is as follows:

[0019] GYPA-G1F:5'-TACATCTCATCACAGAC-3'(SEQ ID NO: 2),

[0020] GYPA-G1R: 5'-GAAATTTCTGAAACTTCA-3' (SEQ ID NO: 3);

[0021] The haplotype amplification and sequencing primer information used to detect the above SNP sites are as follows:

[0022] GYPA-G2F: 5'-CACAAAGAGTTACATCTCA-3' (SEQ ID NO: 4), GYPA-G2R: 5'-CCTTTCTCCGGTTTCCTCTTCT-3' (SEQ ID NO: 5).

[0023] The present invention provides an effective MNS blood type gene diagnosis method by detecting and screening the obtained SNP sites, and improves the MNS gene database. The application effect shows that the gene SNP sites and detection primers provided by the present invention can be effectively used for the rapid detection of MNS blood type M-type variant gene mutation sites in the peripheral blood of clinical patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 : PCR product electrophoresis detection results of the proband's SNP site.

[0025] Figure 2 :HRM genotyping results of SNP sites in different blood types. DETAILED DESCRIPTION

[0026] The present invention discovered a heterozygous mutation of a specific SNP site on the M antigen during DNA sequencing in a MNS blood type M subtype family. The MNS blood type antigen is controlled by a gene cluster consisting of the 4q28 to q31 segment of chromosome 4 and exists in the form of dominant inheritance.

[0027] The SNP sites obtained by screening can be detected using a high-resolution melting curve (HRM) method or a direct sequencing method.

[0028] The present invention is described in detail below with reference to the embodiments.

[0029] Example 1: Screening of SNP markers

[0030] 1. Extraction of peripheral blood genomic DNA:

[0031] In accordance with relevant national policies and regulations, and based on the consent of the sampling subjects, 2-5 mL of peripheral venous blood was drawn from family members with M-type variants. The specific operation process is as follows:

[0032] Sample pretreatment: Thaw 1 ml of EDTA anticoagulated frozen blood at room temperature and transfer to a 5 ml centrifuge tube. Add 1 ml of phosphate buffered saline (PBS), mix well, centrifuge at 3500 g for 15 min, and pour off the supernatant containing lysed red blood cells. Repeat once. Suspend the cell pellet with 0.7 ml of DNA extraction solution and incubate in a 37°C water bath for 1 hour.

[0033] Digestion: After the above DNA extract is heated in a 37℃ water bath, add 0.2ml of 1mg / ml proteinase K to a final concentration of 100-200ug / ml, and mix it up and down until the liquid becomes viscous. Incubate in a 50℃ water bath for 3h to lyse cells and digest proteins. During the insulation process, the reaction solution should be mixed up and down several times from time to time.

[0034] Phenol extraction to purify DNA: After the above reaction solution is cooled to room temperature, add an equal volume of saturated phenol solution and gently rotate the centrifuge tube up and down for 5-10 minutes until the water phase and the phenol phase are mixed into an emulsion. Centrifuge at 5000g for 15 minutes, carefully aspirate the upper viscous water phase with a large pipette, and transfer it to another centrifuge tube. Repeat the extraction once. Add an equal volume of chloroform: isocyanate (24:1) and rotate up and down to mix, centrifuge at 5000g for 15 minutes, carefully aspirate the upper viscous water phase with a large pipette, and transfer it to another centrifuge tube. Repeat once.

[0035] Add 1 / 5 volume of 3mol / L NaAc and 2 times volume of pre-cooled anhydrous ethanol, and shake the centrifuge tube slowly at room temperature, and milky white cloudy DNA will appear. Carefully pick up the cloudy DNA with a glass rod, transfer it to another 1.5m centrifuge tube, add 0.2ml of 70% ethanol, centrifuge at 5000g for 5min to wash the DNA, discard the supernatant, and remove the residual salt. Repeat once. Volatilize the residual ethanol at room temperature, but do not let the DNA dry completely. Add 20ul of TE solution to dissolve the DNA. Place it on a shaking platform and shake it slowly. It usually takes 12-24 hours for the DNA to completely dissolve.

[0036] DNA concentration determination and purity assessment: Take the DNA solution and dilute it with TE solution, use TE solution as blank control, and read the optical density values ​​of A260 and A280 on a UV spectrophotometer.

[0037] 4. Perform haplotype sequencing on exon 2 of the MN gene to determine the mutation site of the proband's M variant gene;

[0038] Amplification was performed using the primer pairs with the following sequence information:

[0039] GYPA-G2F:5'-CACAAAGAGTTACATCTCA-3' (SEQ ID NO: 4),

[0040] GYPA-G2R: 5'-CCTTTCTCCGGTTTCCTCTTCT-3' (SEQ ID NO: 5).

[0041] After amplification product detection ( Figure 1 ), the PCR product was recovered and cloned into the T vector, and multiple colonies were picked for haploid sequence determination. The results showed that a base mutation occurred at the 154th position of the start codon (A mutated to T).

[0042] This mutation is a newly discovered mutation. It does not exist in the existing blood type database, indicating that it is rare. In the mutation screening of this site in the peripheral blood genomic DNA samples of nearly 500 normal local people, no mutation was found.

[0043] The peripheral blood genomic DNA of the proband's family members collected at the Institute of Transfusion Medicine of Qingdao Central Blood Station was extracted, and GYPA-G2F and GYPA-G2R were used as primers. The PCR products were directly sequenced using the above primers by conventional Sanger sequencing. It was found that the SNP mutation found in the present invention also existed in the MNS blood type M gene of another family member of the proband.

[0044] Example 2: Detection of SNP sites of M gene using HRM method

[0045] In order to more conveniently detect the SNP sites of the present invention, the HRM method is used for detection, and nucleic acid fragments of three genotypes, AA, AT, and TT, are synthesized. By comparing the morphology of the melting curves of the sample to be tested and the control sample, the genotyping of the sample to be tested is achieved.

[0046] The primers used for HRM genotyping were synthesized by a biological company. The sequences of the forward and reverse primers are as follows:

[0047] GYPA-G1F:5'-TACATCTCATCACAGAC-3'(SEQ ID NO: 2),

[0048] GYPA-G1R: 5'-GAAATTTCTGAAACTTCA-3' (SEQ ID NO: 3).

[0049] PCR amplification program: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 10 s, for a total of 45 cycles; finally extension at 72°C for 10 min and storage at 4°C. Melting curve conditions were: 60-95°C, and the plate was read 15 times every 1°C.

[0050] LightCycler96 software was used for melting curve analysis, and the system was as follows:

[0051]

[0052]

[0053] The HRM genotyping results of the three genotypes AA, AT, and TT are shown in Figure 2 By comparing the morphology and position of the melting curves generated by the control specimens, it was found that the detection primer pair used could effectively distinguish the three genotypes.

[0054] In summary, the SNP loci of the present invention can accurately determine the MNS blood type of the subject to be tested, provide a more accurate data background for genetic determination of the MNS blood type, and are of great significance for formulating blood transfusion policies for patients.

Claims

1. Use of a preparation for detecting SNP sites associated with the M variant in the MNS blood group system in the preparation of a product for detecting the MNS blood type of red blood cells, wherein the preparation is a PCR amplification detection primer pair, and the product is a PCR amplification detection kit; The SNP site is located at the 154th position of the nucleic acid fragment with the nucleotide sequence of SEQ ID NO: 1, and is A or T.

2. The use according to claim 1, characterized in that The PCR amplification detection primer pair is a high-resolution melting curve detection primer pair or a haplotype amplification and sequencing primer pair.

3. A detection kit, characterized in that: The detection kit contains a primer pair for detecting a SNP site associated with the M variant in the MN blood group system. The SNP site is located at the 154th position of the nucleic acid fragment with the nucleotide sequence of SEQ ID NO: 1 and is A or T.

4. The kit according to claim 3, characterized in that The primer pair is a high-resolution melting curve detection primer pair, the sequence of the upstream primer is SEQ ID NO: 2, and the sequence of the downstream primer is SEQ ID NO:

3.

5. The kit according to claim 3, characterized in that The primer pair is a haplotype amplification and sequencing primer pair, the sequence of the upstream primer is SEQ ID NO: 4, and the sequence of the downstream primer is SEQ ID NO: 5.

Images