Molecular Marker of ABCF1 Gene Related to Vibrio Resistant Trait of Litopenaeus vannamei and Its Application

Abstract

The invention discloses an ABCF1 gene molecular marker related to the Vibrio disease resistance trait of whiteleg shrimp. The molecular marker is characterized in that: the gene molecular marker is located at the 4709 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, which is recorded as D.4709 G>A, the base of the site is A or G, and the mutation type is A / G heterozygous type and G / G homozygous type; the molecular marker is used as a functional marker of the Vibrio parahaemolyticus resistance trait of whiteleg shrimp, shows a significant correlation with the Vibrio resistance trait, can quickly and accurately identify and breed whiteleg shrimp with Vibrio resistance trait, shorten the breeding cycle, accelerate the breeding process, and quickly realize the disease resistance breeding of whiteleg shrimp. Specifically, the genomic DNA of muscle tissue of whiteleg shrimp to be tested is extracted, and then the genomic DNA is used as a template DNA for PCR amplification and PCR amplification product purification, and then the obtained product is sequenced to determine the genotype of the molecular marker ABCF1, so as to select individuals with advantageous genotypes as parents for breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of Litopenaeus vannamei breeding, and particularly relates to an ABCF1 gene molecular marker related to the trait of resistance to Vibrio disease in Litopenaeus vannamei and its application. Background Art

[0002] Litopenaeus vannamei, also known as white skin shrimp, white shrimp, and Pacific white shrimp, has a relatively fast growth rate and a short breeding cycle. It has high economic value and nutritional value and is deeply loved by the public. It is an important cultured shrimp species in China at present. In recent years, the breeding of Litopenaeus vannamei has faced the challenge of bacterial diseases, which not only affects the economic benefits of the aquaculture industry, but also causes many negative impacts such as the misuse and abuse of antibiotics and the spread of drug-resistant strains due to insufficient disease prevention and control technologies. Among them, vibriosis caused by Vibrio parahaemolyticus is the most common and harmful bacterial disease in the process of Litopenaeus vannamei breeding. The diseased shrimp show symptoms such as white turbidity and slight redness of the body color, enlarged and soft hepatopancreas, and lighter color. The hepatopancreas of some shrimp may be significantly atrophied. The disease develops rapidly, and the mortality rate and pond evacuation rate are extremely high. The time from the onset of a small number of cases to pond evacuation may be extremely short, only 2-3 days.

[0003] ATP-binding cassette (ABC) transporters are membrane-bound proteins that are widely present in prokaryotes and eukaryotes. They use the energy generated by hydrolyzing ATP to complete the transmembrane transport of various substrates, including inorganic ions, monosaccharides, polysaccharides, cholesterol, phospholipids, amino acids, peptides, proteins, toxins, drugs, and antibiotics. ABC transporters are also involved in immune regulation and participate in the cell defense response during pathogen infection, such as affecting the function of immune cells by transporting immune regulatory molecules. The ABC transporter family is divided into 8 subfamilies (ABCA-ABCH), and each subfamily contains multiple members. Among them, ABCF1 is a member of the F subfamily. ABCF1 is considered a key gene regulating the innate immune response and is related to the risk of autoimmune pancreatitis. Studies have found that ABCF1 regulates protein synthesis, and knocking out the gene can lead to embryonic lethality in mice; ABCF1 may play a role in the cell's sensing of double-stranded DNA viruses and affect the immune response by regulating the IRF3 signaling pathway. In regulating the process of sepsis, the protein of ABCF1 can prevent the development of sepsis. Some studies believe that ABCF1 is a key regulator of the DNA sensing pathway, which plays a role in recognizing and responding to cytoplasmic DNA (such as viral DNA), combating viral and other pathogen infections, maintaining the stability of the intracellular environment, and improving the anti-infection ability. However, whether it is related to the Vibrio resistance of Litopenaeus vannamei has not been reported.

[0004] Single Nucleotide Polymorphism (SNP) refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. It is a molecular marker technology based on trait-related functional genes and has become one of the key technologies in the field of aquatic genetic breeding. SNP has the advantages of high polymorphism, easy data sharing, good genetic stability, convenience for high throughput, automated detection, and mature technology. In the breeding of white shrimp, SNP markers have been applied, and molecular markers related to ammonia nitrogen resistance, nitrate resistance, and growth traits have been reported, but SNP markers related to Vibrio parahaemolyticus resistance have rarely been reported. Summary of the invention

[0005] In view of the above shortcomings, the present invention discloses an ABCF1 gene molecular marker related to the Vibrio disease resistance trait of Penaeus vannamei, and screens the ATP-binding cassette sub-family F member 1 gene of Penaeus vannamei to obtain a SNP molecular marker related to the Vibrio parahaemolyticus resistance trait of Penaeus vannamei. The SNP molecular marker is used as a functional marker for the Vibrio parahaemolyticus resistance trait of Penaeus vannamei and is used for breeding new disease-resistant varieties of Penaeus vannamei.

[0006] The present invention is achieved by adopting the following technical solutions:

[0007] A molecular marker of the ABCF1 gene related to the Vibrio disease resistance trait of white shrimp is located at the 4709 bp site of the nucleotide sequence shown in sequence 1 in the sequence table, denoted as D. 4709 G>A, the base at the site is A or G, and the mutation type is A / G heterozygous type and G / G homozygous type.

[0008] The nucleotide sequence described in Sequence 1 in the sequence listing is the nucleotide sequence of the ATP-binding cassette sub-family Fmember 1 gene.

[0009] The application of the ABCF1 gene molecular marker related to the Vibrio disease resistance trait of the whiteleg shrimp is to use it for the selection breeding of whiteleg shrimp. Specifically, the genomic DNA of the muscle tissue of the whiteleg shrimp to be tested is first extracted, and the obtained genomic DNA is then used as a template DNA for PCR amplification and the PCR amplification product is purified. Then, the obtained PCR amplification product is sequenced to determine the genotype of the gene molecular marker. When it is the AG genotype of the dominant genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding.

[0010] The present invention extracts DNA from the appendage muscle tissue of Litopenaeus vannamei, which will not cause much impact on the shrimp body. Breeding can be carried out by means of molecular assisted breeding, such as obtaining varieties by using methods of gene knockout or gene editing to process molecular markers.

[0011] In the PCR amplification process, the primer set for detecting the molecular marker of ABCF1 gene related to the vibriosis resistance trait of Litopenaeus vannamei includes primer F and primer R. The sequence of primer F is CTGACTCGCAAGCAGGAGAAGAAC (sequence 2 in the sequence listing), and the sequence of primer R is TTATAAATCGGCCGCGTTGTGG (sequence 3 in the sequence listing).

[0012] The PCR amplification system consists of the following components: 2.0 μL of 10× Taq buffer, 0.4 μL of dNTP (10 mmol / L each), 0.2 μL of Taq DNA polymerase with a concentration of 5 U / μL, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template DNA.

[0013] The reaction procedure of the PCR amplification includes the following steps:

[0014] S1. Pre-denature at 95 °C for 5 min;

[0015] S2. Denature at 95 °C for 30 s, anneal at 60 °C for 30 s, and extend at 72 °C for 30 s, for 34 cycles;

[0016] S3. Extend at 72 °C for 5 min.

[0017] The present technical solution has the following beneficial effects compared with the prior art:

[0018] The present invention provides an SNP molecular marker closely related to the Vibrio parahaemolyticus resistance trait of Litopenaeus vannamei, which shows a significant correlation with the vibriosis resistance trait. It can quickly and accurately identify and breed Litopenaeus vannamei with vibriosis resistance traits, shorten the breeding cycle, accelerate the breeding process, quickly achieve the disease-resistant breeding of Litopenaeus vannamei, and provide a good basis for the research on the cultivation and improvement of Litopenaeus vannamei varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is a partial fragment sequence (positions 386 to 390) of the product obtained by amplifying the ATP-binding cassette sub-family F member 1 gene in the example, which shows the AG and GG peak graphs of the D.4709 G>A site. DETAILED DESCRIPTION OF THE INVENTION

[0020] The present invention will be further illustrated by the following examples, which shall not be construed as limiting the present invention. For the specific experimental conditions and methods not specified in the following examples, the technical means adopted are generally conventional means well-known to those skilled in the art.

[0021] Example: The screening process of the ABCF1 gene molecular marker related to the Vibrio - resistant trait of Litopenaeus vannamei of the present invention is as follows:

[0022] (1) After selecting 245 Litopenaeus vannamei with a body weight of about 20 grams and acclimating them for 5 days, inject 100 μL of Vibrio parahaemolyticus with a concentration of 7×10 6 cfu / mL into each individual of Litopenaeus vannamei; in order to exclude the death caused by the injection factor, start recording the dead individuals 6 hours after the challenge, and respectively select 60 Litopenaeus vannamei that died first and those that still survived after 96 hours as samples of the Vibrio parahaemolyticus - sensitive group and the Vibrio parahaemolyticus - tolerant group of Litopenaeus vannamei;

[0023] (2) Randomly select 5 Litopenaeus vannamei from the sensitive group and the tolerant group respectively, extract the muscle tissue and extract the genomic DNA by the conventional phenol - chloroform extraction method, and store the obtained genomic DNA at - 20 °C for standby;

[0024] (3) According to the Litopenaeus vannamei ATP - binding cassette sub - family F member 1 gene sequence, primers F and primer R are designed, and then amplify and screen the SNP sites located in the ATP - binding cassette sub - family F member 1 gene;

[0025] The sequence of primer F is: CTGACTCGCAAGCAGGAGAAGAAC;

[0026] The sequence of primer R is: TTATAAATCGGCCGCGTTGTGG;

[0027] The PCR amplification system consists of the following components: 2.0 μL of 10× Taq buffer, 0.4 μL of dNTP (10 mmol / L each), 0.2 μL of Taq DNA polymerase with a concentration of 5 U / μL, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template DNA;

[0028] The reaction procedure of the PCR amplification includes the following steps:

[0029] S1. Pre - denature at 95 °C for 5 min;

[0030] S2. Denature at 95°C for 30 s, anneal at 60°C for 30 s, extend at 72°C for 30 s, and perform 34 cycles;

[0031] S3. Extend at 72°C for 5 min;

[0032] (4) After detecting the PCR amplification product by 1% agarose gel electrophoresis, purify and sequence it, and then use DNAstar software to compare and analyze the sequencing results, including nucleotide sequence alignment and peak map analysis, to screen out relevant SNPs sites; the PCR amplification product sequence of one sample is shown as follows:

[0033] CTGACTCGCAAGCAGGAGAAGAACAGGGCCAAGAGCAAGAAGAACGACGACGAGGACGGCCCCACGGAGTTGTTAGAGAAGCCGCAGGAGTACATAGTGAAGTTCAAGTTCCCAGAGCCGCCCCCGTTGCAACCTCCAATCCTCGGTCTTTATAATGTTAGCTTTTGGTACCCCGGCCACAAGCCCTTGTTTAAGGAAGTCGACTTCGGTATCGACATGGATAGCAGAGTGGCCATTGTCGGCCCTAATGGAGTGGGTAAGTCAACGTTCTTGAAGCTGCTGGTGAGCGACCTAACTCCCATGGAGGGCGAGGTGCGCAAGAACCACCGCCTCAAGATCGGCCGCTACGATCAGCACTCCGGCGAGCACCTGACGGCTGAGGAATCGCCTTCCGAGTATCTCATGCGTCTGTTCAACCTGCAGTACGAGAAGGCGAGGAAGGCTTTGGGCACGTTTGGACTGGCATCCCACGCACACACACCATCAAGAACAAGGACTCGGGGAGGCGCGCGTGGCCCTGGCTGAGCTCTGCCTCTCCTCGCCCGACGTCCTCATCCTCGACGAGCCCACCAACAACCTCGACATCGAGAGCATCGACGCCCTCGCGGAGGCCATCAGCGACTTCCAGGGCGGCGTGATCATCGTGTCTCACGACGAGCGCCTCATCCGTGACACCGACTGCACGCTGTGGGTCATCGAGGAGCAGACCATCAACGAGATCGACGGCGGCTTCGACGATTACCGCAAGGAGCTGCTCGAGGAACTGGGCGAGGAAATCAACAACCCCAGCATCTCCGCCCACAACGCGGCCGATTTATAA, where the 387th position is D. 4709 G>A;

[0034] (5)According to the screened SNPs loci, the white - leg shrimps in the sensitive group and the tolerant group were respectively detected and genotyped according to the above - mentioned method. The samples of different SNP loci in the sensitive group and the tolerant group were counted, the genotype frequencies and allele frequencies were calculated, and the chi - square analysis was used for independence test. The results of the chi - square analysis are shown in Table 1.

[0035] Chi-square analysis results of the loci described in Table 1

[0036]

[0037] The chi-square test method of SPSS 19.0 software was used to analyze the correlation between the locus D. 4709 G>A and the trait of Vibrio parahaemolyticus resistance in Litopenaeus vannamei. The results showed that: among the locus D. 4709 G>A, the distributions of the two different genotypes AG and GG were significantly associated with the trait of Vibrio parahaemolyticus resistance (X2 = 6.5993, P = 0.0102), and the two alleles A and G also showed significant association with the trait of Vibrio parahaemolyticus resistance (X2 = 4.0961, P = 0.0430); the results indicated that the genotype polymorphism of the molecular marker locus D.4709 G>A had a significant impact on the trait of Vibrio parahaemolyticus resistance in Litopenaeus vannamei, and the Vibrio parahaemolyticus resistance performance of individuals with the AG genotype was better than that of individuals with the GG genotype. Individuals with the AG genotype at the locus D. 4709 G>A were preferentially selected as the parents for the breeding of Vibrio parahaemolyticus-resistant Litopenaeus vannamei or for large-scale farming.

[0038] In addition, it should be understood that although this specification is described according to the embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A molecular marker of the ABCF1 gene related to the vibriosis resistance trait of Litopenaeus vannamei, characterized in that: The gene molecular marker is the nucleotide sequence shown in Sequence 1 in the sequence listing, and at the 4709 bp site of the nucleotide sequence, it is denoted as D. 4709 G>A. The base at this site is A or G, and the mutation type is A / G heterozygous and G / G homozygous.

2. Use of the ABCF1 gene molecular marker related to the vibriosis-resistant trait of Litopenaeus vannamei as described in claim 1, characterized in that: The gene molecular marker is used for selective breeding of Litopenaeus vannamei. Specifically, first, genomic DNA of the muscle tissue of the Litopenaeus vannamei to be tested is extracted, and then the obtained genomic DNA is used as template DNA for PCR amplification and purification of the PCR amplification product. Then, the obtained PCR amplification product is sequenced to determine the genotype of the gene molecular marker. When its genotype is the dominant genotype AG genotype, this individual is selected as a reserve parent for breeding of the Litopenaeus vannamei variety.

3. Use of the ABCF1 gene molecular marker related to the vibriosis resistance trait of Litopenaeus vannamei according to claim 2, characterized in that: In the PCR amplification process, the primer set for detecting the ABCF1 gene molecular marker related to the Vibrio resistance trait of Litopenaeus vannamei includes primer F and primer R. The sequence of primer F is CTGACTCGCAAGCAGGAGAAGAAC, and the sequence of primer R is TTATAAATCGGCCGCGTTGTGG.

4. Use of the ABCF1 gene molecular marker related to the vibriosis-resistant trait of Litopenaeus vannamei according to claim 3, characterized in that: The PCR amplification system consists of the following components: 2.0 μL of 10× Taq buffer, 0.4 μL of dNTP, 0.2 μL of Taq DNA polymerase with a concentration of 5 U / μL, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template DNA.

5. Use of the ABCF1 gene molecular marker related to the vibriosis-resistant trait of Litopenaeus vannamei according to claim 2, characterized in that: The reaction procedure of the PCR amplification includes the following steps: S1. Pre-denature at 95 °C for 5 min; S2. Denature at 95 °C for 30 s, anneal at 60 °C for 30 s, extend at 72 °C for 30 s, and perform 34 cycles; S3. Extend at 72 °C for 5 min.

Images