A pepper anthracnose pathogen HQY158, its detection target, LAMP primer, kit, detection method and application

Abstract

The present invention belongs to the technical field of plant pathogenic microorganism detection, and discloses a pepper anthracnose pathogen HQY158, its detection target, LAMP primer, kit, detection method and application. The present invention separates and identifies a new pathogenic species - pepper anthracnose pathogen HQY158 from pepper diseased fruits. The present invention further develops a specific detection target Cq-GAPDH for rapid and accurate identification of the pathogen, and further develops a LAMP primer, kit and detection method based on the Cq-GAPDH detection target. The detection method of pepper anthracnose pathogen HQY158 provided by the present invention has high accuracy, sensitivity, effectiveness and specificity, and is easy to operate and has good practicality, and can realize accurate and rapid detection of pepper anthracnose pathogen HQY158. The present invention can be used for the detection of pepper anthracnose pathogen Colletotrichum qingyuanense, and is further applied to the determination of pathogen distribution range and the identification of pepper diseases.

Description

Technical Field

[0001] The invention relates to the technical field of plant pathogenic microorganism detection, and specifically discloses a pepper anthracnose pathogen HQY158, a detection target, a LAMP primer, a kit, a detection method and an application thereof. Background Art

[0002] Pepper anthracnose is an important disease of peppers before and after harvest worldwide. The pathogen not only harms pepper fruits and stems and leaves during the growing period, but also causes continuous corruption during storage and transportation after harvest, thus seriously affecting the quality of dried and fresh peppers. It has become a restrictive factor in the development of the pepper industry. When the disease occurs, it can cause a 10% to 50% reduction in production, causing serious economic losses to pepper production.

[0003] The pathogen that causes pepper anthracnose belongs to the genus Colletotrichum, and the common dominant pathogenic species include C. truncatum, C. scovillei and C. siamense. At least 17 species of pepper anthracnose pathogens have been reported in my country, and the dominant species in different regions vary greatly. In addition, new pathogens of pepper anthracnose are constantly reported. Pepper anthracnose pathogen HQY158 is a new pathogenic species isolated and identified by the inventor of this patent from pepper diseased fruits. The pathogen HQY158 mainly harms pepper fruits that are nearly mature and post-harvest, and causes moist, brown oval lesions. The lesions are slightly sunken, and there are small black spots on the surface of the lesions in the later stage, causing serious damage to peppers before and after harvest.

[0004] The conventional PCR detection technology for pathogenic microorganisms currently used faces the problems of requiring many equipment (such as thermal cyclers, gel electrophoresis equipment, etc.), requiring experienced experimental operators, requiring long amplification cycles, cumbersome detection, and poor detection specificity. Not only can it not meet the needs of rapid detection, but it is also inconvenient to operate in the field.

[0005] Loop-mediated isothermal amplification (LAMP) is a new type of nucleic acid detection technology with the advantages of fast reaction speed, high sensitivity, strong specificity and high detection efficiency. It has been widely used in the detection of various pathogens. The key and difficulty of the LAMP detection method lies in the design of specific primers and the selection of LAMP reaction system and conditions, which are directly related to the specificity, sensitivity and accuracy of the detection method. Summary of the invention

[0006] The present invention separates and identifies a new pathogenic species, pepper anthracnose pathogen HQY158, from pepper diseased fruits. In view of the current lack of a detection method for the pathogen, the present invention aims to develop a LAMP primer combination and a detection kit through research on detection targets and specific detection primers for pepper anthracnose pathogen HQY158, and further provide a detection method for pepper anthracnose pathogen HQY158 with strong specificity, high sensitivity and high detection efficiency.

[0007] In order to achieve the above-mentioned object of the invention, the embodiment of the present invention adopts the following technical solution:

[0008] In the first aspect, the present invention provides a pepper anthracnose fungus (Colletotrichum qingyuanense) Cq, which is a new pathogenic species isolated and identified by the inventor of this patent from diseased pepper fruits. The fungus has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on October 31, 22, and its deposit number is CGMCC3.23797.

[0009] In the second aspect, the present invention provides a specific detection target Cq-GAPDH of pepper anthracnose pathogen HQY158 by whole genome sequencing and comparison analysis of the differences in genome sequences between pepper anthracnose pathogen HQY158 and 10 other anthracnose pathogen strains. The DNA sequence of the detection target is shown in SEQ ID NO.1.

[0010] Experiments have confirmed that the detection target Cq-GAPDH of pepper anthracnose pathogen HQY158 provided by the present invention has good specificity and is not interfered by other anthracnose pathogen strains, thereby achieving effective identification of pepper anthracnose pathogen HQY158.

[0011] In a third aspect, the present invention provides a LAMP primer composition based on Cq-GAPDH, wherein the LAMP primer composition comprises: a forward outer primer F3 as shown in SEQ ID NO.2, a reverse outer primer B3 as shown in SEQ ID NO.3, a forward inner primer FIP as shown in SEQ ID NO.4, and a reverse inner primer BIP as shown in SEQ ID NO.5.

[0012] The present invention takes the specific sequence Cq-GAPDH of pepper anthracnose pathogen HQY158 as a target and designs specific LAMP primers. The LAMP reaction can realize specific recognition of 6 independent regions on the target sequence through 4 primers (i.e., F3, B3, FIP, and BIP), and its specificity is high; compared with the primer composition for detecting pepper anthracnose pathogens through LAMP reaction in the prior art, which adds a loop primer, the 4 primers provided by the present invention have good specificity, and the LAMP reaction time is not long after subsequent determination, so the loop primer does not need to be added.

[0013] In a fourth aspect, the present invention provides an application of the above-mentioned Cq-GAPDH-based LAMP primer composition in detecting pepper anthracnose pathogen HQY158.

[0014] In a fifth aspect, the present invention provides a use of the above-mentioned Cq-GAPDH-based LAMP primer composition in the preparation of a Cq-GAPDH-based LAMP kit.

[0015] In a sixth aspect, the present invention provides a Cq-GAPDH-based LAMP kit, wherein the LAMP kit comprises the above-mentioned Cq-GAPDH-based LAMP primer composition.

[0016] Preferably, the LAMP kit further comprises dNTPs, Tris-HCl, KCl, (NH4)2SO4, MgSO4 and BstDNA polymerase.

[0017] In the above-mentioned Cq-GAPDH-based LAMP kit, the final concentration of each reagent is: 0.15-0.25 μM forward outer primer F3, 0.15-0.25 μM reverse outer primer B3, 0.45-0.60 μM forward inner primer FIP, 0.45-0.60 μM reverse inner primer BIP, 0.2 mM dNTPs, 20 mM Tris-HCl, 5 mM KCl, 2 mM (NH4)2SO4, 2 mM MgSO4, 0.2-0.4 U / μL Bst DNA polymerase, and sterile ultrapure water is used to prepare the detection solution.

[0018] Exemplarily, in the LAMP kit based on Cq-GAPDH, the reagents may be: 100 μM forward outer primer F3 1.5-2.5 μL, 100 μM reverse outer primer B3 1.5-2.5 μL, 100 μM forward inner primer FIP 4.5-6.0 μL, 100 μM reverse inner primer BIP 4.5-6.0 μL, 10 mM dNTPs 20 μL, 200 mM Tris-HCl 100 μL, 500 mM KCl 100 μL, 20 mM (NH4)2SO4 100 μL, 40 mM MgSO4 50 μL, 8 U / μL Bst DNA polymerase 25-50 μL, and sterile ultrapure water is used to prepare 1 mL of detection solution.

[0019] In a seventh aspect, the present invention provides the use of the above-mentioned Cq-GAPDH-based LAMP kit in detecting pepper anthracnose pathogen HQY158.

[0020] In an eighth aspect, the present invention further provides a LAMP detection method for pepper anthracnose pathogen HQY158, the LAMP detection method comprising the following steps:

[0021] Extract the genome of the sample microorganism to be tested, use the Cq-GAPDH-based LAMP primer composition or the Cq-GAPDH-based LAMP kit to perform LAMP amplification reaction, add dye, observe the fluorescent signal, and judge the result.

[0022] Preferably, in step S1, the temperature of the LAMP reaction is 62-68° C. and the time is 40-50 min.

[0023] For example, the selected dye may be SYBR Green I or hydroxynaphthol blue, and the present invention is described by taking SYBR Green I as an example. The color change of the reaction solution includes the following two situations:

[0024] In the first case, when the color of the reaction solution changes from orange to yellow-green, it is judged that the pepper anthracnose pathogen HQY158 in the sample is positive;

[0025] In the second case, when the color of the reaction solution does not change and remains orange, it is determined that the pepper anthracnose pathogen HQY158 in the sample tested is negative.

[0026] Exemplarily, the DNA of the microorganism to be tested in the sample is extracted, 1 to 3 μL (20 ng / μL) of DNA solution is taken as a reaction template, 10 to 20 μL of the detection solution in the LAMP kit is added to carry out LAMP reaction at 62 to 68° C. The reaction time is 40 to 50 min to obtain an amplified product; then 0.15 to 0.3 μL of SYBR Green I is added to the amplified product. Since a large amount of DNA amplification product is generated during the reaction, the amplified product can be combined with the SYBR Green I dye and the color change can be observed by naked eye to determine whether the LAMP reaction is a positive result.

[0027] Compared with conventional PCR detection of pepper anthracnose pathogens, the LAMP detection method of pepper anthracnose pathogens HQY158 provided by the present invention has the advantages of simple operation, short detection cycle, high accuracy, high sensitivity, strong specificity, and suitable for promotion. The details are as follows:

[0028] (1) Conventional PCR detection technology for pathogenic microorganisms faces the problems of requiring many equipments (such as thermal cyclers, gel electrophoresis equipment, etc.), requiring experienced experimental operators, requiring long amplification cycles, cumbersome detection, and poor detection specificity. The detection method of the present invention has simple experimental conditions and does not require complex instruments such as PCR instruments and gel electrophoresis equipment. Under isothermal conditions of 62 to 68°C, it only takes 40 to 50 minutes to accurately, quickly, and efficiently detect pepper anthracnose bacteria, which can better meet the field detection of pepper anthracnose bacteria and is suitable for promotion and use in grassroots plant protection departments;

[0029] (2) The present invention discovered a specific target gene Cq-GAPDH through genome sequencing combined with alignment, and designed a specific LAMP primer combination with GAPDH as the target. The LAMP reaction specifically recognizes six independent regions on the target sequence through four primers (F3, B3, FIP, BIP), and its specificity is relatively high;

[0030] (3) The LAMP detection method for pepper anthracnose pathogen HQY158 established in the present invention has a very high sensitivity, which can reach 100 ag / μL DNA, indicating that the detection method is sufficient to accurately and quickly detect pepper anthracnose pathogen HQY158 when the DNA concentration is very low.

[0031] The present invention separated and identified a new pathogenic pepper anthracnose pathogen HQY158 from pepper diseased fruits, and developed a specific detection target Cq-GAPDH for rapid and accurate identification of pepper anthracnose pathogen HQY158, based on which LAMP primers, kits and detection methods were further developed. The present invention can provide guidance information for the distribution, harm and evolution of the pathogen, disease identification, etc., and also lay a foundation for the effective prevention and control of pepper anthracnose. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0033] Figure 1 This is a colony morphology diagram of pepper anthracnose pathogen HQY158 in PDA medium in Example 1 of the present invention;

[0034] Figure 2 This is a morphological diagram of the fruiting body of pepper anthracnose pathogen HQY158 in PDA medium in Example 1 of the present invention;

[0035] Figure 3The conidia morphology of pepper anthracnose pathogen HQY158 in Example 1 of the present invention is shown;

[0036] Figure 4 The phylogenetic tree constructed in the molecular biology study of pepper anthracnose pathogen HQY158 in Example 1 of the present invention;

[0037] Figure 5 This is a comparison chart of the results of different DNA template concentrations when LAMP detection of pepper anthracnose pathogen HQY158 was performed in Example 6 of the present invention;

[0038] Figure 6 This is a comparison chart of the results of different reaction times when LAMP detection of pepper anthracnose pathogen HQY158 was performed in Example 6 of the present invention;

[0039] Figure 7 This is a graph showing the specific results of LAMP detection of pepper anthracnose pathogen HQY158 in Example 6 of the present invention. DETAILED DESCRIPTION

[0040] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0041] In order to better illustrate the embodiments of the present invention, further examples are given below.

[0042] Example 1 Pepper Anthracnose Pathogen HQY158

[0043] This embodiment provides a new species of pepper anthracnose bacteria, namely pepper anthracnose bacteria HQY158. In September 2020, the inventor of this patent isolated microorganisms from pepper diseased fruits in Baoding City, Hebei Province, and discovered a new pathogenic species. The morphological characteristics and molecular biology research of pepper anthracnose bacteria HQY158 are as follows:

[0044] (1) Morphological characteristics of pepper anthracnose pathogen HQY158

[0045] In PDA medium, the colony edge of pepper anthracnose pathogen HQY158 is complete, and the colony diameter is 3.3-3.5cm after 7 days of culture. There are fewer aerial hyphae, and the fruiting bodies are black, solitary or aggregated, surface or buried, and irregular in shape. As the culture time increases, a large number of fruiting bodies are produced, and the front and back of the colony are radiating. The bristles are upright or slightly curved, the wall is smooth or has small warty protrusions, the base cells are brown or dark brown, and the color gradually becomes lighter toward the tip, with 0-1 septa, 33-79μm long, cylindrical at the base, a few are slightly swollen, and 2-5μm in diameter. The spore-producing cells are attached to the inside of the fruiting body, cylindrical or ampoule-shaped, upright or curved, colorless to light brown, 10.5-18×3.5-7μm. Conidia are colorless and transparent, with smooth walls, no septa, straight or slightly curved, cylindrical, blunt at both ends or slightly pointed at the base, 12.5-18×3.5-5.5μm (av.±SD=14.15±1.22×4.58±0.41μm), with a few conidia light brown with 1 septum as the culture time increases. Appressoria are oval, pear-shaped or irregular in shape, with a smooth surface, light brown to dark brown, 7.5-12.5×5.5-7.5μm. Among them, the colony morphology of pepper anthracnose pathogen HQY158 in PDA medium is as follows Figure 1 As shown in Figure 2, the fruiting body morphology of pepper anthracnose pathogen HQY158 in PDA medium is as follows Figure 2 As shown, the conidia of pepper anthracnose pathogen HQY158 are shown in Figure 3 shown.

[0046] (2) Molecular Biology of Pepper Anthracnose Pathogen HQY158

[0047] The total DNA of pepper anthracnose pathogen HQY158 was extracted, and the primers ACT-512F / ACT-783R, CHS-79F / CHS-345R, GDF1 / GDR1, his3 and ITS1 / ITS4 were used to amplify the act fragment, the his3 fragment and the ITS fragment, and then the sequencing, BLAST comparison and multi-gene phylogenetic tree construction were carried out.

[0048] According to the preliminary BLAST comparison results, the strain belongs to the Colletotrichum magnum species complex (CMSC). Based on the act chs-I_gapdh his3 ITS multi-gene sequence dataset, a maximum likelihood tree was constructed using RAxML v.8.2.12. The constructed phylogenetic tree is shown in Figure 4 As shown. Figure 4The results showed that the identified strain formed a sister branch with C. magnum (type strain CBS519.97) in CMSC, with a bootstrap support rate of 99%. The act similarity of the identified strain and the C. magnum type strain was only 97% (identity 244 / 252bp), and the gapdh similarity was only 76% (177 / 233bp, including 45 gaps).

[0049] The morphological characteristics of pepper anthracnose pathogen HQY158 and C. magnum are significantly different, such as growth rate (7-day colony diameter 3.3-3.5cm vs. <3cm), number of bristle septa (0-1 vs. 1-3), and conidial cell production mode (inside the fruiting body vs. produced from hyphae). Molecular biological analysis combined with morphological characteristics comparison identified pepper anthracnose pathogen HQY158 as a new species of the genus Colletotrichum.

[0050] The inventor named the species Colletotrichum qingyuanense, and later deposited the pepper anthracnose pathogen HQY158 strain in the General Microbiological Center of China Microbiological Culture Collection Administration on October 31, 22, with the deposit number CGMCC3.23797.

[0051] Example 2 A specific detection target Cq-GAPDH of pepper anthracnose pathogen HQY158

[0052] The present invention provides a specific detection target Cq-GAPDH of pepper anthracnose pathogen HQY158 by whole genome sequencing and comparison analysis of the differences in genome sequences between pepper anthracnose pathogen HQY158 and other anthracnose pathogen strains. The DNA sequence of the detection target is shown in SEQ ID NO.1, and SEQ ID NO.1 is specifically:

[0053] CATTGGCCGTATCGTCTTCCGCAACGCCGTCGAGCACCCCGACGTCGAGATCGTTGCCGTCAACGACCCCTTCATTGAGACCAAGTACGCTGTGAGTAGCACCTATCCAAGCTCGCCACGATGCCACGCCCGCCACCCCTCAATCGCGAACGTCAGCTCGTAGCTG TCGATGGGTCGGCGTGGCGGGTTCCAACATCATCCAAAGGACTCTGGTTGCTGACACGCCATCCGCAGGCCTACATGCTCAAGTACGACTCTACCCACGGCATCTTCAACGGCGACATCCAGCAGGATGGCAACGACCTCGTCATCAACGGCAAGAAGGTCAAGT.

[0054] Among them, the other anthrax pathogens include 10 strains including Colletotrichum gloeosporioides (Cg), Colletotrichum truncatum (Ct), Colletotrichum scovillei (Csc), Colletotrichumsiamense (Csi), Colletotrichum musicola (Cm), Colletotrichum sojae (Cs), Colletotrichum plurivorum (Cp), Colletotrichum orbiculare (Co), Colletotrichum karsti (Ck) and Colletotrichum fructicola (Cf).

[0055] Example 3 A LAMP primer composition based on Cq-GAPDH

[0056] This embodiment provides a LAMP primer composition based on Cq-GAPDH. The specific contents are as follows:

[0057] The present invention designs a LAMP primer composition based on the target Cq-GAPDH, and the LAMP primer composition comprises: a forward outer primer F3 as shown in SEQ ID NO.2, a reverse outer primer B3 as shown in SEQ ID NO.3, a forward inner primer FIP as shown in SEQ ID NO.4, and a reverse inner primer BIP as shown in SEQ ID NO.5.

[0058] SEQ ID NO.2~5 are as follows:

[0059] SEQ ID NO.2:

[0060] CCAAGTACGCTGTGAGTAGC;

[0061] SEQ ID NO.3:

[0062] TGGATGTCGCCGTGTAAGA;

[0063] SEQ ID NO.4:

[0064] ACGAGCTGACGTTCGCGATTGACCTATCCAAGCTCGCCA;

[0065] SEQ ID NO.5:

[0066] AAGGACTCTGGTTGCTGACACGGCCGTGGGTAGAGTCGTA.

[0067] Example 4 A LAMP kit based on Cq-GAPDH

[0068] The present embodiment provides a LAMP kit based on Cq-GAPDH, wherein the concentration and dosage of each reagent in the kit are: 100 μM forward outer primer F3 1.5 μL, 100 μM reverse outer primer B3 1.5 μL, 100 μM forward inner primer FIP 4.5 μL, 100 μM reverse inner primer BIP 4.5 μL, 10 mM dNTPs 20 μL, 200 mM Tris-HCl 100 μL, 500 mM KCl 100 μL, 20 mM (NH4)2SO4 100 μL, 40 mM MgSO4 50 μL, 8 U / μL Bst DNA polymerase 40 μL, and sterile ultrapure water is used to prepare 1 mL of detection solution.

[0069] Example 5 A LAMP kit based on Cq-GAPDH

[0070] The present embodiment provides a LAMP kit based on Cq-GAPDH, wherein the concentration and dosage of each reagent in the kit are: 100 μM forward outer primer F3 2.0 μL, 100 μM reverse outer primer B3 2.0 μL, 100 μM forward inner primer FIP 6.0 μL, 100 μM reverse inner primer BIP 6.0 μL, 10 mM dNTPs 20 μL, 200 mM Tris-HCl 100 μL, 500 mM KCl 100 μL, 20 mM (NH4)2SO4 100 μL, 40 mM MgSO4 50 μL, 8 U / μL Bst DNA polymerase 50 μL, and sterile ultrapure water is used to prepare 1 mL of the detection solution.

[0071] Example 6 A LAMP detection method for pepper anthracnose pathogen HQY158

[0072] This example provides a LAMP detection method for pepper anthracnose pathogen HQY158, and investigates the sensitivity and specificity of the detection method. The specific contents are as follows.

[0073] (1) This embodiment provides a LAMP detection method for pepper anthracnose pathogen HQY158, the detection method comprising the following steps:

[0074] S1. The DNA of the sample microorganism to be tested was extracted by the CTAB method, 2 μL of the extracted DNA solution with a concentration of 20 ng / μL was taken as a reaction template, 18 μL of the detection solution in the Cq-GAPDH-based LAMP kit provided in Example 5 was added, and a LAMP reaction was performed to obtain an amplified product; wherein the LAMP reaction conditions are: temperature of 66° C. and reaction time of 40 min;

[0075] S2. Add 0.25 μL SYBR Green I to the amplified product, observe the color change of the reaction solution, and judge the result. The judgment result specifically includes the following two situations:

[0076] In the first case, when the color of the reaction solution changes from orange to yellow-green, it is judged that the pepper anthracnose pathogen HQY158 in the sample is positive;

[0077] In the second case, when the color of the reaction solution does not change and remains orange, it is determined that the pepper anthracnose pathogen HQY158 in the sample tested is negative.

[0078] (2) This example investigates the sensitivity and specificity of the above-mentioned LAMP detection method, as follows:

[0079] A. Sensitivity test

[0080] In order to determine the sensitivity of the LAMP detection method provided above, the concentration of the DNA known as pepper anthracnose fungus HQY158 extracted by the CTAB method was measured by a spectrophotometer and then diluted 10 times in series. The DNA template concentration range was set to 100ng / μL~10ag / μL, and 2μL of each diluted DNA dilution solution was taken as a template, and 18μL of the detection solution in the Cq-GAPDH-based LAMP kit provided in Example 5 was added to perform LAMP reaction to obtain an amplified product; wherein, the LAMP reaction conditions are: reaction temperature 66°C, reaction time 40min. 0.25μLSYBR Green I was added to the amplified product, and the results of different DNA template concentrations are compared as shown in the figure below. Figure 5 As shown. Among them, Figure 5 “—” represents the negative control group, and “+” represents that the DNA concentration of pepper anthracnose pathogen HQY158 is 50 ng / ul.

[0081] Depend on Figure 5 It can be seen that when the DNA template concentration of pepper anthracnose pathogen HQY158 is 100ng / μL, 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL, 1pg / uL, 100fg / μL, 10fg / μL, 1fg / μL, and 100ag / μL, the color of the solution in the corresponding reaction tube turns yellow-green, indicating a positive reaction; and when the DNA template concentration of pepper anthracnose pathogen HQY158 is 10ag / μL, the color of the solution in the corresponding reaction tube is still orange, indicating a negative reaction. The results show that the sensitivity of the detection of pepper anthracnose pathogen HQY158 using the LAMP detection primer of the present invention reaches 100ag / μL.

[0082] B. Reaction time

[0083] 2 μL of DNA solution (20 ng / μL) of pepper anthracnose pathogen HQY158 extracted by CTAB method was used as a reaction template (ddH2O was used as a control), and 18 μL of the detection solution in the Cq-GAPDH-based LAMP kit provided in Example 5 was added to perform LAMP. The LAMP reaction conditions were: reaction temperature 66°C, reaction time 20, 30, 40, 50, 60, 70 min, respectively, and then 0.25 μL of SYBR Green I was added to the amplified product, and the color change of the reaction solution was observed. The results are as follows: Figure 6 As shown, Figure 6 The leftmost “—” represents the negative control group.

[0084] Depend on Figure 6It can be seen that within the scope of this experiment, the reaction tubes corresponding to the negative control and the amplification reaction for 20 minutes are still orange, a slight color change can be seen at 30 minutes, and the reaction tubes corresponding to the amplification time of 40 minutes, 50 minutes, 60 minutes, and 70 minutes turn bright green. This shows that within the scope of this embodiment, the reaction time is 40 minutes when the LAMP detection method is used to detect the pepper anthracnose pathogen HQY158 strain.

[0085] C. Specificity

[0086] According to the LAMP detection method for pepper anthracnose pathogen HQY158 established in part (1) of this embodiment, LAMP detection was performed on seven samples to be tested, namely, Colletotrichum qingyuanense (Cq, as a positive control), Colletotrichum gloeosporioides (Cg), Colletotrichum truncatum (Ct), Colletotrichum scovillei (Csc), Colletotrichum siamense (Csi), Fusarium psendograminearum (Fp) and Fusariumgraminearum (Fg), and a synchronous experiment was performed using sterile double distilled water as a template for a negative control. The specificity test results are shown in FIG. Figure 7 As shown. Figure 7 It can be seen that only the color of the reaction tube of sample Cq changed from orange to yellow-green, and the test showed a positive result; the test results of the other 6 samples and the negative control were all negative. This result shows that the LAMP primer combination provided by the present invention has a high specificity for pepper anthracnose pathogen HQY158, can well distinguish it from other pathogens, and the test result is accurate.

[0087] Example 7 A LAMP detection method for pepper anthracnose pathogen HQY158

[0088] This example provides a LAMP detection method for pepper anthracnose pathogen HQY158, and investigates the sensitivity and specificity of the detection method, as described below.

[0089] (1) This embodiment provides a LAMP detection method for pepper anthracnose pathogen HQY158, the detection method comprising the following steps:

[0090] S1. Extract the DNA of the sample microorganism to be tested, take 5 μL of the above DNA solution as a reaction template, add 20 μL of the detection solution in the Cq-GAPDH-based LAMP kit provided in Example 5 to perform LAMP reaction to obtain an amplified product; wherein the LAMP reaction conditions are: 68°C reaction amplification for 30 min;

[0091] S2. Add 0.25 μL SYBR Green I to the amplified product, observe the color change of the reaction solution, and judge the result, which specifically includes the following two situations:

[0092] In the first case, when the color of the reaction solution changes from orange to yellow-green, it is judged that the pepper anthracnose pathogen HQY158 in the sample is positive;

[0093] In the second case, when the color of the reaction solution does not change and remains orange, it is determined that the pepper anthracnose pathogen HQY158 in the sample tested is negative.

[0094] A sensitivity test was performed on the detection method provided in this embodiment, and a similar effect as the method provided in Example 6 was obtained.

[0095] Since the reaction time is affected to a certain extent by the concentration of pepper anthracnose pathogen HQY158 in the sample tested, the LAMP reaction temperature, the amount of detection solution added, etc., the LAMP detection method for pepper anthracnose pathogen HQY158 provided in this embodiment can show a positive result in 30 minutes.

[0096] Example 8 Application of Cq-GAPDH-based LAMP primer combination in detecting pepper anthracnose pathogen HQY158

[0097] The LAMP detection method for pepper anthracnose pathogen HQY158 provided in Example 4 or Example 5 has good sensitivity and high specificity. Based on the common sense of technicians in this field, the DNA of microorganisms in pepper diseased fruits or pepper stems and leaves suspected of pepper anthracnose pathogen HQY158 can be extracted, and the above detection method can be used to detect pepper anthracnose pathogen HQY158 in pepper anthracnose-affected areas.

[0098] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Pepper anthracnose pathogen HQY158, characterized in that Its deposit number is CGMCC 3.23797 and its Latin name is Colletotrichum qingyuanense .

2. A specific detection target Cq-GAPDH of pepper anthracnose pathogen HQY158 as claimed in claim 1, characterized in that: The DNA sequence of the detection target Cq-GAPDH is shown in SEQ ID NO.

1.

3. A LAMP primer composition based on Cq-GAPDH as claimed in claim 2, characterized in that: The LAMP primer composition comprises: a forward outer primer F3 as shown in SEQ ID NO.2, a reverse outer primer B3 as shown in SEQ ID NO.3, a forward inner primer FIP as shown in SEQ ID NO.4, and a reverse inner primer BIP as shown in SEQ ID NO.

5.

4. The use of the LAMP primer combination as claimed in claim 3 in detecting pepper anthracnose pathogen HQY158, characterized in that: The preservation number of the pepper anthracnose pathogen HQY158 is CGMCC 3.23797.

5. Use of the LAMP primer composition as claimed in claim 3 in preparing a LAMP kit based on Cq-GAPDH as claimed in claim 2.

6. A LAMP kit based on the Cq-GAPDH of claim 2, characterized in that: The LAMP kit comprises the LAMP primer composition as claimed in claim 3.

7. The LAMP kit according to claim 6, wherein The LAMP kit also includes dNTPs, Tris-HCl, KCl, (NH4)2SO4, MgSO4 and Bst DNA polymerase.

8. Use of the LAMP kit as claimed in claim 6 or 7 in detecting pepper anthracnose pathogen HQY158, characterized in that: The preservation number of the pepper anthracnose pathogen HQY158 is CGMCC 3.23797.

9. A LAMP detection method for pepper anthracnose pathogen HQY158, characterized in that: The LAMP detection method comprises the following steps: Extract the genome of the sample microorganism to be tested, perform LAMP amplification reaction using the LAMP primer composition described in claim 3 or the Cq-GAPDH-based LAMP kit described in any one of claims 6 to 7, add dye, observe the fluorescent signal, and judge the result; The preservation number of the pepper anthracnose pathogen HQY158 is CGMCC 3.23797.

10. The LAMP detection method according to claim 9, characterized in that The temperature of the LAMP amplification reaction is 62-68° C. and the time is 30-50 min.

Images