Application of a soybean gene Glyma.18G041900

Abstract

The present invention discloses the application of a soybean gene Glyma.18G041900, belonging to the field of plant genetic engineering. The present invention clones a gene that simultaneously controls soybean quality traits and yield traits, providing new clues for soybean molecular-assisted breeding and an important theoretical basis for high-quality and high-yield soybean breeding work. The nucleotide sequence of the soybean gene Glyma.18G041900 is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the soybean gene Glyma.18G041900 is shown in SEQ ID NO.2. By constructing transgenic soybean plants with low-expression and over-expression of the gene Glyma.18G041900, the present invention finds that the gene Glyma.18G041900 can regulate soybean plant height, 100-seed weight, mature seed particle size, protein content and oil content. The gene Glyma.18G041900 of the present invention plays an important role in improving soybean quality and is applicable to the field of soybean molecular breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and mainly relates to the application of a soybean gene Glyma.18G041900. Background Art

[0002] Increasing the accumulation of soybean protein and oil content has always been the main goal of soybean breeding programs. However, the utilization rate of soybean germplasm resources is low, and there is a negative correlation between soybean protein content and oil content. Therefore, increasing soybean protein content while achieving the expected oil content is a huge challenge in the process of improving soybean quality. Nicastrin (NCT), also known as Nakastruin protein, is a component of the γ-secretase complex. In animals, γ-secretase has been shown to generate Aβ peptides by cleaving amyloid precursor protein. The aggregation of Aβ peptides is closely related to Alzheimer's disease (AD). It can also participate in Notch signal transduction, affect melanin synthesis, and the endocytosis, transport, and degradation of membrane proteins (Bolduc et al., 2015; Kovall et al., 2017; Confaloni et al., 2005). However, at present, the research on NCT protein is mainly carried out in humans and animals, and there are very few reports in plants. In 2014, Michalina et al. first analyzed the genetic and functional data of the γ-secretase complex in Arabidopsis thaliana. They found that the genes of γ-secretase homologs also exist in the plant genome, and its important amino acid sequences are conserved in plants. In addition, they also found that NCT co-localizes with the VTI12 protein involved in the post-Golgi transport of storage proteins. Similarly, the present invention is the first to conduct a functional study on NCT protein in plants and link NCT protein with soybean quality and yield traits, filling the research gap of NCT protein in soybeans.

[0003] The basic research on high-oil and high-yield soybean breeding is weak, the utilization rate of soybean germplasm resources is low, and there is a lack of gene cloning and its molecular mechanism research related to soybean quality traits and yield traits. Therefore, developing more gene cloning and its molecular mechanism related to soybean quality traits and yield traits is an urgent problem to be solved. Summary of the Invention

[0004] The present invention discloses the application of a soybean gene Glyma.18G041900, clones a gene that simultaneously controls soybean quality traits and yield traits, provides new clues for soybean molecular assisted breeding, and provides an important theoretical basis for high-quality and high-yield soybean breeding work.

[0005] The technical solution of the present invention is as follows:

[0006] Application of soybean gene Glyma.18G041900 in regulating protein content and oil content of soybean seeds. The nucleotide sequence of the soybean gene Glyma.18G041900 is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by the soybean gene Glyma.18G041900 is shown as SEQ ID NO.2.

[0007] Application of the recombinant expression vector containing the soybean gene Glyma.18G041900 in regulating protein content and oil content of soybean seeds.

[0008] Application of the recombinant bacterium containing the soybean gene Glyma.18G041900 in regulating protein content and oil content of soybean seeds.

[0009] Application of the soybean gene Glyma.18G041900 in soybean molecular breeding.

[0010] Application of the recombinant expression vector containing the soybean gene Glyma.18G041900 in soybean molecular breeding.

[0011] Application of the recombinant bacterium containing the soybean gene Glyma.18G041900 in soybean molecular breeding.

[0012] Beneficial effects

[0013] In the present invention, Glyma.18G041900 belongs to the Nicastrin protein and contains 664 amino acid residues. Through tissue expression analysis, it is found that the expression level of Glyma.18G041900 is the highest mainly in the LM stage of soybean seeds. Subcellular localization shows that the Glyma.18G041900 protein is mainly located in the cell membrane. Using the plant overexpression vector pSOY1-GmM28 and the knockout vector pCBSG015-GmM28, transgenic plants of Glyma.18G041900 are obtained. It is found that compared with the control soybean plants, the plant height, 100-seed weight, mature seed particle size, protein and oil content of the transgenic soybeans have significant changes. The present invention discloses the utility of this gene in regulating the protein and oil content of soybeans, and at the same time finds that this gene can affect the seed length, seed width, plant height and 100-seed weight of soybean seeds, belonging to a soybean pleiotropic gene. The research on the Glyma.18G041900 gene provides new insights into the genetic mechanism of the accumulation of protein and oil content in soybean seeds, provides new ideas for the breeding of high-yield soybeans, and provides new targets for the development of soybean molecular markers. The present invention provides new clues and important bases for the genetic improvement and breeding work of high-oil and high-yield soybeans. Description of the drawings

[0014] Figure 1Phylogenetic tree analysis of GmM28 gene family proteins in different species;

[0015] Figure 2 Gene structure analysis of homologous genes in soybean and Arabidopsis thaliana;

[0016] Figure 3 Prediction of cis - acting elements related to the GmM28 promoter;

[0017] Figure 4 Protein domain of the GmM28 gene;

[0018] Figure 5 Expression levels of candidate genes in different tissues of soybean;

[0019] Figure 6 Analysis of tissue - specificity and grain expression of GmM28 gene at different developmental stages;

[0020] Figure 7 Soybean GmM28 PCR amplification product, M is DL2000 Plus DNA molecular weight standard; 1 - 5 are PCR amplification results of the GmM28 gene;

[0021] Figure 8 PCR amplification product of FU28 - GmM28 plasmid transformed into Escherichia coli, M is DL2000 Plus DNA molecular weight standard, 1 - 13 are PCR amplification results, 1 is water, 2 is plasmid, 3 - 13 are PCR amplification products of FU28 - GmM28 plasmid transformed into Escherichia coli;

[0022] Figure 9 PCR amplification product of pSOY1 - GmM28 plasmid transformed into Escherichia coli, M is DL2000 Plus DNA molecular weight standard, 1 - 13: PCR amplification results; 1: water; 2: plasmid; 3 - 13: PCR amplification products of pSOY1 - GmM28 plasmid transformed into Escherichia coli;

[0023] Figure 10 PCR amplification product of pSOY1 - GmM28 plasmid transformed into Agrobacterium tumefaciens, M is DL2000 Plus DNA molecular weight standard, 1: water, 2 - 9 are PCR amplification products of pSOY1 - GmM28 plasmid transformed into Agrobacterium tumefaciens;

[0024] Figure 11 PCR amplification product of pCBSG015 - GmM28 plasmid transformed into Escherichia coli, M is DL2000 Plus DNA molecular weight standard, 1 - 9 are PCR amplification results, 1 is water; 2 - 9 are PCR amplification products of pCBSG015 - GmM28 plasmid transformed into Escherichia coli;

[0025] Figure 12 PCR amplification products of Agrobacterium tumefaciens transformed with plasmid pCBSG015-GmM28. M is the DL2000 Plus DNA molecular weight standard. 1-7 are the PCR amplification results. 1 is water; 2-7 are the PCR amplification products of Agrobacterium tumefaciens transformed with plasmid pCBSG015-GmM28;

[0026] Figure 13 Subcellular localization of GmM28;

[0027] Figure 14 Soybean genetic transformation process;

[0028] Figure 15 PCR detection and qRT-PCR identification of overexpression plants. Figure A is the PCR detection map of overexpression plants, where M is the DL2000 Plus DNA molecular weight standard, 1 is the recipient DN50, 2 is the plasmid, 3-14 are transgenic plants, and Figure B is the qRT-PCR identification map;

[0029] Figure 16 Western blot detection of transgenic plants;

[0030] Figure 17 Schematic diagram of soybean mutant knockout;

[0031] Figure 18 For T 4 Agronomic traits of T-generation transgenic soybean plants;

[0032] Figure 19 For T 4 Agronomic traits of seeds of T-generation transgenic soybean plants;

[0033] Figure 20 Total nitrogen content, total fatty acid content and fatty acid content of transgenic plants. Detailed implementation methods

[0034] To make the objectives, technical solutions and effects of the present invention clearer and more definite, the present invention is further described in detail below. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0035] Example 1

[0036] Bioinformatics analysis of the Hub gene (Glyma.18G041900).

[0037] Nucleotide sequence of the Glyma.18G041900 gene (version a2.v1 of the phytozome database): (SEQ ID NO.1)

[0038]

[0039] Amino acid sequence of Glyma.18G041900 gene ((version a2.v1 of phytozome database): SEQ ID NO.2

[0040] MALTVFSLFFFFLSFTFHLPSGFSAPWNQCLIYASIDGYPCVRLMNLSGTIGCSNPGRDKVVAPIVRFENVDRIAEPSAVLVSLDEFPTLFTRISDDSSFASKVGGVLVEPSTDFQKKLKGFSPDQKFPQAQFALYHNTSYEWNPIGSGIMWKSYNFPVFLLTESGSKTLQEFVTKNEDTKKSYTSNVAEFDLVMQTVKSGTHDSESCLKEETCLPLGGYSVWSSLPPINISSLQRSKPILLTVASMDSASFFRDKSLGADSPISGLIALLAAVDALSHLDGLGDLSKQLVFAVFTGEAWGYLGSRRFLVELDMHSDAVHGLNQTLIETVIEIGSVGKGLSQGVKNFFAHTKGDSSATNQTVAALKRAQESLISENIKIASASASNPGIPPSSLMSFLEKNPAISGVVLEDFDSVFVNKFYHSHLDDLSNVNSSAVVAAASLIARTLYMLASETEDVQNSTLAAINVNVSLVEQLLGCLLDCDPGLSCELVKKYISPMSTCPSHYVGVILDEPSSAPYAGYINDVPRFIWNFLADRTSIPRENNISDCQHGCNGRDEVCVKAETDGKGVCVLSTTRYVPAYSTRLKFESGVWNVLPPNSSDKMGVVDPVWTESNWNTIGMRVYTVQNAAYDRLVLFGGITLTVFAYLAIATARAFFNKAMKRD

[0041] Combined with homologous alignment, Glyma.18G041900 is abbreviated as GmM28, and Glyma.18G041900 in the embodiments of the present invention has been abbreviated as GmM28.

[0042] Search for the PF number (PF04389) of the GmM28 gene in the Phytozome database, and search for this PF number in the soybean database. Screen out the genes with the same domain structure as the GmM28 gene as its gene family members. As shown in Table 1, we organized information such as the start - end positions on the chromosome, ORF length, protein sequence length, molecular weight, and isoelectric point of the genes. The data in the table can be obtained from the Phytozome database and the SIB website. The results showed that the GmM28 gene and its 6 family members were located on 6 different chromosomes. Among them, 2 genes were distributed on chromosome 18, namely the target gene GmM28 and its family member Glyma.18G131500; Glyma.05G146600, Glyma.08G103300, and Glyma.11G214700 were located on chromosomes 5, 8, and 11; among the family members, the Glyma.16G102200 gene located on chromosome 16 had the smallest ORF length, number of amino acids, isoelectric point, and molecular weight. On the contrary, the largest was the Glyma.10G210900 gene located on chromosome 10.

[0043] Table 1 Information on the GmM28 gene family in soybean

[0044]

[0045] Use the PF number (PF04389) of the GmM28 gene and its conserved domain to screen out homologous genes of different species that are highly similar to the candidate genes in the Phytozome database, including 6 soybean genes, 1 Arabidopsis gene, 2 sorghum genes, 2 maize genes, 3 rice genes, 3 common bean genes, and 3 alfalfa genes. Construct a phylogenetic tree using MEGA5 and draw a gene structure diagram using the IBS mapping software. As Figure 1As shown in the figure, the gene families of different species are divided into 3 Clusters. GmM28 and Glyma.11G214700 are located in Cluster I and have relatively similar gene structures, both containing multiple introns and exons; Glyma.08G103300, Glyma.05G146600, and AT1G67420 of Arabidopsis thaliana all belong to Cluster III. Among them, AT1G67420, Glyma.08G103300, and Glyma.05G146600 contain 20, 21, and 22 exons respectively, and their sizes and positions in the sequence vary little. Glyma.10G210900 and Glyma.18G131500 both belong to Cluster II and have relatively fewer introns and exons compared to the above genes; the gene of Glyma.16G102200 has only 4 exons and 3 introns. This shows that GmM28 has the closest genetic relationship with Phaseolus vulgaris, which is also a leguminous plant. It can also be seen from the protein sequence and gene structure that there is a high homology between the candidate gene and Glyma.11G214700( Figure 2 ).

[0046] Search for the promoter sequence of 2000 bp upstream of the ATG of the GmM28 gene in the Phytozome database, perform cis-acting element analysis according to the PlantCARE website, and select 10 response elements for drawing for relevant analysis. The results show that the promoter sequence of the candidate gene contains multiple different functional elements. Among them, there are 5 functional elements related to light reaction, namely 3-AF1, GT1-motif, G-box, Box 4, and LAMP; various hormone-related functional elements are also found. Among them, CGTCA and TGACG are both MeJA response elements, the auxin response element TGA is found at 554 bp, the cis-acting element TCA responsive to salicylic acid is present at 1514 bp, and the ethylene response element ERE binds at 901 bp and 1859 bp. In addition, the cis-acting element TC-rich repeats involved in drought defense is found at 1425 bp; the cis-regulatory element ARE essential for anaerobic induction is present at positions 741 bp, 1524 bp, 1199 bp, and 1939 bp in the sequence. In summary, these cis-acting elements present in the promoter may have a certain regulatory function on the growth, development, and physiological processes of soybean plants( Figure 3 , Table 2).

[0047] Table 2 Prediction Table of the GmM28 Gene Sequence Promoter

[0048]

[0049]

[0050]

[0051] Obtain the protein sequence of the GmM28 gene from the Phytozome database, submit the protein sequence to the SMART website for protein domain prediction, and draw a graph using the IBS software. As Figure 4 shown, there is a Nicastrin domain at 239 - 467 bp in the candidate gene. This component is a major component of γ-secretase. Existing studies have shown that Nicastrin can promote the maturation and transport of complex components in cells. In animals, plants, and humans, it may also be involved in processes such as cell signal transduction, endocytosis regulation, transport, and degradation of membrane proteins.

[0052] Example 2

[0053] Prediction and analysis of the expression of the candidate gene in different tissue parts.

[0054] Use the Phytozome database to screen out the predicted expression levels of the candidate gene and its family members in different tissues of soybean, such as flowers, leaves, root nodules, pods, roots, root hairs, seeds, apical meristems, and stems, and make Table 2 - 3, Figure 5 which is generated by the TBTools mapping software. The results show that the expression levels of the 7 genes are different in the above tissues. The expression level of the GmM28 gene is the highest in flowers and the lowest in the apical meristem, and it has a relatively high level of expression in each part; the expression levels of Glyma.08G103300 and Glyma.10G210900 reach the highest in stems and roots; the expression levels of Glyma.05G146600 and Glyma.11G214700 are the highest in pods; compared with these genes, Glyma.16G102200 is only expressed in meristems and stems; Glyma.18G131500 is only expressed in meristems and at a relatively low level. It is thus speculated that the candidate gene plays an important regulatory role during the growth and development of soybeans.

[0055] Example 3

[0056] Analysis of the tissue specificity of the GmM28 gene and its expression level in grains at different developmental stages.

[0057] RNA was extracted from different tissue parts (roots, stems, leaves, flowers, pods) of Suinong 14 materials and seeds at different developmental stages (cot, EM, MM, LM, DS), reverse transcribed into cDNA, and RT-PCR analysis was carried out. Using the soybean Actin4 gene as an internal reference gene, the amplification primers for Actin4 were: Actin4 forward primer sequence: GTGTCAGCCATACTGTCCCCATTT (SEQ ID NO.13), Actin4 reverse primer sequence: GTTTCAAGCTCTTGCTCGTAATCA (SEQ ID NO.14). Using the cDNA from different tissues or organs of soybean Suinong 14 as a template, real-time fluorescence quantitative PCR analysis was carried out. The amplification primers for the GmM28 gene were: qGmM28-F: CCGATTGGAGTTTGATAAGCAG (SEQ ID NO.15), qGmM28-R: GTCTTCTCAGCTTTCTTCCTCT (SEQ ID NO.16). RT-PCR was used to analyze whether there were differences in the expression levels of the GmM28 gene in various tissue parts and seeds at different developmental stages. The results are as Figure 6 shown. The GmM28 gene was expressed in all tissue parts and at different developmental stages. Among them, the expression levels in different tissues from high to low were: Pod > Root > Leaf > Stem, and the expression level in pods was about 2 times that of stems. In addition, the expression level of the GmM28 gene showed a gradually increasing trend during the Cot-LM development process and reached a peak at the LM stage, and then slightly decreased during the LM-DS development stage. The specific expression levels of the GmM28 gene at different developmental stages from high to low were: LM stage > MM stage > DS stage > EM stage > Cot stage. The expression level at the LM stage was 3 times that of the Cot stage, and the expression level at the MM stage was also more than 2 times that of the Cot stage.

[0058] Example 4

[0059] Cloning and vector construction of soybean GmM28 gene.

[0060] 1) Cloning of GmM28 gene

[0061] According to the Phytozome database, the CDS sequence of the GmM28 gene is 1992 bp (phytozome database version a2.v1). Candidate gene-specific primers were designed using SnapGene software. Total RNA was extracted from the leaves of soybean cultivar SN14 and reverse-transcribed into cDNA, which was used as a template for PCR amplification. Forward primer GmM28-F: TCTAGAATGGCGCTAACCGTTTTCTC (SEQ ID NO.17); reverse primer GmM28-R: GAATTCATCCCTCTTCATTGCTTTG (SEQ ID NO.18). The results are as Figure 7 shown: A 1992-bp PCR product was amplified by electrophoresis. The correctly amplified fragment was recovered using a gel extraction kit for subsequent vector construction.

[0062] 2) Construction of the FU28-GmM28 entry vector

[0063] The recovered target fragment and the FU28 empty vector were double-digested with XbaI and EcoRI restriction endonucleases and then ligated with SolutionI. The ligated product was transformed into DH5α and cultured on a plate containing the corresponding resistance until single colonies grew. PCR identification was performed using this single colony and the GmM28-specific primers, and the sample was sent to Sangon for sequencing. The results are as Figure 8 shown: The expected target band was detected by electrophoresis at 1992 bp, and the sequencing result was also correct, indicating that the entry vector construction was completed. The bacterial strain was preserved for subsequent experiments.

[0064] 3) Construction of the pSOY1-GmM28 expression vector

[0065] The plasmid of the constructed entry vector (FU28-GmM28) and the empty plasmid of the expression vector pSOY1 bacterial strain were extracted. The recombinant plasmid was obtained through an LR reaction and transformed into Escherichia coli DH5α. It was cultured on a plate containing the corresponding resistance until single colonies grew. PCR identification was performed using this single colony and the GmM28-specific primers, and the sample was sent to Sangon for sequencing. The results are as Figure 9 shown: The expected target band was detected by electrophoresis at 1992 bp, and the sequencing result was also correct, indicating that the expression vector construction was completed. The bacterial strain was preserved for subsequent experiments.

[0066] 4) Transformation of the pSOY1-GmM28 expression vector into Agrobacterium tumefaciens

[0067] The plasmid of the expression vector (pSOY1-GmM28) was transferred into EHA105 Agrobacterium competent cells by electroporation and cultured on a plate containing the corresponding resistance until single colonies grew. PCR identification was performed using this single colony. The results are as Figure 10As shown: The expected target band appeared at 1992 bp in the electrophoresis, indicating that the expression vector (pSOY1-GmM28) had been successfully transferred into Agrobacterium tumefaciens.

[0068] 5) Construction of the pCBSG015-GmM28 knockout vector

[0069] Online website CRISPR-P was used to design the target sequences online. Target 1: GATTTTCAGAAGAAGTTAAAGGG (SEQ ID NO.19); Target 2: ATCATAATACCAGCTATGAATGG (SEQ ID NO.20). After digestion with enzymes and ligation, the ligation product was transformed into Escherichia coli DH5α. Single colonies were picked on the Kan-resistant plate for expanded culture, followed by PCR amplification and sent to Sangon for sequencing. The results are as Figure 11 shown: The expected target band was detected at around 1000 bp in the electrophoresis, and the sequencing result was also correct, indicating that the knockout vector construction was completed. The bacterial strain was preserved for subsequent experiments.

[0070] 6) Transformation of the pCBSG015-GmM28 knockout vector into Agrobacterium tumefaciens

[0071] The plasmid of the knockout vector (pCBSG015-GmM28) was transferred into the competent cells of Agrobacterium tumefaciens EHA105 by electroporation. The cells were cultured on the plate containing the corresponding resistance until single colonies grew out, and PCR identification was carried out using the single colonies. The results are as Figure 12 shown: The expected target band appeared at around 1000 bp in the electrophoresis, indicating that the knockout vector (pCBSG015-GmM28) had been successfully transferred into Agrobacterium tumefaciens.

[0072] Example 5

[0073] Subcellular localization.

[0074] To study the expression site of the candidate gene GmM28 protein, the recombinant vector pSOY1-GmM28-GFP and the control vector 35S:GFP were respectively injected into the tobacco leaves at the age of 3 weeks by the Agrobacterium tumefaciens injection method. After placing them in the incubator for two days, the injected leaves were cut with a puncher and placed on a glass slide. A drop of distilled water was dropped to moisten and pressed with a coverslip. After driving away the bubbles, the fluorescence localization of the pSOY1-GmM28-GFP fusion protein was observed under a laser confocal microscope. The results are as Figure 13 shown: The green fluorescence signal of 35S:GFP appeared on the cell membrane and the nuclear membrane, while the green fluorescence signal of pSOY1-GmM28-GFP only appeared on the cell membrane, indicating that GmM28 was localized to the cell membrane.

[0075] Example 6

[0076] Obtaining and Detection of Transgenic Soybeans

[0077] 1) Obtaining of Transgenic Soybeans

[0078] Using the Agrobacterium-mediated cotyledon node transformation method of soybeans, the expression vector (pSOY1-GmM28) and the knockout vector (pCAS9-GmM28) were transferred into the receptor variety Dongnong 50. After processes such as explant infection, co-cultivation, induction of cluster buds, screening and elongation of cluster buds, rooting and acclimatization ( Figure 14 ) overexpressed regenerated plants and mutant regenerated plants were obtained respectively for subsequent propagation of transgenic plants and data collection.

[0079] 2) Identification of T 4 Generation Overexpressed Plants

[0080] PCR detection and qRT-PCR identification of overexpressed plants.

[0081] Seeds of T 3 generation overexpressed plants were sown in the phenotype park of Northeast Agricultural University. When the first trifoliate leaf unfolded, DNA of transgenic plant leaves was extracted and PCR amplification was carried out by the "double primer method". Among them, GmActin4 primers were used to ensure the integrity of amplification, GmActin4-F: GTGTCAGCCATACTGTCCCCATTT (SEQ ID NO.21), GmActin4-R: GTTTCAAGCTCTTGCTCGTAATCA (SEQ ID NO.22); another pair of primers had the upstream as the last 20 - 25 bp in the 35S sequence of the expression vector pSOY1 and the downstream as the last 20 bp of the full-length CDS sequence of the target gene, 35S-F: GAGCATCGTGGAAAAAGAAGAC (SEQ ID NO.23); GmM28-F: ATCCCTCTTCATTGCTTTGTTG (SEQ IDNO.24). The results were as Figure 15 (A) shown: "Double bands" could be detected in transgenic plants, while only a band at 500 bp was detected in the receptor Dongnong 50 and non-transgenic plants. The change characteristics of the expression levels of transgenic plants and control plants were analyzed by qRT-PCR. Using GmActin4 as the internal reference gene (primer sequences were the same as in Example 3), and the expression level of Dongnong 50 as the reference for qRT-PCR amplification. The results were as Figure 15 (B) shown. The expression levels of overexpressed plant lines from high to low were: OE-2 > OE-3 > OE-1 > Null plants. Among them, the expression levels of 3 overexpressed lines were significantly higher than those of the control plants, and there were extremely significant differences.

[0082] Western blot detection of overexpressed plants.

[0083] To further identify the positive overexpressing plants, Western blot was used for detection at the protein level. Overexpressing transgenic plants with consistent and robust growth were selected, and total proteins from leaf tissues were extracted for Western Blot detection. The results are as Figure 16 shown. For the leaf tissues of the three overexpressing lines, the target protein bands could be detected near 120 kDa, and they were consistent with the predicted size.

[0084] T 4 generation mutant soybean plant sequencing alignment and mutation types.

[0085] The T 3 generation mutant seeds were sown in the phenotypic garden of Northeast Agricultural University. When the first trifoliate leaf of the mutant plants unfolded, leaf DNA of the mutant plants was extracted. Using the receptor plant DN50 as a negative control for PCR molecular detection, the PCR products were sent to Sangon for sequencing, and the results were plotted as Figure 17 . It can be seen from both the sequencing peak map and the target positions that mutation type A deleted 4 bases (GTTA) at target 1 and added 5 bases (TGTGA) at target 2; mutation type B deleted 68 bp in the CDS region between the two targets, and both mutation types caused premature termination of amino acids.

[0086] Example 7

[0087] T 4 generation transgenic soybean plant agronomic traits.

[0088] The T 3 generation mutant seeds were sown in the phenotypic garden of Northeast Agricultural University. On the premise of ensuring that the growth environment of each transgenic plant was consistent with that of the control, after all the plants matured, the agronomic trait data of plant height, 100-seed weight, and particle size were measured, and the results were sorted as Figure 18 、 19 shown.

[0089] The plant heights of the overexpressing plants were all extremely significantly higher than those of the control group, while the plants of the mutants were all extremely significantly lower than the control; in terms of 100-seed weight, the three overexpressing lines were extremely significantly higher than the control, while type A and type B in the mutants were extremely significantly and significantly lower than the control respectively; in terms of particle size, among the overexpressing lines, except that the seed length of OE-3 was significantly higher than the control, the seed lengths and widths of other lines were extremely significantly higher than the control. Among the mutant lines, except that the seed width of KO-B was significantly lower than the control, the seed lengths, widths of KO-A, and the seed length of KO-B were all extremely significantly lower than the control. In summary, the GmM28 gene can affect the plant height, 100-seed weight, and particle size of soybean plants.

[0090] Example 8

[0091] Determination of the protein and oil content in the seeds of T3 and T4 transgenic soybeans.

[0092] Overexpressing plants, mutant plants, and control plants were grown under the same conditions. The T 3 and T 4 generation transgenic mature seeds were collected by plant line. The seeds were ground into powder with a sterilized mortar, sieved, weighed, and recorded. The total nitrogen content of soybean seeds was determined by the Dumas combustion method for nitrogen, as shown in Figure 20 (A, D): The total nitrogen content of soybean plants from high to low was: OE, WT, KO. Among them, the total nitrogen content of the overexpressing lines was significantly higher than that of WT, and both mutant types of the mutants were significantly lower than the control. At the same time, the fatty acid content of the seeds was determined by gas chromatography. As can be seen from Figure 20 (B, E), the phenotypic characteristics of the total fatty acid content in the seeds of transgenic plants were opposite to those of the total nitrogen content in the seeds. The total fatty acid content from high to low was: KO, WT, OE. Among them, the total fatty acid content of mutant A was significantly higher than that of WT, and the total fatty acid content of the overexpressing lines was significantly lower than that of WT.

[0093] Next, the five fatty acid components of palmitic acid, stearic acid, oleic acid, linoleic acid, and linolenic acid were analyzed. The results are shown in Figure 20 (C, F): The total fatty acid content of mutant plants increased extremely significantly. Among them, stearic acid and oleic acid decreased significantly, while linoleic acid and linolenic acid increased significantly; in contrast, the total fatty acid content of overexpressing plants decreased extremely significantly. Among them, stearic acid and oleic acid decreased significantly, while linoleic acid and linolenic acid increased significantly.

[0094] The above results indicate that when the candidate gene GmM28 loses its gene function, the fatty acid content in the seeds shows an obvious upward trend, and the protein content in the seeds decreases significantly; when its gene function is enhanced, the total fatty acid content decreases significantly, and at the same time, the protein content in the seeds increases greatly. This shows that the gene GmM28 can affect both the oil content and protein content of soybeans. The soybean gene Glyma.18G041900 can be applied to the regulation of the protein content and oil content in soybean seeds and soybean molecular breeding.

Claims

1. Application of soybean gene Glyma.18G041900 in regulating the protein content and oil content of soybean grains, characterized in that: The nucleotide sequence of the soybean gene Glyma.18G041900 is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by the soybean gene Glyma.18G041900 is shown as SEQ ID NO.

2.

2. Use of a recombinant expression vector containing the soybean gene Glyma.18G041900 described in claim 1 in regulating the protein content and oil content of soybean grains.

3. Use of a recombinant bacterium containing the soybean gene Glyma.18G041900 described in claim 1 in regulating the protein content and oil content of soybean grains.

4. Use of the soybean gene Glyma.18G041900 described in claim 1 in soybean molecular breeding.

5. Use of the recombinant expression vector containing the soybean gene Glyma.18G041900 described in claim 1 in soybean molecular breeding.

6. Use of a recombinant bacterium containing the soybean gene Glyma.18G041900 described in claim 1 in soybean molecular breeding.

Images