Application of TPK1 in radiosensitization of hypopharyngeal carcinoma

Abstract

The present invention relates to the application of TPK1 in radiotherapy sensitization of hypopharyngeal cancer. Through a large number of studies and screenings, the present invention found that TPK1 is a gene that is extremely related to radiotherapy tolerance of hypopharyngeal cancer. It is highly expressed in hypopharyngeal cancer tissue, and radiotherapy will further increase its expression level in tumor tissue. When TPK1 is inhibited or knocked out, it can significantly inhibit the proliferation, cloning and other functional activities of hypopharyngeal cancer cells, and reduce the growth rate and volume of the tumor. The present invention also conducts in-depth research on the mechanism of action between TPK1 and radiotherapy tolerance of hypopharyngeal cancer, and designs and screens small molecule active ingredients PTDM for TPK1 targets, which can effectively target TPK1 to produce inhibitory activity to enhance the sensitization effect of hypopharyngeal cancer after radiotherapy. The present invention provides a new drug treatment target for humans to conquer hypopharyngeal cancer, and provides a new direction for subsequent drug development, clinical treatment, etc., with extremely high social value and market application prospects.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to the application of TPK1 in radiosensitization of hypopharyngeal cancer. Background Art

[0002] Hypopharyngeal carcinoma refers to a malignant tumor originating from the epithelium of the hypopharynx, mainly a poorly differentiated squamous cell carcinoma, which often occurs in the pyriform sinus, postcricoid region, and posterior pharyngeal wall. The incidence of hypopharyngeal carcinoma is relatively low, accounting for about 5% of all head and neck malignant tumors, but the malignancy is relatively high, due to its characteristics of spreading along the mucosa or submucosa, that is, invasive expansion. The actual range of the lesion often exceeds the range of the tumor seen in clinical examination, and it is easy to invade the oropharynx, larynx, cervical esophagus or thyroid gland. In addition, the onset is hidden, and most of the patients are in the late stage when diagnosed (about 70%-85% of patients are in stage III-IV). Overall, the prognosis of patients with hypopharyngeal carcinoma is poor, with a 5-year overall survival rate of only 15%-45%.

[0003] For patients with early hypopharyngeal cancer (T1-2N0M0), both CSCO and NCCN guidelines recommend surgery or radiotherapy alone. Retrospective analysis shows that the overall efficacy of the two is similar (the 5-year local control rate of organ-preserving transoral laser surgery is about 70-84%, and radiotherapy is about 85%). For patients with locally advanced disease, in order to ensure the surgical effect, total laryngectomy and large-scale neck lymph node dissection are often required, and adjuvant radiotherapy or chemoradiotherapy is also required after surgery.

[0004] In recent years, with the continuous improvement of radiotherapy technology, comprehensive treatment based on intensity modulated radiotherapy (IMRT) or three-dimensional conformal radiotherapy (3D-CRT) has gradually replaced total laryngectomy and become the main treatment for locally advanced hypopharyngeal cancer. For patients with locally advanced stage III-IV A (T2-T4aM0), retrospective analysis results showed that the 3-year OS of surgery (total laryngectomy or partial laryngectomy + neck lymph node dissection) was 37.9% and 44.1% respectively compared with radical radiotherapy and chemotherapy (p = 0.178). This shows that non-surgical methods based on radiotherapy can achieve similar survival as surgery-based treatment methods, but patients retain their larynx and benefit more. Therefore, the treatment model of hypopharyngeal cancer has gradually changed from the original surgery-based treatment to comprehensive treatment based on radiotherapy, and radiotherapy resistance is an urgent problem that needs to be solved. Summary of the invention

[0005] The purpose of the present invention is to solve the problem of treatment tolerance existing in the radiotherapy process of hypopharyngeal cancer in the prior art, thereby providing a target TPK1 that is highly correlated with the radiotherapy tolerance of hypopharyngeal cancer. By knocking out TPK1 or inhibiting its expression, the radiotherapy effect of hypopharyngeal cancer patients can be significantly improved and the radiotherapy tolerance can be reduced. At the same time, by detecting the expression of the biomarker TPK1 in the body, the radiotherapy tolerance can be predicted, providing an auxiliary diagnostic basis for the formulation of subsequent treatment plans and prognosis evaluation.

[0006] In order to solve the above technical problems, the present invention is implemented through the following technical solutions.

[0007] The first aspect of the present invention provides the use of a TPK1 inhibitor in the preparation of a product for improving the radiosensitivity of hypopharyngeal cancer, wherein the TPK1 inhibitor is selected from one or more of a small molecule compound, a shRNA, sgRNA, and siRNA designed based on TPK1; the structure of the small molecule compound is shown in the following formula:

[0008]

[0009] Preferably, the sgRNA sequence is selected from one or more of SEQ ID NO: 1 (5'-CCTGCT TTCCACTGGGAATTT-3'), SEQ ID NO: 2 (5'-CGCTTATATGATATCACC GAA-3'), SEQ ID NO: 3 (5'-GACTTTACTAAGTGCCTTAAA-3'), SEQ ID NO: 4 (5'-CAGAGAATACTATGCTACTAA-3'), and SEQ ID NO: 5 (5'-CATTGGTCAGTACTTCCAATA-3').

[0010] The second aspect of the present invention provides a pharmaceutical composition for improving the radiosensitivity of hypopharyngeal cancer, comprising a TPK1 inhibitor and a pharmaceutically acceptable carrier; the TPK1 inhibitor is selected from one or more of a small molecule compound, shRNA, sgRNA, and siRNA designed based on TPK1; the structure of the small molecule compound is shown in the following formula:

[0011]

[0012] Preferably, the sgRNA sequence is selected from one or more of SEQ ID NO: 1 (5'-CCTGCT TTCCACTGGGAATTT-3'), SEQ ID NO: 2 (5'-CGCTTATATGATATCACC GAA-3'), SEQ ID NO: 3 (5'-GACTTTACTAAGTGCCTTAAA-3'), SEQ ID NO: 4 (5'-CAGAGAATACTATGCTACTAA-3'), and SEQ ID NO: 5 (5'-CATTGGTCAGTACTTCCAATA-3').

[0013] Preferably, the pharmaceutically acceptable carrier is selected from one or more of a filler, a disintegrant, a binder, a lubricant, a flavoring agent, a preservative, an antioxidant, and a colorant.

[0014] The third aspect of the present invention provides the use of a small molecule compound in the preparation of a drug for improving the radiosensitivity of hypopharyngeal cancer, wherein the structure of the small molecule compound is shown in the following formula:

[0015]

[0016] Preferably, the small molecule compound improves the radiosensitivity of hypopharyngeal cancer by targeting and inhibiting TPK1.

[0017] A fourth aspect of the present invention provides the use of a reagent for detecting the expression level of TPK1 in the preparation of a composition for detecting the radiotherapy sensitivity and / or predicting the therapeutic effect of hypopharyngeal cancer.

[0018] Preferably, the reagent for detecting the expression level of TPK1 includes primers for detecting the expression level of TPK1 gene and / or a reagent for detecting the expression level of TPK1 protein.

[0019] Preferably, the primers for detecting the expression level of the TPK1 gene are selected from at least one of the following primer pairs:

[0020] Primer pair 1: the upstream primer sequence is shown in SEQ ID NO: 6 (ATGCCTTTACCCCGTTG GAG), and the downstream primer sequence is shown in SEQ ID NO: 7 (AGTGGGCTTCCCCTAGAGAG);

[0021] Primer pair 2: the upstream primer sequence is shown in SEQ ID NO: 8 (ATCTCCAGTCTGTGGCT CCT), and the downstream primer sequence is shown in SEQ ID NO: 9 (CTCCAACGGGGTAAAGGCAT);

[0022] Primer pair 3: the upstream primer sequence is shown in SEQ ID NO: 10 (ATGGAGCATGCCTTTA CCCC), and the downstream primer sequence is shown in SEQ ID NO: 11 (TAAGGCCACACCAATCAC CC);

[0023] Primer pair 4: the upstream primer sequence is shown in SEQ ID NO: 12 (CTGCGATCTCCAGTCT GTGG), and the downstream primer sequence is shown in SEQ ID NO: 13 (ACCTGCATACAAGGCTGT CC);

[0024] Primer pair 5: the upstream primer sequence is shown in SEQ ID NO: 14 (CCTGCGATCTCCAGTC TGTG), and the downstream primer sequence is shown in SEQ ID NO: 15 (CCTGCATACAAGGCTGTC CA).

[0025] Preferably, the reagent for detecting the expression level of TPK1 protein is selected from TPK1 monoclonal antibody and / or TPK1 polyclonal antibody.

[0026] Preferably, the reagent for detecting the expression level of TPK1 protein is selected from Anti-TPK 1 antibody (10942-1-AP, Proteintech).

[0027] The fifth aspect of the present invention provides a kit for detecting the radiotherapy sensitivity and / or efficacy of hypopharyngeal cancer, comprising primers for detecting the expression level of TPK1 gene and / or reagents for detecting the expression level of TPK1 protein; and one or more of PCR enzyme, PCR buffer, dNTPs, and fluorescent substrate.

[0028] Preferably, the primers for detecting the expression level of the TPK1 gene are selected from at least one of the following primer pairs:

[0029] Primer pair 1: the upstream primer sequence is shown in SEQ ID NO: 6 (ATGCCTTTACCCCGTTG GAG), and the downstream primer sequence is shown in SEQ ID NO: 7 (AGTGGGCTTCCCCTAGAGAG);

[0030] Primer pair 2: the upstream primer sequence is shown in SEQ ID NO: 8 (ATCTCCAGTCTGTGGCT CCT), and the downstream primer sequence is shown in SEQ ID NO: 9 (CTCCAACGGGGTAAAGGCAT);

[0031] Primer pair 3: the upstream primer sequence is shown in SEQ ID NO: 10 (ATGGAGCATGCCTTTA CCCC), and the downstream primer sequence is shown in SEQ ID NO: 11 (TAAGGCCACACCAATCAC CC);

[0032] Primer pair 4: the upstream primer sequence is shown in SEQ ID NO: 12 (CTGCGATCTCCAGTCT GTGG), and the downstream primer sequence is shown in SEQ ID NO: 13 (ACCTGCATACAAGGCTGT CC);

[0033] Primer pair 5: the upstream primer sequence is shown in SEQ ID NO: 14 (CCTGCGATCTCCAGTC TGTG), and the downstream primer sequence is shown in SEQ ID NO: 15 (CCTGCATACAAGGCTGTC CA).

[0034] Preferably, the reagent for detecting the expression level of TPK1 protein is selected from TPK1 monoclonal antibody and / or TPK1 polyclonal antibody.

[0035] Preferably, the reagent for detecting the expression level of TPK1 protein is selected from Anti-TPK 1 antibody (10942-1-AP, Proteintech).

[0036] Preferably, the fluorescent substrate is selected from Syber Green or a fluorescently labeled probe.

[0037] It should be understood that, in the context of the present invention, unless otherwise specified, the primers and / or primer pairs refer to PCR primers used to synthesize the cDNA chain of the TPK1 gene in PCR, so as to detect the expression level of the mRNA of the TPK1 gene. In addition to the primers and / or primer pairs listed in the present invention, those skilled in the art are fully capable of designing corresponding primers and / or primer pairs according to the gene sequence of TPK1 using conventional methods and means in the art including but not limited to molecular biology, and screening the designed primers and / or primer pairs by conventional experimental means, as long as the specific detection of the TPK1 expression level can be achieved. The TPK1 inhibitor refers to a substance that can specifically downregulate the expression level of TPK1 and / or the transcription level of its mature mRNA and / or the expression level or activity of TPK1 protein, for example, antisense oligonucleotides, siRNA, shRNA, sgRNA, antagomiRs, miRNA sponges, miRNA Erasers, Target Masking and / or multi-target methods are used to downregulate the expression level and / or activity of TPK1, as long as the level and / or activity of TPK1 can be reduced.

[0038] TPK1 (thiamine pyrophosphokinase 1) is a type of substrate-specific pyrophosphorylase (diphosphorylase), which directly transfers the diphosphate of ATP to thiamine (vitamin B1), pyrophosphorylating it into its active form - thiamine pyrophosphate (TPP). It is generally believed that after formation, TPP enters the mitochondria and participates in the tricarboxylic acid cycle (TCA) as a key cofactor of pyruvate (PDH), α-ketoglutarate (KGDHC) and branched-chain α-ketoacid dehydrogenase. There are few studies on TPK1 in tumors, and the studies are limited to functional revelations, and no mechanism has been explored. It is worth noting that studies have found that TPP is involved in processes such as resistance to chemotherapy drugs-fluorouracil or changes in tumor stemness phenotype, but the relationship between these processes and TPK1 has not been revealed.

[0039] The present invention has confirmed through a series of in vivo and in vitro experiments that TPK1 is a gene that is extremely related to hypopharyngeal cancer radiotherapy tolerance. It is highly expressed in hypopharyngeal cancer tissues, and radiotherapy will further increase its expression level in tumor tissues. When TPK1 is inhibited or knocked out, it can significantly inhibit the proliferation of hypopharyngeal cancer cells, clone formation and other functional activities, and reduce the growth rate and volume of tumors. The present invention also conducted an in-depth study on the mechanism of action between TPK1 and hypopharyngeal cancer radiotherapy tolerance, and found that mutations in key amino acids in the pyrophosphorylation catalytic domain can cause TPK1 to lose the function of mediating radiotherapy tolerance. By analyzing the metabolite levels in tumor cells after radiotherapy, it was found that TPK1-KO cells were significantly enriched in tumor metabolites including 2HG, succinic acid, and fumaric acid after radiotherapy, and TPK1 contributed to the clearance of tumor metabolites after radiotherapy. When (S)-2-HG was added to TPK1-KO cells, radiotherapy sensitivity could be further improved, and HR repair could be inhibited. The present invention also designs and screens a small molecule active ingredient PTDM for the TPK1 target, which can effectively target TPK1 and produce inhibitory activity on it, so as to enhance the sensitization effect of hypopharyngeal cancer after radiotherapy.

[0040] The present invention clarifies the gene TPK1 that is extremely related to hypopharyngeal cancer radiotherapy tolerance. Its higher expression level has a significant positive correlation with poor hypopharyngeal cancer tumor regression, which can be used to predict hypopharyngeal cancer radiotherapy tolerance and sensitivity, and provide early evaluation for patients to receive preoperative treatment. At the same time, by revealing the correlation between the TPK1 gene and hypopharyngeal cancer radiotherapy tolerance, the present invention has important practical significance for solving the difficult problems of clinical efficacy differences between individuals and the gaps in regression effects / prognosis assessments, and better realizing precision treatment. It provides a new drug treatment target for humans to conquer hypopharyngeal cancer, and provides a new direction for subsequent drug development, clinical treatment, etc., with extremely high social value and market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1Schematic diagram of TPK1 expression levels in hypopharyngeal cancer tumor tissues before and after radiotherapy.

[0042] Figure 2 This is a schematic diagram of the results of detecting the effect of TPK1 knockout on clonal formation in hypopharyngeal cancer under radiotherapy.

[0043] Figure 3 This is a schematic diagram of the results of detecting the effect of TPK1 knockout on the proliferation of hypopharyngeal cancer under radiotherapy.

[0044] Figure 4 Schematic diagram of the radiosensitivity of hypopharyngeal cancer tumor growth after TPK1 knockout.

[0045] Figure 5 This is a schematic diagram of the effect of TPK1 mutation on radiotherapy tolerance.

[0046] Figure 6 Schematic diagram of the comparison of metabolite contents between TPK1 knockout and TPK1 wild-type in hypopharyngeal cancer cells after radiotherapy.

[0047] Figure 7 Schematic diagram of the results of TPK1 affecting tumor metabolite content before and after radiation intervention.

[0048] Figure 8 Schematic diagram of the effect of TPK1 on the content of tumor metabolites after the addition of tumor metabolites.

[0049] Fig. 9 Schematic diagram of the effect of (S)-2-HG on radiosensitivity and HR repair of TPK1 knockout cell lines.

[0050] Fig.10 Schematic diagram of the synthesis steps of PTDM.

[0051] Fig.11 Schematic diagram of the structure of PTDM.

[0052] Fig.12 To confirm the binding of PTDM to TPK1 by streptavidin method.

[0053] Fig.13 Schematic diagram of the effect of PTDM on the radiosensitivity of hypopharyngeal cancer after radiotherapy. DETAILED DESCRIPTION

[0054] In order to make the purpose, technical scheme and effect of the present invention clearer and more specific, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0055] In the absence of special instructions, the cell lines listed in the context of the present invention, including Fadu, Detroit 562, etc., are cultured according to the prior art, and all cell lines are identified by short tandem repeat analysis of China Type Culture Collection (Wuhan), and PCR detection kit (Shanghai Biothrive Sci) is used to verify the presence of mycoplasma contamination, and frozen in liquid nitrogen and used for subsequent experiments. The reagents used in the present invention are all commercially available. For the use of clinical specimens, informed consent forms were signed with patients, and relevant procedures and methods meet medical ethics requirements and drug clinical trial quality management standards. The experimental methods used in the present invention, such as molecular biology experiments, cell experiments, animal experiments, clinical trials, etc., are conventional methods and techniques in the art.

[0056] Representative results selected from the biological experiment repetitions are presented in the context figures, and the data are displayed as mean±SD and mean±SEM as specified in the figure. All in vitro experiments were repeated at least three times, and animal experiments were repeated twice. The data were analyzed using GraphPad Prism 8.0 or SPSS22.0 software. Conventional medical statistical methods such as t-test, chi-square test, and analysis of variance were used to compare the mean differences between two or more groups. p<0.05 is considered to be a significant difference. The present invention uses one or more primer pairs in Table 1 below to detect the expression level of TPK1, and those skilled in the art may also use other conventional methods in the art for detection according to actual needs.

[0057] Table 1 Primer pairs (5'-3') for detecting TPK1 expression levels

[0058]

[0059] Example 1

[0060] By selecting patients with hypopharyngeal cancer who did not shrink well after radiotherapy, RNA-seq sequencing was performed using tumor biopsy tissues before and after radiotherapy, and it was found that many kinase genes were significantly upregulated after radiotherapy compared with before radiotherapy. In order to clarify the types of kinase genes closely related to radiotherapy tolerance of hypopharyngeal cancer, a kinase-sgRNA library was used to carry out functional screening of radiotherapy tolerance in hypopharyngeal cancer cells (FaDu): a stable cell line containing a kinase sgRNA library was constructed (mixed to ensure that each cell contained 1 sgRNA), and then the mouse transplanted tumor or cells were irradiated respectively. Subsequently, the genes corresponding to the downregulation of sgRNA copy number in the residual library cells after radiotherapy were analyzed, and the screening conditions were set: |Log2(Fold Change)|>2, the number of captured sgRNAs>2, and all met in the three treatment schemes, aiming to discover kinases related to radiotherapy tolerance. The results showed that one kinase TPK that best met the screening conditions may be a kinase related to radiotherapy tolerance, and it was preliminarily speculated that downregulation of TPK1 expression can improve the radiotherapy sensitivity of hypopharyngeal cancer.

[0061] Furthermore, the expression level of TPK1 in tumor tissues of hypopharyngeal cancer patients before and after radiotherapy was detected to clarify its correlation with radiotherapy tolerance. The specific steps are as follows:

[0062] (1) Pre-radiotherapy biopsy samples of hypopharyngeal cancer patients from the First Affiliated Hospital of Sun Yat-sen University were selected; for each selected case, the patient was required to be diagnosed with hypopharyngeal cancer; no concurrent symptoms such as tumor bleeding, acute or chronic infection; all patients received radical radiotherapy, and the specific regimen was: conventional long-course radiotherapy (2.26 Gy / time / day × 5 times / week, 6 weeks, total dose 68 Gy). For all cases included in the study, their clinical pathological data were obtained from the medical records of the First Affiliated Hospital of Sun Yat-sen University, and the corresponding follow-up data were obtained from the hospital follow-up department.

[0063] (2) Tumor tissue samples were collected from each patient before and after radiotherapy, and fresh biopsy tissue was embedded in paraffin for sealing. Paraffin specimens were stored at room temperature, and the cut white slices were stored in a refrigerator at 4°C. During the experiment, paraffin slices were taken out and dewaxed with xylene, hydrated with gradient alcohol, and then heated to 0.3% H 2 O 2 The peroxidase in the tissue was removed by solution, the tissue was repaired by microwave using citrate solution, the anti-TPK1 antibody (1:200) of Invitrogen and the secondary antibody of the corresponding species were incubated, the tissue was developed by DAB and hematoxylin, the tissue was differentiated by hydrochloric acid and alcohol, the tissue was dehydrated by gradient alcohol, the tissue was permeabilized twice by xylene, and the tissue was sealed with neutral gum.

[0064] (3) The staining evaluation of tissue specimens was performed by taking photos with an inverted microscope at 100-200×, and 5-10 fields of view / case were taken on the entire tissue surface. After IHC staining, two or more experimenters performed double-blind scoring of protein expression. The scoring was based on two indicators, staining intensity and staining area, using a 12-point method: staining intensity was divided into strong positive (3 points), positive (2 points), weak positive (1 point), and negative (0 points), and staining area was divided into 0-25% (1 point), 25%-50% (2 points), 50%-75% (3 points), and 75%-100% (4 points). The total score = staining intensity score × staining area score; the patient case data were sorted, and the correlation between TPK1 and various indicators was analyzed using IBM SPSS statistics20.0 software.

[0065] The results are as follows Figure 1 As shown, the results showed that TPK1 was generally highly expressed in hypopharyngeal cancer tissues, and radiotherapy further increased its expression in the tissues.

[0066] Example 2

[0067] The above examples clearly show the relationship between TPK1 and radiotherapy tolerance of hypopharyngeal cancer. In this regard, a series of in vivo and in vitro experiments were designed to study the effect of TPK1 expression level on radiotherapy sensitivity of hypopharyngeal cancer. First, the effect of TPK1 knockout on the clone formation of hypopharyngeal cancer cells under radiotherapy treatment was studied. The specific steps are as follows:

[0068] (1) sgRNA1 was designed for the TPK1 gene sequence (the sequence is shown in SEQ ID NO: 1, 5'-CCTGCTTTCCACTGGGAATTT-3'), and a TPK1 knockout (TPK1-KO) cell line was constructed in Fadu cells using Crispr-Cas9; after the cells grew to the logarithmic phase, they were digested with 0.25% trypsin and blown into single cells, and the cells were suspended in DMEM culture medium containing 10% fetal bovine serum for later use.

[0069] (2) The cell suspension was diluted and inoculated at a density of 1000 / well in a dish containing 10 mL of 37°C pre-warmed culture medium. The cells were gently rotated to disperse the cells evenly. Each group of cells was irradiated with 0-4 Gy and placed at 37°C with 5% CO. 2 The cells were cultured in a cell culture incubator with saturated humidity.

[0070] (3) When clones visible to the naked eye appear in the culture dish, terminate the culture, discard the supernatant, carefully rinse twice with PBS, add 1 mL of methanol containing 0.5% crystal violet to each well, and stain for 30 min; discard the methanol and wash the remaining methanol with water; cell clones can be observed; observe under a microscope, and a valid clone is counted when the number of cells is greater than 50.

[0071] The results are as follows Figure 2 The results showed that knocking out TPK1 could significantly improve the radiosensitivity of Fadu cells, and the difference was statistically significant.

[0072] The effect of TPK1 knockout on the proliferation of hypopharyngeal cancer cells under radiotherapy was then studied. The specific steps are as follows:

[0073] (1) sgRNA1 was designed for the TPK1 gene sequence (the sequence is shown in SEQ ID NO: 1, 5'-CCTGCTTTCCACTGGGAATTT-3'), and a TPK1 knockout (TPK1-KO) cell line was constructed in Detroit 562 cells using Crispr-Cas9. After the cells grew to the logarithmic phase, they were digested with 0.25% trypsin and perfused into single cells. The cells were cultured at 1.0×10 3 The cells were seeded into 96-well plates at a density of 1.54 cells / well (3 replicates).

[0074] (2) The cells were cultured in a 37°C incubator. Each group of cells was irradiated with 6 Gy. The cells were collected at 72 h, 10 μL of CCK-8 was added to each well, and the culture plate was incubated in the incubator for 1-4 h. The absorbance at 450 nm was measured to evaluate the cell proliferation.

[0075] The results are as follows Figure 3 The results showed that knocking out TPK1 could enhance the killing ability of radiotherapy on hypopharyngeal cancer cells.

[0076] Further, the effect of TPK1 knockout on tumor growth in vivo was studied, and the specific steps were as follows:

[0077] (1) Five-week-old female BALB / c-nu / nu mice were divided into two groups and subcutaneously injected with the above-mentioned TPK1-KO and TPK1-WT cells, respectively.

[0078] (2) After tumor formation, the TPK1-KO group mice were randomly divided into two groups, with 4 mice in each group, namely Group 1 and Group 2; the TPK1-WT group mice were also randomly divided into two groups, with 4 mice in each group, namely Group 3 and Group 4.

[0079] (3) The mice in Group 1 and Group 3 did not receive any treatment, while the mice in Group 2 and Group 4 were treated with tumor area irradiation (RS2000 X-ray irradiator, with a source-skin distance of 100 cm as the standard, medium- and long-range daily average equal dose radiation; the non-tumor area was shielded with a lead container specially made for mice), 1 Gy / day, 5 days / week, for 4 consecutive weeks; the tumor volume was measured regularly during the treatment period, and the mice were killed 7 weeks after treatment, the tumors were removed, and the tumor inhibition rate was calculated by weighing.

[0080] The results are as follows Figure 4As shown. The results showed that the tumor inhibition rate in the TPK1-KO group increased significantly after radiotherapy, and the tumor was reduced, indicating that knocking out TPK1 can significantly improve the radiotherapy sensitivity of Fadu cells. From the above, it can be seen that simply inhibiting the expression level of TPK1 in hypopharyngeal cancer cells cannot significantly inhibit the growth of hypopharyngeal cancer cells; however, during radiotherapy of hypopharyngeal cancer cells, the knockout of TPK1 can significantly increase the sensitivity of hypopharyngeal cancer to radiotherapy, reduce the growth rate and volume of tumor cells, significantly improve the tumor inhibition effect, and effectively prevent the occurrence of radiotherapy tolerance. The above experiment was repeated using sgRNA2-5 (sequences are shown in SEQID NO: 2-5, respectively) to replace sgRNA1, and the results were consistent with the above (results not shown).

[0081] Example 3

[0082] According to the above results, it is necessary to start with the study of TPK1 pyrophosphorylation catalytic activity to reveal the mechanism. Therefore, by analyzing the protein structure information of TPK1 (PDBe_3s4y, Q9H3S4), the key amino acids of the thiamine binding domain, i.e., the pyrophosphorylation catalytic domain, were mutated (D77N / D101N / D105N) in hypopharyngeal cancer cells, and in the TPK1-KO Fadu hypopharyngeal cancer cell line, wild-type TPK1 (sequence as shown in SEQ ID NO: 16) or mutant TPK1 (thiamine binding domain, i.e., the pyrophosphorylation catalytic domain, key amino acids were mutated (D77N / D101N / D104N) (sequence as shown in SEQ ID NO: 17)) were complemented and then cell clone formation experiments were carried out. The experimental results are as follows Figure 5 As shown. The results showed that in TPK-KO cells, radiotherapy tolerance was restored by complementing wild-type TPK1, while complementing mutant TPK1 could not restore its radiotherapy tolerance. This indicates that TPK1 with mutant thiamine domain has lost its function of mediating radiotherapy tolerance.

[0083] In order to comprehensively analyze the changes in metabolites in hypopharyngeal cancer cells dominated by TPK1, the contents of various metabolites were analyzed by non-targeted metabolomics (HPLC-MS / MS). The results showed that after radiotherapy, tumor metabolites such as (S)-2-hydroxyglutaric acid (2-HG), fumarate and succinate were significantly enriched in TPK1-deficient cell lines; in addition, abnormal metabolites such as (S)-2-(R)-4-dihydroxyglutaric acid and (S)-2-hydroxyfumaric acid were identified as metabolites belonging to Log2(TPK1-KO / WT)≥2.5 (see Figure 6 ). The above substances are not produced by the normal metabolic pathway of cells, suggesting that TPK1 knockout may cause the accumulation of tumor metabolites.

[0084] Oncometabolites are metabolites that accumulate abnormally in the metabolic pathways of tumors. Many studies have found that they play an important role in tumor transformation, metabolism, invasiveness and treatment resistance. Therefore, they were once considered a new pathological feature of tumors. There are currently three known oncometabolites: (1) succinate, which mainly accumulates in cells lacking succinate dehydrogenase (SDH); (2) fumarate, which mainly accumulates when fumarate hydratase (FH) is lacking; (3) 2-hydroxyglutarate (2-HG), which produces 2-HG in the (R) conformation when isocitrate dehydrogenase (IDH)1 / 2 mutates, and produces 2-HG in the (S) conformation when catalyzed by malate or lactate dehydrogenase. The results of further HPLC detection of tumor metabolites in hypopharyngeal cancer cells showed that in TPK1 wild-type cells, radiotherapy could significantly downregulate tumor metabolites such as (S)-2-HG, succinic acid, and fumaric acid. However, in TPK1-KO cell lines, these tumor metabolites were significantly upregulated after radiotherapy. In addition, it was found that (S)-2-(R)-4-dihydroxyglutaric acid and (S)-2-hydroxyfumaric acid, two types of abnormal metabolites, had the same change pattern (see Figure 7 ). It is worth noting that the tumor metabolites revealed above are either derivatives of α-ketoglutarate or its further metabolic intermediates, which are highly similar to α-ketoglutarate in structure. In summary, it can be seen that after radiotherapy, TPK1 can promote the downregulation of tumor metabolites with a similar structure to α-ketoglutarate.

[0085] In order to further verify whether TPK1 has the ability to clear this type of tumor metabolites after radiotherapy, we made a judgment after adding tumor metabolites, that is, 2HG, succinate, and fumarate were added to hypopharyngeal cancer TPK1-WT and TPK1-KO cells respectively after 4Gy 4h of radiotherapy. The results showed that compared with the absence of TPK1, the presence of TPK1 caused a significant decrease in the high content of 2-HG, succinate, and fumarate (see Figure 8 ), the above results indicate that after radiotherapy, TPK1 can capture this type of tumor metabolites by activating substrates. When TPK1 is knocked out, this clearance effect is blocked, thereby hindering the capture effect and causing the accumulation of tumor metabolites.

[0086] In order to determine whether the addition of (S)-2-HG can further affect radiosensitivity and HR repair in the case of TPK1 knockout, functional and repair efficiency experiments were performed. The results showed that the addition of (S)-2-HG can further inhibit HR repair and enhance the sensitivity of hypopharyngeal cancer to radiotherapy (see Fig. 9 ).

[0087] Example 6

[0088] The above examples demonstrate that the clearance of tumor metabolites by TPK1 after radiotherapy is timely and efficient, and even exogenous supplementation of a certain amount of tumor metabolites cannot achieve effective radiosensitization. Therefore, tumor metabolites do not have the potential to serve as radiosensitizers. Based on the above mechanism research results, it is speculated that targeting TPK1 to block the clearance of tumor metabolites after radiotherapy may be a key step in improving the sensitivity of hypopharyngeal cancer cells to radiotherapy. Based on this, according to the structural characteristics of the thiamine binding domain in TPK 1, a class of compounds with similar structures and unable to undergo pyrophosphorylation were designed and synthesized using thiamine or pyrithiamine as molecular templates, aiming to competitively bind to the thiamine domain of TPK1, causing TPK1 to lose its structural basis for catalysis.

[0089] When the pyridine ring side chain hydroxyl group of pyrithiamine is converted into nitrogen dimethyl, a new molecule PTDM is formed. Its synthesis steps are as follows: Fig.10 As shown, the details are as follows:

[0090] Take 15g of sodium methoxide, 30g of anhydrous methanol and 3g of ethyl formate and add them to a 250mL three-necked bottle, stir at room temperature for 30min, add 30g of methylamidine hydrochloride, stir and react for 20-30min, distill and recover methanol, cool, add 10g of toluene, cool to about 2℃, add 35g of α-methoxymethyl-β-methoxypropionitrile at one time, keep warm in a water bath at 70℃ and react for 3h. Add 66g of sodium hydroxide and distill toluene. Add 135g of water and 90g of chloroform and stir, let stand to separate, extract the water layer twice with a little chloroform, combine with the organic layer, distill to remove chloroform, and cool. Add 147g of xylene and 48g of N,N-dimethyl-2-(2-methylpyridin-3-yl)ethyl-1-amine, stir, pass HCl to pH 1-2, after passing, heat and reflux with water, keep reflux for 4-5h, then distill to dryness under reduced pressure and cool. Add 150g of isopropanol and reflux for 2h. Cool, filter and dry to obtain a yellow crude product. Then, use column chromatography to obtain a yellow product with a purity of >98.2%, which is PTDM. Its structure is as follows Fig.11 As shown, the NMR identification data are as follows: 1 HNMR (400MHz, MeOD) δ8.85 (d, 1H), 8.55 (d, 1H), 8.09 (s, 1H), 7.96 (dd, 1H), 6.44 (s ,2H),5.95(s,3H),2.91(s,3H),2.69(s,4H),2.25(s,9H).m / z(ESI):286.2023[M] + .

[0091] Experiments have shown that PTDM can block the consumption of ATP in the in vitro co-incubation of TPK1 and thiamine; at the same time, PTDM is linked to a biotin tag, and the binding of PTDM to TPK1 can be confirmed by the streptavidin method (see Fig.12 ). This shows that PTDM can inhibit the catalytic activity of TPK1.

[0092] In order to further clarify the effect of PTDM on radiosensitivity of hypopharyngeal carcinoma after radiotherapy, DMSO or PTDM was added to hypopharyngeal carcinoma TPK1-WT and TPK1-KO cells 24 hours after radiotherapy of 0, 2, and 4 Gy to detect its effect on cell clone formation. The experimental results are shown in Figure 2. Fig.13 The results showed that PTDM can significantly improve the radiosensitivity of hypopharyngeal cancer cells, confirming the effectiveness of PTDM in targeting TPK1 to enhance radiosensitivity of hypopharyngeal cancer.

[0093] The present invention has confirmed through a series of in vivo and in vitro experiments that TPK1 is a gene that is extremely related to hypopharyngeal cancer radiotherapy tolerance. It is highly expressed in hypopharyngeal cancer tissues, and radiotherapy will further increase its expression level in tumor tissues. After radiotherapy, when TPK1 is inhibited or knocked out, the proliferation, cloning and other functional activities of hypopharyngeal cancer cells can be significantly inhibited, and the growth rate and volume of tumors can be reduced. The present invention also conducted an in-depth study on the mechanism of action between TPK1 and hypopharyngeal cancer radiotherapy tolerance, and found that mutations in key amino acids in the pyrophosphorylation catalytic domain can cause TPK1 to lose the function of mediating radiotherapy tolerance. By analyzing the metabolite levels in tumor cells after radiotherapy, it was found that TPK1-KO cells were significantly enriched in tumor metabolites including 2HG, succinic acid, and fumaric acid after radiotherapy, and TPK1 contributed to the clearance of tumor metabolites after radiotherapy. When (S)-2-HG was added to TPK1-KO cells, radiotherapy sensitivity could be further improved, and HR repair could be inhibited. The present invention also designs and screens a small molecule active ingredient PTD M for the TPK1 target, which can effectively target TPK1 and produce inhibitory activity on it, so as to enhance the sensitization effect of hypopharyngeal cancer after radiotherapy.

[0094] From the above, it can be seen that the present invention clarifies the gene TPK 1 that is extremely related to hypopharyngeal cancer radiotherapy tolerance. Its higher expression level has a significant positive correlation with the poor regression of hypopharyngeal cancer tumors, which can be used to predict hypopharyngeal cancer radiotherapy tolerance and sensitivity, and provide early evaluation for patients to receive preoperative treatment. At the same time, by revealing the correlation between the TPK1 gene and hypopharyngeal cancer radiotherapy tolerance, the present invention has important practical significance for solving the difficult problems of clinical efficacy differences between individuals and the gaps in regression effects / prognosis assessments, and better realizing precision treatment. It provides a new drug treatment target for humans to conquer hypopharyngeal cancer, thereby providing a new direction for subsequent drug development, clinical treatment, etc., and has extremely high social value and market application prospects.

[0095] The above specific implementation method part specifically introduces the analytical method involved in the present invention. It should be noted that the above introduction is only to help those skilled in the art better understand the method and ideas of the present invention, rather than limiting the relevant content. Without departing from the principle of the present invention, those skilled in the art may also make appropriate adjustments or modifications to the present invention, and the above adjustments and modifications shall also fall within the scope of protection of the present invention.

Claims

1. Use of a TPK1 inhibitor in the preparation of a product for improving the radiosensitivity of hypopharyngeal cancer, characterized in that: The TPK1 inhibitor is selected from one or more of a small molecule compound and a sgRNA designed based on TPK1; the structure of the small molecule compound is shown in the following formula: ; The sgRNA sequence is selected from one or more of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO:

5.

2. The use of a small molecule compound in the preparation of a drug for improving the radiosensitivity of hypopharyngeal cancer, wherein the structure of the small molecule compound is shown in the following formula: 。 3. The use according to claim 2, characterized in that: The small molecule compound improves the radiosensitivity of hypopharyngeal cancer by targeting and inhibiting TPK1.

4. Use of a reagent for detecting TPK1 expression level in the preparation of a composition for detecting radiotherapy sensitivity and / or therapeutic efficacy prediction of hypopharyngeal cancer, characterized in that: The reagent for detecting the expression level of TPK1 includes primers for detecting the expression level of TPK1 gene; The primers for detecting the expression level of the TPK1 gene are selected from at least one of the following primer pairs: Primer pair 1: the upstream primer sequence is shown in SEQ ID NO: 6, and the downstream primer sequence is shown in SEQ ID NO: 7; Primer pair 2: the upstream primer sequence is shown in SEQ ID NO: 8, and the downstream primer sequence is shown in SEQ ID NO: 9; Primer pair 3: the upstream primer sequence is shown in SEQ ID NO: 10, and the downstream primer sequence is shown in SEQ ID NO: 11; Primer pair 4: the upstream primer sequence is shown in SEQ ID NO: 12, and the downstream primer sequence is shown in SEQ ID NO: 13; Primer pair 5: the upstream primer sequence is shown in SEQ ID NO: 14, and the downstream primer sequence is shown in SEQ ID NO: 15.

Images