A sturgeon bioactive peptide with α-glucosidase inhibitory activity and improved insulin resistance and its application.
By extracting and purifying sturgeon bioactive peptides from sturgeon meat, the problem of significant side effects of α-glucosidase inhibitors in existing technologies has been solved. This provides sturgeon bioactive peptides that inhibit α-glucosidase and improve insulin resistance, suitable for hypoglycemic health products or pharmaceuticals, achieving efficient and safe peptide preparation and application.
Patent Information
- Application Number
- CN202410367263.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-28
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-03-28
AI Technical Summary
Existing α-glucosidase inhibitors such as acarbose and miglitol have side effects, and current technologies have not been able to effectively screen and purify bioactive peptides with α-glucosidase inhibitory activity, especially since their effects on improving insulin resistance have not been fully verified.
Protein was extracted from sturgeon meat using an alkaline extraction and acid precipitation method. Sturgeon bioactive peptides with α-glucosidase inhibitory activity were screened using a complex protease hydrolysis combined with ultrafiltration and gel chromatography. The amino acid sequences were VLLQKNNDT and LSMQRAQEE. The effectiveness was further confirmed by mass spectrometry analysis.
The obtained sturgeon bioactive peptides have good α-glucosidase inhibitory activity and the function of improving insulin resistance. They are suitable for preparing hypoglycemic health products or drugs, and are stable in the gastrointestinal tract with low side effects.
Smart Images

Figure CN118344436B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioactive peptides, and specifically relates to a sturgeon bioactive peptide with α-glucosidase inhibitory activity and improved insulin resistance, and its application. Background Technology
[0002] Type 2 diabetes mellitus (T2DM) is a metabolic disease characterized by hyperglycemia, which includes a series of metabolic defects such as insulin resistance and can lead to common complications such as cardiovascular disease, kidney failure, and retinopathy.
[0003] Insulin resistance is an early metabolic abnormality in the progression of type 2 diabetes mellitus (T2DM). Insulin resistance due to insulin receptor (IR) insensitivity, chronic hyperglycemia, low-grade inflammation, and dyslipidemia are characteristic of T2DM. Insulin resistance occurs when insulin's efficiency in transporting glucose in skeletal muscle or inhibiting endogenous glucose transport in the liver is lower than expected. Alpha-glucosidase inhibitory peptides, as bioactive macromolecules, have been shown to restore cellular sensitivity to insulin, thereby achieving the goal of preventing and treating T2DM.
[0004] The most effective treatment strategy for type 2 diabetes mellitus (T2DM) is to maintain normal blood glucose levels. One effective way to suppress postprandial hyperglycemia is to control glucose release by inhibiting alpha-glucosidase. Alpha-glucosidase inhibitors reduce the digestibility of sugar. Acarbose and miglitol are two alpha-glucosidase inhibitors used clinically to control postprandial hyperglycemia, but these drugs often have many side effects, such as bloating, flatulence, diarrhea, dizziness, and vomiting. Therefore, it is necessary to find low-cost and relatively safe plant-based foods or supplements as alternatives to alpha-glucosidase inhibitors. Numerous studies have confirmed that some food-derived bioactive components (peptides, phenols, terpenes, etc.) possess excellent alpha-glucosidase inhibitory potential. Among them, alpha-glucosidase inhibitory peptides prepared from food-derived proteins have nutritional properties and have received widespread attention from the research community due to their high bioavailability, significant T2DM treatment effect, and fewer side effects compared to traditional alpha-glucosidase inhibitors. For example, Chinese patent (patent number: 201810844107.2, title: A method for preparing horseshoe crab blood protein hydrolysate peptides with α-glucosidase inhibitory activity) discloses α-glucosidase inhibitory peptides derived from horseshoe crab blood, whose α-glucosidase half-inhibitory concentration (IC50) is... 50The concentration reached 0.073 mg / mL, and the raw material was horseshoe crab blood cells, a waste product from horseshoe crab reagent production, thus solving the problem of waste recycling and improving the utilization rate of raw materials. However, it did not separate, purify, or synthesize the specific effective active ingredients of the hydrolyzed peptide. A Chinese patent (patent number: 202210396235.1, title: Millet Prolysozyme Peptide with α-glucosidase inhibitory activity) discloses an α-glucosidase inhibitory peptide derived from cooked millet prolysozyme, with the amino acid sequence WFQHQ, YWTPR, and FMLPQ, which can be used to prepare hypoglycemic drugs suitable for type II diabetes patients. However, it only used computer-aided predictive analysis to analyze the stability of the synthesized peptide and did not investigate its gastrointestinal digestive stability. Summary of the Invention
[0005] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and provide a sturgeon active peptide.
[0006] Another object of the present invention is to provide the use of the aforementioned sturgeon active peptide in the preparation of products that inhibit α-glucosidase activity.
[0007] Another object of the present invention is to provide the use of the aforementioned sturgeon active peptide in the preparation of products that improve or treat insulin resistance.
[0008] The objective of this invention is achieved through the following technical solution:
[0009] A sturgeon bioactive peptide, comprising at least one of the following:
[0010] (1) Enzymatic hydrolysis product: crude product obtained by alkaline extraction and acid precipitation of sturgeon meat and enzymatic hydrolysis by compound protease.
[0011] (2) Sturgeon bioactive peptide, the amino acid sequence of which is shown below: VLLQKNNDT (SEQ ID NO.1);
[0012] (3) Sturgeon bioactive peptide, the amino acid sequence of which is shown below: LSMQRAQEE (SEQ ID NO.2).
[0013] The enzymatic hydrolysis product is preferably prepared by the following method:
[0014] (a) Alkali extraction and acid precipitation: Sturgeon meat is used as raw material. After being minced, water is added and homogenized. Then the pH of the system is adjusted to 7.0 to 11.0 and extracted at 40±2℃. After extraction, the supernatant is collected by centrifugation. The pH of the system is adjusted to 3.0 to 6.0 to precipitate the protein. After centrifugation and collection of the precipitate, the protein is freeze-dried to obtain sturgeon protein (ASP).
[0015] (b) Enzymatic hydrolysis: Sturgeon protein is added to water to obtain sturgeon protein solution; then, a complex protease is added to the sturgeon protein solution, the pH is adjusted to 7.0-8.0, and enzymatic hydrolysis is carried out at 40-45°C to obtain the enzymatic hydrolysis product, namely the crude product of the sturgeon active peptide.
[0016] The ratio of sturgeon meat to water in step (a) is 1g:9-10mL; preferably 1g:9mL.
[0017] The homogenization conditions described in step (a) are: homogenize at 5000 rpm for 2 to 3 minutes; preferably: homogenize at 5000 rpm for 2 minutes.
[0018] The pH adjustment described in steps (a) and (b) is performed using HCl or NaOH solution; preferably, a 1 mol / L HCl or NaOH solution is used.
[0019] The pH value of the alkali extraction in step (a) is preferably 10.0 to 11.0; more preferably 10.0.
[0020] The alkaline extraction time in step (a) is 30 to 40 minutes; preferably 30 minutes.
[0021] The pH value of the acid precipitation in step (a) is preferably 5.0 to 5.5; more preferably 5.0.
[0022] The water mentioned in step (b) is preferably distilled water.
[0023] The concentration of the sturgeon protein solution described in step (b) is preferably 10 mg / mL.
[0024] The complex protease mentioned in step (b) is preferably a complex protease produced by Shanghai Yuanye Biotechnology Co., Ltd., with product number S10155 (product specification: 120U / mg).
[0025] The amount of complex protease used in step (b) is calculated as 10,000 to 12,000 U of complex protease per gram of sturgeon protein; preferably, it is calculated as 10,000 U of complex protease per gram of sturgeon protein.
[0026] The preferred conditions for enzymatic hydrolysis in step (b) are: pH 7.5, hydrolysis temperature 45°C, and hydrolysis time 3 hours.
[0027] The enzymatic hydrolysis product can be further purified and separated to obtain sturgeon bioactive peptides. The specific steps are as follows:
[0028] (c) The enzymatic hydrolysis product from step (b) is purified by ultrafiltration, gel column chromatography and mass spectrometry to obtain the sturgeon bioactive peptide; wherein the amino acid sequence of the sturgeon bioactive peptide is shown in SEQ ID NO.1 (VLLQKNNDT) and / or SEQ ID NO.2 (LSMQRAQEE).
[0029] The ultrafiltration described in step (c) is performed using an ultrafiltration tube with a molecular weight cutoff of 3KD.
[0030] The conditions for gel column chromatography described in step (c) are as follows: Sephadex G-25 gel chromatography, sample loading volume of 3 mL, after loading, stand for 30 min, elute with ultrapure water at a flow rate of 0.5 mL / min, detect at 230 nm and plot the separation peak, and combine the components under the second and third peaks.
[0031] The application of the sturgeon active peptide in the preparation of products that inhibit α-glucosidase activity.
[0032] The products mentioned include drugs that inhibit α-glucosidase activity.
[0033] The drugs mentioned that inhibit α-glucosidase activity include α-glucosidase inhibitors, etc.
[0034] The application of the sturgeon active peptide in the preparation of products that improve or treat insulin resistance.
[0035] The products mentioned include medicines (drugs) for improving or treating insulin resistance, medicines or health products for assisting in lowering blood sugar, etc.
[0036] The sturgeon bioactive peptides described herein increase the phosphorylation levels of AKT and PI3K by upregulating the expression levels of AKT and PI3K mRNA, thereby promoting glucose transport by glucose transporter 4 (GLUT4) and inhibiting gluconeogenesis by inhibiting the expression of phosphoenolpyruvate carboxykinase (PEPCK), thus achieving the function of regulating blood glucose.
[0037] The application of the sturgeon bioactive peptide in the preparation of products that improve cellular insulin resistance.
[0038] The cells include normal human hepatocytes or human liver cancer cells; preferably, human liver cancer cells HepG2 (which can be used to construct an insulin resistance model to study the hypoglycemic effect of the active substance).
[0039] The present invention has the following advantages and effects compared with the prior art:
[0040] (1) In this invention, sturgeon protein (ASP) was extracted from sturgeon meat by alkaline extraction and acid precipitation. The molecular characteristics of peptides with α-glucosidase inhibitory activity were obtained by studying and analyzing the BIOPEP-UWM database. Then, using the α-glucosidase inhibition rate as a screening index, the enzymatic hydrolysis products with better α-glucosidase inhibition rates were screened from the products of ASP hydrolysis by four commercial enzymes (trypsin, papain, alkaline protease, and complex protease). The enzymatic hydrolysis products were further separated and purified step by step by ultrafiltration and gel chromatography. The fraction with the strongest α-glucosidase inhibition rate was analyzed by mass spectrometry to obtain the peptide amino acid sequences VT-9 (VLLQKNNDT) and LE-9 (LSMQRAQEE).
[0041] (2) The sturgeon active peptide (α-glucosidase inhibitory peptide) provided by the present invention has good resistance to gastrointestinal digestion.
[0042] (3) The sturgeon active peptides screened in this invention have α-glucosidase inhibitory activity and also have the function of improving insulin resistance in HepG2 cells, which is of great significance for the development of health products or drugs that help lower blood sugar. Attached Figure Description
[0043] Figure 1 This is a graph showing the protein solubility in the supernatant of alkaline extraction and acid precipitation methods; where A represents the protein solubility in the supernatant of alkaline extraction (pH 7.0–11.0) and B represents the protein solubility in the supernatant of acid precipitation (pH 3.0–6.0).
[0044] Figure 2 This is a graph showing the inhibition of α-glucosidase by ultrafiltration fractions smaller than 3KD of ASP hydrolysis products from different enzymes (Note: all sample concentrations were 2 mg / mL, and all hydrolysis times were 3 h).
[0045] Figure 3 This is a graph showing the effect of gastrointestinal digestion on the relative activity of α-glucosidase by the enzymatic hydrolysates of ASP by different enzymes (Note: '*' indicates a significant difference from the control group (ns indicates p>0.05, no significant difference, ** indicates p<0.01)).
[0046] Figure 4 The images show chromatograms of different components (represented by C) obtained by purification and separation of the complex protease hydrolysis product using Sephadex G-25 and their inhibition of α-glucosidase; where A is the chromatogram and B is the statistical graph of α-glucosidase inhibition rate (Note: '*' indicates a significant difference between each group and component C (ns indicates p>0.05, no significant difference, * indicates p<0.05, *** indicates p<0.001, **** indicates p<0.0001)).
[0047] Figure 5 It is the IC50 of α-glucosidase inhibitory peptide. 50 A graph showing the distribution of hydrophobic amino acid percentages, lengths, C-terminal amino acid types, and N-terminal amino acid types; where A represents the IC50 of the α-glucosidase inhibitory peptide. 50 Distribution: B represents the proportion of hydrophobic amino acids in the α-glucosidase inhibitory peptide; C represents the number distribution of peptide amino acids in the α-glucosidase inhibitory peptide; D represents the distribution of C-terminal amino acid types in the α-glucosidase inhibitory peptide; E represents the distribution of N-terminal amino acid types in the α-glucosidase inhibitory peptide.
[0048] Figure 6 This is a graph showing the inhibitory activity of α-glucosidase inhibitory peptides VT-9 and LE-9 at different concentrations; where A represents α-glucosidase inhibitory peptide VT-9 and B represents α-glucosidase inhibitory peptide LE-9.
[0049] Figure 7 This is a graph showing the effect of gastrointestinal digestion on the relative activities of α-glucosidase inhibitory peptides VT-9 and LE-9 (Note: the experimental group consists of gastrointestinal digestion products; '*' indicates a significant difference between the gastrointestinal digestion products of each peptide and their corresponding control group (ns indicates p>0.05, no significant difference, * indicates p<0.05, ** indicates p<0.01)).
[0050] Figure 8 This is a graph showing the effects of different concentrations of metformin hydrochloride, α-glucosidase inhibitory peptide VT-9, and LE-9 on the viability of HepG2 cells (Note: '*' indicates a significant difference from the control group (ns indicates p>0.05, no significant difference, * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, **** indicates p<0.0001)).
[0051] Figure 9 The graph shows the effect of different concentrations of insulin on the viability of HepG2 cells (Note: '*' indicates a significant difference from the control group (ns indicates p>0.05, no significant difference, * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, **** indicates p<0.0001)); where A is the cell viability after 24 hours of co-culture; B is the cell viability after 48 hours of co-culture; and C is the cell viability after 72 hours of co-culture.
[0052] Figure 10 This is a graph showing glucose consumption under different concentrations of insulin (establishing an IR-HepG2 cell model).
[0053] Figure 11 This is a graph showing the effect of α-glucosidase inhibitory peptides VT-9 and LE-9 on glucose consumption in IR-HepG2 cells (Note: '*' indicates a significant difference from the control group (**** indicates p<0.0001)).
[0054] Figure 12 The effects of α-glucosidase inhibitory peptides VT-9 and LE-9 on glycogen content in IR-HepG2 cells (Note: '*' indicates a significant difference from the control group (ns indicates p>0.05, no significant difference, * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, **** indicates p<0.0001)).
[0055] Figure 13 This is a graph showing the effects of metformin hydrochloride, α-glucosidase inhibitor VT-9, and LE-9 on the expression levels of PEPCK mRNA, GLUT4 mRNA, PI3K mRNA, and AKT mRNA in HepG2 cells (Note: '#' indicates a significant difference from the control group; '*' indicates a significant difference from the model group (ns indicates p>0.05, no significant difference; * indicates p<0.05; ** and ## indicate p<0.01; *** and ### indicate p<0.001; **** and #### indicate p<0.0001)); where A represents the expression level of PEPCK mRNA; B represents the expression level of GLUT4 mRNA; C represents the expression level of PI3K mRNA; and D represents the expression level of AKT mRNA. Detailed Implementation
[0056] The present invention will be further described in detail below with reference to embodiments, but the implementation of the present invention is not limited thereto. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Test methods in the following embodiments that do not specify specific experimental conditions are generally performed according to conventional experimental conditions or experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the present invention are commercially available.
[0057] The sturgeon in this embodiment of the invention is an artificially bred sturgeon, which can be obtained through conventional commercial sales.
[0058] Example 1: Method for Extraction of Sturgeon Protein (ASP)
[0059] (1) Determination of pH for alkaline extraction: Take an appropriate amount of sturgeon meat (stewed and minced using a meat grinder), add deionized water at a ratio of 1:9 (M / V, unit is g / mL), stir well, and homogenize at 5000 rpm for 2 minutes using an Icarus T25 homogenizer. Adjust the pH of the system to 7.0, 8.0, 9.0, 10.0, and 11.0 with 1 mol / L HCl or NaOH solution. Extract at 40℃ for 30 min with stirring, centrifuge at 11000 rpm for 15 min at 4℃, take the supernatant, and determine its protein concentration using the Bradford method. Calculate the protein solubility according to formula (1). Take the average value of three replicates.
[0060]
[0061] (2) Determination of pH for acid precipitation: Take an appropriate amount of sturgeon meat paste, add deionized water at a material-to-liquid ratio of 1:9 (M / V), stir well, and homogenize at 5000 rpm for 2 minutes using an Icarus T25 homogenizer. Adjust the pH of the system to 10.0 with 1 mol / L HCl or NaOH solution, stir and extract at 40℃ for 30 min, centrifuge at 11000 rpm for 15 min at 4℃, and collect the supernatant into centrifuge tubes. Adjust the pH of the system to 3.0, 4.0, 4.5, 5.0, 5.5, and 6.0 with 1 mol / L HCl or NaOH solution to precipitate proteins. Centrifuge at 8000 rpm for 10 min at 4℃, collect the supernatant and determine its protein concentration using the Bradford method, and calculate the protein solubility according to formula (1). Take the average value of three replicates.
[0062] The results are as follows Figure 1 As shown in Figure A, protein solubility increases with increasing pH during alkaline extraction, which means that the extracted protein content also increases. Figure 1 As shown in Figure B, in the acid precipitation method, the protein solubility in the supernatant is lowest at a pH of 5-5.5. Based on the above results, the final method adopted for ASP extraction was 40℃, alkaline extraction at pH 10.0, and acid precipitation at pH 5.0.
[0063] Example 2: Preparation of ASP enzymatic hydrolysate and detection of α-glucosidase inhibitory activity
[0064] (1) Preparation of ASP enzymatic hydrolysis products
[0065] a. Following the extraction method of Example 1, the extraction temperature was set to 40℃, the pH for alkaline extraction was 10.0, and the pH for acid precipitation was 5.0. After extraction, the product was freeze-dried to obtain freeze-dried ASP powder.
[0066] b. Weigh a certain amount of lyophilized ASP powder, dissolve it in distilled water to obtain a protein solution with a concentration of 10 mg / mL;
[0067] c. The prepared protein solutions were preheated with stirring at the optimal temperature of each enzyme. After the temperature stabilized, the pH was adjusted to the optimal pH of each protease using 1.0M hydrochloric acid and 1.0M sodium hydroxide solution. Stirring was continued for enzymatic hydrolysis. Proteases were added according to the optimal hydrolysis conditions and hydrolyzed for 3 hours. After hydrolysis, the hydrolysis products were collected, boiled in a water bath for 10 minutes, rapidly cooled, and centrifuged (4℃, 11000rpm, 15min). The supernatant was ultrafiltered to obtain fractions with a molecular weight <3KD, which were then lyophilized. Finally, the four crude peptide lyophilized powders were stored at -80℃ for later use. The trypsin, papain, alkaline protease, and complex protease used were purchased directly, and the specific sources are shown in Table 1. The amount of enzymes used and the optimal hydrolysis conditions are shown in Table 2.
[0068] Table 1. Information related to proteases
[0069] Types of proteases Item number Product Specifications Manufacturer Trypsin S10032 250U / mg Shanghai Yuanye Biotechnology Co., Ltd. Papain A501612 2000U / mg Sangon Biotech (Shanghai) Co., Ltd. Alkaline protease S10154 200U / mg Shanghai Yuanye Biotechnology Co., Ltd. Complex protease S10155 120U / mg Shanghai Yuanye Biotechnology Co., Ltd.
[0070] Table 2 Enzymatic hydrolysis conditions
[0071] Types of enzymes Optimal temperature Optimal pH Enzyme dosage (U / g) Trypsin 37℃ 8.0 10000 Papain 50℃ 6.0 10000 Alkaline protease 45℃ 8.0 10000 Complex protease 45℃ 7.5 10000
[0072] Note: In Table 2, the amount of enzyme added is the ratio of protease to lyophilized ASP powder.
[0073] (2) Assay of α-glucosidase inhibitory activity
[0074] The determination of the inhibitory activity of the four lyophilized enzymatic hydrolysates against α-glucosidase was based on the method described in the reference (Liang Kai. Enzymatic preparation and purification of hypoglycemic peptides from hemp seed meal [D]. South China University of Technology, 2014.), with slight modifications according to the sample conditions. The specific steps are as follows:
[0075] α-glucosidase, PNPG (p-nitrobenzene-β-D-galactoside), and the test sample (enzymatic digest) were dissolved in 0.10M sodium phosphate buffer (pH=6.8). 100 μL of 0.10M sodium phosphate buffer (pH 6.8) was added to a 96-well plate, followed by 20 μL of 0.2 U / mL α-glucosidase solution and 20 μL of sample solution (2 mg / mL). The mixture was then incubated at 37℃ for 15 min. 20 μL of 2.5 mmol / L PNPG solution was added, and the mixture was incubated at 37℃ for another 15 min. Finally, 80 μL of 0.20M Na2CO3 solution was added to terminate the reaction. The absorbance was measured at 405 nm. The α-glucosidase inhibitory activity was calculated using formula (2). The experiment was repeated three times.
[0076]
[0077] Where: OD A—The absorbance of the reaction when sodium phosphate buffer solution is used instead of the sample solution;
[0078] OD B —The absorbance of the sample solution during the reaction;
[0079] OD C —Absorbance of sodium phosphate buffer solution used in place of sample solution and PNPG solution for reaction.
[0080] The results are as follows Figure 2 As shown, when the sample concentration was 2 mg / mL, the ASP hydrolysis product of the complex protease had the highest inhibition rate against α-glucosidase, which was 29.56 ± 0.87%, while the α-glucosidase inhibition rate of the alkaline protease hydrolysis product was the lowest, which was 6.08 ± 0.86%.
[0081] Example 3: Enzyme Selection
[0082] Simulated gastrointestinal digestion: The four crude peptide lyophilized powders obtained in step (1) of Example 2 were dissolved in preheated 37°C artificial gastric digestion solution (purchased from Feijing Biotechnology Co., Ltd., product specification: 500mL) to achieve a final concentration of 10mg / mL. The solutions were then incubated on a 37°C constant-temperature shaker for 2 hours. The pH of the digested gastric solution was adjusted to 7.0 with 1.0M NaOH solution, and an equal volume of preheated 37°C artificial small intestinal digestion solution (purchased from Feijing Biotechnology Co., Ltd., product specification: 500mL) was added. The solutions were then incubated on a 37°C constant-temperature shaker for 4 hours. The digested samples were heated in boiling water for 10 minutes to terminate the reaction. The digested products were collected and lyophilized, and the inhibition rate of the products against α-glucosidase was determined. The relative activity of α-glucosidase was calculated using formula (3). The experiment was repeated three times.
[0083]
[0084] A1 and A2 represent the α-glucosidase inhibition rates of gastrointestinal digestive products (experimental group) and the control group (no gastrointestinal digestive products), respectively.
[0085] The results are as follows Figure 3 As shown, after simulated gastrointestinal digestion, the inhibition rate of the complex protease hydrolysate against α-glucosidase increased, with an increase in inhibitory activity of 17.84%, while the inhibitory activities of the hydrolysates of the other three enzymes did not change significantly. This indicates that all four hydrolysates possess a certain degree of gastrointestinal digestibility, with the complex protease hydrolysate exhibiting better gastrointestinal digestibility. Therefore, the ASP hydrolysate obtained by hydrolyzing the complex protease for 3 hours was selected for further research.
[0086] Example 4: Isolation and purification of component C
[0087] (1) Sephadex G-25 gel chromatography separation and purification: The lyophilized sample obtained after 3 h of enzymatic hydrolysis of the complex protease in Example 2 was dissolved in pure water to prepare a 30 mg / mL solution. The solution was filtered through a 0.22 μm microporous membrane and purified using a pre-prepared Sephadex G-25 gel chromatography column. The purification process should be carried out at low temperature to avoid peptide inactivation. The sample volume was 3 mL. After loading, the sample was allowed to stand for 30 min and then eluted with ultrapure water at a flow rate of 0.5 mL / min. The separated fractions were collected using an automatic collector, 3 mL per tube. The separation peak was detected at 230 nm and plotted. Fractions under the same peak were mixed, lyophilized, and stored at -20 °C.
[0088] Separation chromatography, such as Figure 4 As shown in A, four components were collected and named C1: tubes 7-16; C2: tubes 17-21; C3: tubes 22-27; and C4: tubes 28-31.
[0089] (2) Following the method in Example 2, the inhibitory activity of the four components (C1, C2, C3, C4) on α-glucosidase was determined, with the unpurified complex protease hydrolysis product (C) from Example 2 serving as a control. The experiment was conducted in triplicate.
[0090] The α-glucosidase inhibition rate of different components is as follows: Figure 4 As shown in B, the enzyme inhibition rate of component C1 was significantly lower than that of the unseparated component. The enzyme inhibition rate of component C4 was not significantly different from that of the unseparated component. The enzyme inhibition rates of components C2 and C3 were significantly higher than those of the unseparated component, indicating that components C2 and C3 play a major role in inhibiting α-glucosidase activity. The two components were combined and named CP.
[0091] Example 5: Molecular characterization analysis of reported α-glucosidase inhibitory peptides
[0092] Information on "Alpha-glucosidase inhibitor" was downloaded from the "Bioactivepeptides" section of the BIOPEP-UWM database (https: / / biochemia.uwm.edu.pl / ). A total of 79 α-glucosidase inhibitory peptides have been reported. Then, commonalities were analyzed in the IC50, the proportion of hydrophobic amino acids in the peptide, and the amino acids at the C-terminus and N-terminus of the reported α-glucosidase inhibitory peptides. Graphs were then generated to obtain the molecular characteristics of the reported α-glucosidase inhibitory peptides.
[0093] Molecular characteristics of α-glucosidase inhibitory peptides, such as Figure 5 As shown: Figure 5As shown in Figure A, approximately 50% of the reported IC50 values for α-glucosidase inhibitory peptides are... 50 ≤500μM. For example... Figure 5 As shown in Figure B, nearly 60% of α-glucosidase inhibitory peptides have a hydrophobic amino acid ratio ≥50%, with the highest proportion of α-glucosidase inhibitory peptides occurring in the 50-75% hydrophobic amino acid range. Figure 5 As shown in C, only a few α-glucosidase inhibitory peptides contain more than 10 amino acids, with peptides containing 5 amino acids being the most numerous. For example... Figure 5 As shown in Figure D, the C-terminal amino acids of α-glucosidase inhibitory peptides are mainly phenylalanine (F), arginine (R), leucine (L), and lysine (K), with the N-terminal amino acid being arginine (R). For example... Figure 5 As shown in E, the N-terminal amino acids of α-glucosidase inhibitory peptides are mainly alanine (A), leucine (L), glutamine (Q), serine (S), and tyrosine (Y), among which the α-glucosidase inhibitory peptide with alanine (A) as the C-terminal amino acid is the most abundant.
[0094] By summarizing the common molecular structures of reported α-glucosidase inhibitory peptides, this study provides a theoretical reference for the subsequent enzymatic preparation of α-glucosidase inhibitory peptides. For example, when screening α-glucosidase inhibitory peptides, priority should be given to oligopeptides with a hydrophobic amino acid content ≥50%, and peptides with the aforementioned amino acid types at the N-terminus and C-terminus are preferred.
[0095] Example 6: Structural Analysis of CP Components
[0096] (1) The CP component obtained in Example 4 was dissolved in 0.1% (v / v) formic acid aqueous solution and filtered through a 0.22 μm microporous membrane for loading.
[0097] (2) The peptide sequence was determined using a Thermo Fisher Ultimate 3000U HPLC-Q Exactive ultra-high resolution liquid chromatography-mass spectrometry system under the following conditions:
[0098] Chromatographic conditions: Solution A for the liquid chromatography was a 0.1% (v / v) formic acid aqueous solution, and Solution B was a formic acid aqueous solution containing 84% (v / v) acetonitrile (i.e., acetonitrile dissolved in 0.1% (v / v) formic acid aqueous solution, with acetonitrile volume percentage being 84%). The liquid chromatography column (0.15 mm × 150 mm, RP-C18, Column Technology Inc.) was equilibrated with 95% Solution A. The sample was loaded into a Zorbax 300SB-C18 peptide traps (Agilent Technologies, Wilmington, DE) via an autosampler and then separated by the liquid chromatography column. The relevant liquid chromatography gradients were set as follows: 0-50 min, linear gradient of Solution B from 4% to 50%; 50-54 min, linear gradient of Solution B from 50% to 100%; 54-60 min, Solution B maintained at 100%. Flow rate: 3 μL / min.
[0099] Mass spectrometry identification: CP components were separated by capillary high-performance liquid chromatography (HPLC) and then analyzed by mass spectrometry using a Q Exactive HF-X mass spectrometer (Thermo Fisher). Analysis time: 60 min. Detection mode: positive ion; Scan type: full mass spectrometry; Mass range: 100-1500 m / z; Drying temperature: 250℃. Specific determination conditions were as follows: The sample structure was identified using an ultra-high resolution liquid chromatography-mass spectrometry (LC-MS) quadrupole-electrostatic track trap system.
[0100] (3) Download the Bos taurus database from Uniprot (https: / / www.uniprot.org / ), import the MS / MS results and the Bos taurus database into MaxQuant software to analyze the obtained data, and obtain 16 peptide sequences. See Table 3.
[0101] Table 3 shows the predicted bioactivity and molecular characteristics of peptides identified in CP.
[0102]
[0103] Example 7: Synthesis and Activity Verification of Peptides
[0104] (1) Based on the peptide sequences shown in Example 6, and considering the peptide identification score, signal intensity, and the summary of the common molecular structures of α-glucosidase inhibitory peptides in Example 5, 16 peptides were further screened, and 8 peptides were finally determined to be synthesized: LQVR (LR-4), QVR (QR-3), SISLGLPR (SR-8), SLSPAGRGTIS (SS-11), LATSVRIP (LP-8), PASITSLN (PN-8), VLLQKNNDT (VT-9), and LSMQRAQEE (LE-9). All 8 peptides were synthesized by Nanjing Genscript Biotech Co., Ltd. (purity ≥ 95%).
[0105] (2) The inhibitory activity of eight synthetic peptides (all at a concentration of 250 μM) against α-glucosidase was preliminarily investigated, using the same method as in Example 2. The results showed that six peptides (LR-4, QR-3, SR-8, SS-11, LP-8, and PN-8) did not exhibit α-glucosidase inhibitory activity at this concentration, while two peptides (VT-9 and LE-9) showed α-glucosidase inhibitory activity. Therefore, the IC50 of these six peptides against α-glucosidase was not further investigated. 50 .
[0106] (3) Further investigation was conducted on the inhibitory activity of different concentrations of VT-9 and LE-9 on α-glucosidase (method as in Example 2), and their IC50 values were analyzed. 50 Analysis was performed. Results showed that the ICs of VT-9 and LE-9... 50 The concentrations were 2.781 mg / mL and 6.717 mg / mL, respectively. Furthermore, the inhibitory activities of different concentrations of VT-9 and LE-9 on α-glucosidase were as follows: Figure 6 As shown, the inhibitory effect on α-glucosidase increases with increasing concentrations of VT-9 and LE-9.
[0107] Database searches revealed that these two peptide sequences had not been previously discovered, leading to their identification as novel α-glucosidase inhibitory peptides.
[0108] Example 8: Gastrointestinal digestive stability of α-glucosidase inhibitory peptides VT-9 and LE-9
[0109] For specific procedures on the gastrointestinal digestive stability of VT-9 and LE-9, please refer to Example 3.
[0110] The results are as follows Figure 7As shown, after simulated gastrointestinal digestion, compared with the control group (without gastrointestinal digestion products), the α-glucosidase inhibitory activities of VT-9 and LE-9 decreased slightly, but still retained about 90% of the inhibitory activity, and there was no significant difference in the enzyme inhibitory activity of VT-9 before and after digestion (p>0.05). The in vitro simulated gastrointestinal digestion results indicate that VT-9 and LE-9 have good stability during gastrointestinal digestion.
[0111] Example 9: Effects of VT-9 and LE-9 on HepG2 cell viability
[0112] HepG2 cells in the logarithmic growth phase (purchased from the Shanghai Cell Bank, Chinese Academy of Sciences) were digested and collected, then diluted to 1×10⁻⁶ in DMEM complete medium. 5 Cells / ml were seeded with 100 μL of cell suspension (10,000 cells / well) in a 96-well cell culture plate. The plate was incubated at 37°C for 24 h until the cell density reached 80%–90%. The culture medium in the 96-well plate was discarded, and the cells were washed with PBS buffer. The PBS buffer was discarded. The experimental group was given 100 μL of serum-free DMEM medium containing cells and peptides (VT-9, LE-9) (final concentrations of 1 mM, 2 mM, and 4 mM). The control group was given serum-free DMEM medium containing cells but no drugs. The blank control group was cell-free and given only serum-free DMEM medium. Metformin hydrochloride was used as a positive control group. [Metformin hydrochloride is a hypoglycemic drug that can improve insulin sensitivity and is used to treat type II diabetes.] Six replicates were set up for each group. After culturing for 24 hours, 10 μL of CCK-8 reagent was added to each well of the plate and incubated for 1.5 hours. The absorbance at 450 nm was measured using a microplate reader. The experiment was repeated three times. In the last step, care should be taken not to introduce air bubbles into the wells, as they will interfere with the OD value reading. Cell viability was calculated using formula (3):
[0113]
[0114] Where A0 represents the absorbance value of the blank control group, A1 represents the absorbance value of the control group, and A2 represents the absorbance value of the experimental group.
[0115] The effects of different concentrations of metformin hydrochloride, VT-9, and LE-9 on the viability of HepG2 cells are as follows: Figure 8 As shown, various substances had different effects on the cell viability of HepG2 cells after co-culturing for 24 hours, but none of them had any adverse effects.
[0116] Example 10: Establishment of the IR-HepG2 cell model
[0117] (1) Using insulin of different concentrations (final concentration 10)-3 10 -4 10 -5 10 -6 10 -7 10 -8 10 -9 HepG2 cells were co-cultured with insulin (mol / L) for 24, 48, and 72 hours, and the cell viability was measured. A control group (without insulin) was used. The method was the same as in Example 9, except that the drug was replaced with insulin. Results are as follows: Figure 9 As shown, co-culturing HepG2 cells with different concentrations of insulin for 24, 48, and 72 hours had no adverse effect on their cell proliferation activity.
[0118] (2) Collect HepG2 cells (method as in Example 9), seed them in 96-well cell culture plates and culture for 24 hours until the cell density reaches 80%–90%. Discard the culture medium in the 96-well plates, add PBS buffer to wash the cells, discard the PBS buffer, and add 100 μL of insulin containing different concentrations (final concentration 10) to each well of the model group. -3 10 -4 10 -5 10 -6 10 -7 10 -8 10 -9 The cells were cultured in DMEM serum-free medium (mol / L). For the blank control group, 100 μL of DMEM serum-free medium (without cells) was added to each well. For the control group, 100 μL of DMEM serum-free medium (without insulin) was added to each well. Each group had six replicates. After culturing for 24 h, 48 h, and 72 h, the glucose content in the cell supernatant was measured according to the instructions of the glucose assay kit. The calculation formulas are (4) and (5). The experiment was repeated three times.
[0119]
[0120] In the formula, A0 represents the absorbance value of the control group, A1 represents the absorbance value of the standard group, A2 represents the absorbance value of the model group, and C standard: the concentration of the standard, 5.55 mmol / L.
[0121] Glucose consumption (mmol / L) = C1 - C2 (5)
[0122] In the formula, C1 represents the glucose content of the supernatant in the blank control group, and C2 represents the glucose content in the model group.
[0123] The results are as follows Figure 10 As shown, when the insulin concentration is 10 -8At a concentration of 10 mol / L, the cells exhibited the lowest glucose consumption, and after 48 hours of co-culture, the glucose consumption was approximately half that of the control group, demonstrating a significant inhibitory effect on glucose consumption. Therefore, a final concentration of 10 mol / L was adopted. -8 An insulin resistance model of human liver cancer cells HepG2 (IR-HepG2 cell model) was established by treating the cells with mol / L insulin for 48 hours.
[0124] Example 11: Effects of VT-9 and LE-9 on glucose consumption in IR-HepG2 cells
[0125] HepG2 cells were collected (using the same method as in Example 9) and seeded into 96-well cell culture plates. The plates were incubated at 37°C for 24 hours until the cell density reached 80%–90%. The culture medium in the 96-well plates was discarded, and the cells were washed twice with PBS buffer, which was then discarded. The experiment was randomly divided into the following groups: ① Control group: HepG2 cells were cultured in DMEM serum-free medium; ② Model group: cells were cultured at a final concentration of 10... -8 HepG2 cells were induced with 10 mol / L insulin for 48 h; ③ Positive group: IR-HepG2 cells were treated with metformin hydrochloride at a final concentration of 3 mM; ④ Sample group: IR-HepG2 cells were treated with VT-9 and LE-9 samples respectively, with three concentration gradients: low concentration 0.25 mM, medium concentration 0.50 mM, and high concentration 1.00 mM (all final concentrations). Each group had 6 replicates. Except for the control group, the model group, sample group, and positive group all used 10 mol / L insulin. -8 Insulin resistance was induced by insulin at mol / L for 48 h. Subsequently, the model group was added to DMEM serum-free medium, and the sample group was treated with VT-9 and LE-9 samples at three different concentration gradients. After culturing for 24 h, the glucose consumption of the cells was measured using the method in Example 10.
[0126] The results are as follows Figure 11 As shown, compared with the model group, IR-HepG2 cells treated with metformin hydrochloride, VT-9, and LE-9 all increased glucose consumption, and the effect was more significant with increasing peptide concentration.
[0127] Example 12: Effects of VT-9 and LE-9 on glycogen content in IR-HepG2 cells
[0128] HepG2 cells in the logarithmic growth phase were digested and collected, then diluted to 1×10⁻⁶ in DMEM complete medium. 5 Cells / mL, 2 mL of cell suspension (2 × 10⁶ cells / mL) was seeded in each well of a 6-well cell culture plate. 5IR-HepG2 cell models were constructed and experimental groups were set up according to the method in Example 11 (cells / well). 24 h after drug administration, cells were digested with commercially available 0.25% trypsin-EDTA digestion solution and collected into 1.5 mL centrifuge tubes. After centrifugation at 1000 rpm for 5 min at room temperature, the supernatant was carefully aspirated. Cells were washed with PBS and transferred to 5 mL centrifuge tubes. After centrifugation at 1000 rpm for 5 min at room temperature, the supernatant was discarded. 0.75 mL of extraction buffer was added for sonication. The sonication conditions were: power 200W, sonication for 3 seconds, interval 10 seconds, repeated 30 times. The cells were then transferred to 10 mL centrifuge tubes and boiled in a boiling water bath for 20 min (shaking every five minutes to ensure thorough mixing). After the boiling water bath, the centrifuge tubes were removed and immediately cooled to room temperature. The volume was adjusted to 5 mL with distilled water, mixed, and centrifuged at 8000g for 10 min at room temperature. The supernatant was collected for analysis. Glycogen content was determined according to the instructions of the glycogen content detection kit from Beijing Solarbio Technology Co., Ltd. The experiment was conducted in triplicate.
[0129] The results are as follows Figure 12 As shown, compared with the model group, IR-HepG2 cells treated with metformin hydrochloride, VT-9, and LE-9 all showed increased glycogen content, and the effect was more significant with increasing peptide concentration.
[0130] Example 13: Effects of VT-9 and LE-9 on the expression levels of glucose metabolism-related mRNAs in IR-HepG2 cells
[0131] (1) Cell preparation
[0132] a. Cell seeding: Collect HepG2 cells and add 2 mL of cell suspension (2 × 10⁻⁶ cells / well) to a 6-well cell culture plate. 5 Collect cells per well and place them in a cell culture incubator. When the cell density reaches 70-80%, discard the old culture medium.
[0133] b. Divide the experiment into 4 groups and perform cell pretreatment, with 6 replicates per group:
[0134] ① Control group: Cells were cultured using only DMEM serum-free medium.
[0135] ② Model group: final concentration of 10 -8 HepG2 cells were induced with mol / L insulin for 48 h to establish an IR-HepG2 cell model; then they were cultured in DMEM serum-free medium for 24 h.
[0136] ③ Positive group: final concentration of 10 -8HepG2 cells were induced with mol / L insulin for 48 h to establish an IR-HepG2 cell model; then, IR-HepG2 cells were co-cultured with DMEM serum-free medium containing 3 mM metformin hydrochloride for 24 h.
[0137] ④ Experimental group: final concentration of 10 -8 HepG2 cells were induced with mol / L insulin for 48 h to establish an IR-HepG2 cell model; then, DMEM serum-free medium containing peptide / metformin hydrochloride (VT-9 and LE-9 treatment concentration of 1 mM, metformin hydrochloride treatment concentration of 3 mM) was added and co-cultured with IR-HepG2 cells for 24 h.
[0138] (2) The expression levels of PEPCK mRNA, GLUT4 mRNA, PI3K mRNA, and AKT mRNA were detected according to the instructions of the miRNA real-time PCR kit (dye method) from Sangon Biotech (Shanghai) Co., Ltd. The experiment was performed in triplicate. The primer sequences involved are shown in Table 4.
[0139] Table 4 Primer sequences
[0140] Gene Forward primer (5'-3') Reverse primer (5'-3') GAPDH TGGGTGTGAACCATGAGAAGT TGAGTCCTTCCACGATACCAA PEPCK CCTGGGAGATGGTGACTTTGT GGGTTTTCTCTGGGTTGCA GLUT4 CCCATTCCTTGGTTCATCG CCATAGCCTCCGCAACATAC PI3K TCTGGAAAAATGGCTTTGAATC CTGGGAACTTTACCACACTGCT AKT TCAAGAAGGAAGTCATCGTGG CGGTCGTGGGTCTGGAA
[0141] In insulin signaling, insulin primarily regulates glucose and lipid metabolism through the PI3K / AKT signaling pathway. Insulin stimulates autophosphorylation of the insulin receptor, thereby phosphorylating and activating IRS-1, subsequently activating PI3K and downstream AKT. Activated AKT is released from the plasma membrane and translocates to the nucleus, cytoplasm, and mitochondria, thereby regulating cellular glucose uptake. Impairment of the PI3K / AKT signaling pathway can affect cellular glucose uptake, ultimately leading to insulin resistance. Furthermore, activated threonine kinase (AKT) promotes glucose transport via glucose transporter 4 (GLUT4) and inhibits gluconeogenesis by suppressing the gluconeogenesis pathway-related enzyme gene phosphoenolpyruvate carboxykinase (PEPCK). Therefore, by measuring the expression levels of PEPCK mRNA, GLUT4 mRNA, PI3K mRNA, and AKT mRNA in IR-HepG2 cells by VT-9 and LE-9, it is possible to understand whether VT-9 and LE-9 can affect the synthesis of PEPCK, GLUT4, PI3K, and AKT. Figure 13As shown, after insulin treatment, the expression level of PEPCK mRNA in the model group was significantly increased compared with the control group, while the expression levels of GLUT4, PI3K, and AKT mRNA were significantly decreased, indicating the successful establishment of the IR-HepG2 cell model. Compared with the model group, the expression levels of GLUT4, PI3K, and AKT mRNA in IR-HepG2 cells treated with metformin hydrochloride, VT-9, and LE-9 were significantly increased, while the expression level of PEPCK mRNA was significantly decreased. This indicates that VT-9 and LE-9 regulate blood glucose by upregulating the expression levels of AKT and PI3K mRNA, increasing the phosphorylation levels of AKT and PI3K, promoting GLUT4 transport of glucose, and inhibiting PEPCK expression to suppress gluconeogenesis.
[0142] The above examples illustrate that ASP enzymatic hydrolysates have α-glucosidase inhibitory activity. Among them, VT-9 (VLLQKNNDT) and LE-9 (LSMQRAQEE) have α-glucosidase inhibitory activity and can be regarded as novel α-glucosidase inhibitory peptides. They also have the function of improving insulin resistance in HepG2 cells.
[0143] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A sturgeon bioactive peptide, characterized in that, The sturgeon bioactive peptide is any one of the following: (1) Sturgeon bioactive peptide, the amino acid sequence of which is shown below: VLLQKNNDT; (2) Sturgeon bioactive peptide, the amino acid sequence of which is shown below: LSMQRAQEE.
2. The use of the sturgeon active peptide according to claim 1 in the preparation of pharmaceuticals or health products that help lower blood sugar.
3. The application according to claim 2, characterized in that: The aforementioned medications that help lower blood sugar improve or treat insulin resistance.
Citation Information
Patent Citations
Preparation method of limulus blood proteolysis peptide with alpha-glucosidase inhibition activity
CN108866135A
Millet prolysin peptides with α-glucosidase inhibitory activity
CN114716523B
Preparation method for sturgeon protein peptides
CN107653290A