A spatially separated orthogonal translation system and its applications

Abstract

The present invention discloses a spatially separated orthogonal translation system and its application. In order to enhance the specific translational expression of target genes in microbial hosts and reduce the mis-translation of background genes, the present invention provides a spatially separated orthogonal translation system. Specifically, first, the codons of the target gene are replaced with the TAG stop codon. Secondly, RTBA and thrombin F2 are selected as the mRNA-protein interaction system. Then, TyrRS / tRNA is heterologously expressed. This system can incorporate O-methyl-L-tyrosine into the amber stop codon UAG, and further fuse and express TyrRS and F2 with disordered proteins respectively. Finally, the translational selectivity of the target gene is increased to 4.01-fold. Finally, the N-acetylglucosamine epimerase AGE is modified to obtain a mutant AGE OMeY , whose specificity constant k cat / K m is increased by 86.0% compared with the wild type, and further, the specific translational expression of AGE OMeY is achieved in Bacillus subtilis cells by using the optimal orthogonal translation system, and the yield of the target product is as high as 2.1 g / L.

Description

Technical Field

[0001] The present invention relates to a spatially separated orthogonal translation system and its application, belonging to the field of biotechnology. Background Art

[0002] Introducing noncanonical amino acids (ncAAs) into target proteins based on the genetic code expansion (GCE) technology can effectively improve the catalytic performance of enzymes (stability, catalytic activity, substrate selectivity, etc.) and meet the application requirements of rationally designed proteins. Expressing aminoacyl tRNA synthetase (aaRS) and tRNA in a microbial host to construct an orthogonal translation system can achieve reprogrammed translation of specific codons, thereby realizing the incorporation and utilization of noncanonical amino acids. An ideal orthogonal translation system should have complete orthogonality and no interaction with the host, so as to minimize its impact on the host's endogenous translation system. However, even when using the less abundant amber stop codon (UAG), it will still cause mis-translation of non-target genes. Using genome-wide editing to remove background for specific codons is an effective way to reduce the interaction of the orthogonal translation system, but this operation has poor usability and low universality. Therefore, how to design and construct a simple and efficient orthogonal translation system to enhance the specific translation of target genes in microbial cells and reduce the mis-translation of background genes is a key problem to be solved urgently. Summary of the Invention

[0003] To solve the above problems, through synthetic biology technology, the present invention couples and optimizes artificial membraneless organelles, aminoacyl tRNA synthetase mutants / tRNA mutants pairs (TyrRS / tRNA), and mRNA-protein interaction systems, and designs and constructs a spatially separated orthogonal translation system with high operability, strong usability, and good universality. For this purpose, the present invention creates an orthogonal translation system in artificial membraneless organelles, and uses the mRNA-protein interaction system to recruit the mRNA after transcription of the target gene to the artificial membraneless organelles, thereby realizing the specific translation and expression of the target gene and reducing the mis-translation of background genes.

[0004] The first object of the present invention is to provide a spatially separated orthogonal translation system for translating a target gene, comprising:

[0005] Aminoacyl tRNA synthetase and tRNA;

[0006] Thrombin and thrombin-binding aptamer;

[0007] An intrinsically disordered protein for forming an artificial organelle, the amino acid sequence of the intrinsically disordered protein being MSKGP-(RGYGSPDG) n -GY or MSKGP-(RGSPYGDG) n -GY, wherein n is any integer from 15 to 30;

[0008] The gene sequence encoding the thrombin-binding aptamer is fused to the end of the target gene, at least one codon of the target gene is replaced with an amber stop codon or the target gene contains at least one site of O-methyl-l-tyrosine mutation, and the aminoacyl-tRNA synthetase, thrombin and the intrinsically disordered protein are expressed in a fused manner.

[0009] Furthermore, the orthogonal translation system further comprises a signal peptide expressed in a fused manner with the intrinsically disordered protein, and this signal peptide provides a targeting function for the artificial organelle.

[0010] Furthermore, the sequence of the signal peptide is as shown in SEQ ID NO.10 or SEQ ID NO.11.

[0011] Furthermore, the tRNA is constitutively expressed.

[0012] Furthermore, the sequence of the aminoacyl-tRNA synthetase is as shown in SEQ ID NO.6, the sequence of the tRNA is as shown in SEQ ID NO.7, the sequence of the thrombin is as shown in SEQ ID NO.9, and the thrombin-binding aptamer comprises the sequence shown in SEQ ID NO.3 (preferably, containing multiple repeats of SEQ ID NO.3, such as 2-10 repeats, and most preferably, containing 6 repeats, and the sequence is as shown in SEQ ID NO.4).

[0013] Furthermore, most preferably, n is 20, and the sequences are SDP1: MSKGP-(RGYGSPDG) 20 -GY, SDP3: MSKGP-(RGSPYGDG) 20 -GY.

[0014] Furthermore, the orthogonal translation system is expressed in a free form or an integrated form in a host cell. When expressed in a free form, the system contains at least two plasmids, named the first plasmid and the second plasmid. The first plasmid is linked with the target gene and the gene encoding the thrombin-binding aptamer, and the second plasmid is linked with the genes encoding the aminoacyl-tRNA synthetase, thrombin and the intrinsically disordered protein. When the system contains a signal peptide, the signal peptide is located on the second plasmid.

[0015] The second object of the present invention is to provide a polynucleotide encoding the above orthogonal translation system.

[0016] The third object of the present invention is to provide a recombinant cell containing the above orthogonal translation system.

[0017] Further, the recombinant cell includes but is not limited to microorganisms.

[0018] The fourth object of the present invention is to provide the application of the above orthogonal translation system, polynucleotide or recombinant cell in the specific translation of a target gene.

[0019] Further, the application is to culture a host bacterium containing a target gene and the orthogonal translation system under conditions containing O-methyl-L-tyrosine.

[0020] Further, the host bacterium includes but is not limited to Bacillus subtilis.

[0021] The fifth object of the present invention is to provide a method for producing N-acetylmannosamine. Under culture conditions containing O-methyl-L-tyrosine, fermentation production is carried out using a recombinant bacterium containing a target gene and the orthogonal translation system. The target gene includes a coding gene of N-acetylglucosamine epimerase or a mutant thereof, and the mutant contains at least one site of O-methyl-L-tyrosine mutation relative to the wild type.

[0022] Further, the recombinant bacterium uses Bacillus subtilis as the host bacterium, and includes or does not include the following modifications: overexpressing the coding gene GNA1 of glucosamine acetylase, and / or inactivating the β-galactosidase gene yesZ.

[0023] Further, the host bacterium is B.subtilis 168ΔgamPΔgamAΔnagAΔnagBΔldhΔpta::lox72,P 43 -glmS.

[0024] Further, the genes involved refer to the reference Niu, T. et al. Engineering a glucosamine-6-phosphate responsive glmS ribozyme switch enables dynamic control of metabolic flux in Bacillus subtilis for overproduction of N-acetylglucosamine. ACS Synth. Biol. 7, 2423-2435 (2018).

[0025] The sixth object of the present invention is to provide an N-acetylglucosamine epimerase mutant, which is obtained by mutating the amino acid sequence shown in SEQ ID NO. 14, and the mutations are as follows: mutating methionine at position 15 to leucine, asparagine at position 41 to aspartic acid, glutamic acid at position 57 to glutamine, glycine at position 169 to asparagine, glutamine at position 234 to leucine, threonine at position 236 to asparagine, threonine at position 269 to tryptophan, asparagine at position 291 to lysine, serine at position 312 to alanine, arginine at position 323 to glutamic acid, glutamine at position 343 to proline, and valine at position 373 to O-methyl-L-tyrosine.

[0026] The seventh object of the present invention is to provide a nucleic acid molecule encoding the N-acetylglucosamine epimerase mutant.

[0027] The eighth object of the present invention is to provide an expression vector containing the nucleic acid molecule.

[0028] The ninth object of the present invention is to provide a recombinant cell containing the N-acetylglucosamine epimerase mutant.

[0029] The tenth object of the present invention is to provide the application of the N-acetylglucosamine epimerase mutant, nucleic acid molecule, expression vector or recombinant cell in the production of N-acetylmannosamine.

[0030] The beneficial effects of the present invention:

[0031] The present invention combines and optimizes artificial membraneless organelles, mRNA-protein interaction systems, and TyrRS / tRNA mutant pairs to construct a spatially separated orthogonal translation system with high operability, strong usability, and good universality. The translation selectivity of the optimized system is as high as 4.01 times; and when CFP is used to replace GFP as the target gene, the translation selectivity is still as high as 3.6 times, successfully realizing the specific translation of the target gene and reducing the mis-translation expression of background genes; and further applying the above system to the metabolic synthesis regulation of N-acetylmannosamine, and using the above system to realize the specific expression of the artificial enzyme mutant AGE containing O-methyl-L-tyrosine (OMeY) incorporation. OMeY The yield of N-acetylmannosamine was increased by 75.0% compared with the control strain, reaching 2.1 g / L, proving the application feasibility of the spatially separated orthogonal translation system. Description of the Drawings

[0032] Figure 1 It is a schematic diagram for the design and construction of the target gene and background gene.

[0033] Figure 2 Performance test of a spatially separated orthogonal translation system.

[0034] Figure 3 Performance impact of replacing the target gene with CFP on a spatially separated orthogonal translation system.

[0035] Figure 4 Fermentation culture process diagrams of recombinant strains MA1 and MA2.

[0036] Figure 5 Fermentation culture process diagrams of recombinant strains MAO1 and MAO2. Specific implementation manner

[0037] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the embodiments given are not intended to limit the present invention.

[0038] The solution provided by the present invention is as follows:

[0039] In order to enhance the specific translational expression of the target gene in a microbial host and reduce the mis-translation of background genes, the present invention provides a method for designing and constructing a spatially separated orthogonal translation system. This method first uses the constitutive promoter P 43 and P vegControl the expression of GFP (set as the target gene) and mKate (set as the background gene) separately, and place the expression cassettes of GFP and mKate on the same plasmid vector to maintain a constant transcriptional level ratio. In addition, the third codons of the GFP and mKate coding genes are both replaced with the TAG stop codon. Secondly, select RTBA and thrombin (F2) as the mRNA-protein interaction system, and fuse the RTBA sequence to the 3'-untranslated region of the target gene GFP. After the target gene is transcribed, the produced mRNA will contain the RTBA region, and F2 will specifically bind to the RTBA region to form an mRNA-F2 complex. Then, heterologously express TyrRS / tRNA from Methanococcus jannaschii. This system can incorporate O-methyl-L-tyrosine (OMeY) into the amber stop codon UAG, and further fuse and express TyrRS and F2 with intrinsically disordered proteins respectively. Through modular combination optimization, the intrinsically disordered protein fusion proteins form artificial membraneless organelles in the microbial host and are localized to the curved membrane through the signal peptide divIVA-N60. The translational selectivity of the target gene GFP is increased to 4.01-fold, and when the target gene is replaced with CFP, its translational selectivity is still 3.6-fold. Finally, to verify the application feasibility of this system, use the GCE technology to transform N-acetylglucosamine epimerase (AGE) to obtain a positive mutant AGE OMeY , whose specificity constant k cat / K m is increased by 86.0% compared to the wild-type AGE, and further realizes the specific translational expression of AGE OMeY in the intracellular of Bacillus subtilis using the above optimal spatially separated orthogonal translation system. The yield of N-acetylmannosamine is as high as 2.1 g / L, which is increased by 75.0% compared to the control strain.

[0040] Example 1 Design and construction of target gene and background gene

[0041] (a) First, artificially synthesize the gene fragment P veg -mKate 3TAG; Secondly, using the free expression plasmid pADK15-sfGFP preserved in the laboratory (plasmid source literature: CRISPR-dCas12a-mediated genetic circuit cascades for multiplexed pathway optimization; plasmid information public website: https: / / benchling.com / s / seq3ztXHVMGXHgXTrbNE0Mi?m=slm-ZImhU6jkNTDoRpliB94p) as a template, the linearized PADK plasmid fragment PADK-X was amplified using primers HPADK-R1 and HPADK-F1; afterwards, P veg -mKate 3TAG and the PADK-X fragment were configured in an equimolar ratio for seamless cloning connection, and the assembled product was transformed into E. coli competent cells. After the transformants grew, they were subjected to sequencing verification. The single colony with correct sequencing was inoculated into 2 ml of LB liquid medium containing kanamycin resistance and cultured at 37 °C for 12 h, and then the plasmid pADK-P veg -mKate 3TAG (P veg -mKate 3TAG sequence is shown in SEQ ID NO.1) was extracted using the Sangon plasmid extraction kit.

[0042] (b) First, the gene fragment P 43 -GFP 3TAG was artificially synthesized; secondly, using the plasmid pADK-P veg -mKate 3TAG obtained in step (a) as a template, the linearized plasmid fragment PADK-X2 was amplified using primers HPADK-R2 and HPADK-F2; afterwards, P 43 -GFP 3TAG and the PADK-X2 fragment were configured in an equimolar ratio for seamless cloning connection, and the assembled product was transformed into E. coli competent cells. After the transformants grew, they were subjected to sequencing verification. The single colony with correct sequencing was inoculated into 2 ml of LB liquid medium containing kanamycin resistance and cultured at 37 °C for 12 h, and then the plasmid pADK-P 43 -GFP 3TAG -P veg -mKate 3TAG (P 43 -GFP 3TAG sequence is shown in SEQ ID NO.2) was extracted using the Sangon plasmid extraction kit.

[0043] (c) Using the plasmid pADK-P 43 -GFP3TAG -P veg -mKate 3TAG Using -P-mKate as a template, the linearized plasmid fragment PADK-X3 was amplified with primers HPADK-R3 and HPADK-F3. Secondly, the fragment RTBA was obtained by PCR amplification using primers RTBA-F1 and RTBA-R1 as templates for each other. After that, the gene fragment 6RTBA was artificially synthesized. Finally, the obtained linearized plasmid fragment PADK-X3 was seamlessly cloned and ligated with the fragments RTBA and 6RTBA (the sequences are shown in SEQ ID NO.3 and 4 respectively), and heat-shocked and transformed into competent Escherichia coli JM109 respectively, followed by sequencing. The single colonies with correct sequencing were inoculated into 2 ml of LB liquid medium containing ampicillin resistance and cultured at 37 °C for 16 h, and then two kinds of plasmids pADK-P 43 -GFP 3TAG -RTBA-P veg -mKate 3TAG and pADK-P 43 -GFP 3TAG -6RTBA-P veg -mKate 3TAG ( Figure 1 A and B).

[0044] Primer sequences:

[0045] HPADK-R1 TGAGCTCTACAAATAACGCGCGAAAAACGCGAGC

[0046] HPADK-F1 TGGGTCACCGTTAACTGCAGGTCGACGTCCCCGGG

[0047] HPADK-R2 CGGGTTCATTAGATCCGCGCGAAAAACGCGAGCG

[0048] HPADK-F2 AGGTACCTTAGGATCTCGACGAGCTCCGTCTTTAT

[0049] HPADK-R3

[0050] AAGTACTTACCCCAAAAAAAACTGCAGGTCGACAAAAACG

[0051] HPADK-F3 CAGCTTTGTTCCCCGACGAGCTCCGTCTTTATTT

[0052] RTBA-F1 TTTTCGCGCGGATCTAATGAACCCGGGAATACTG

[0053] RTBA-R1 AGCTCGTCGAGATCCTAAGGTACCTAATTGCCTA

[0054] Example 2 Construction and Optimization of a Spatially Separated Orthogonal Translation System

[0055] (a) First, artificially synthesize the plasmid pBUA-P of the orthogonal translation system 43 -TyrRS-P 224 -tRNA (the sequence is shown in SEQ ID NO.5, where TyrRS is shown in SEQ ID NO.6, tRNA is shown in SEQ ID NO.7, P 224 promoter is shown in SEQ ID NO.8), and use it as a template to amplify the linearized plasmid fragment HPB-X1 with the primers HPB-Trs-F1 and HPB-Trs-R1; then, use the gene F2 (SEQ ID NO.9) as a template to amplify the fragment F2-A with the primers F2-F1 and F2-R1; further, configure the fragment F2-A and HPB-X1 in an equimolar ratio for seamless cloning connection, and transform the assembly into E. coli competent cells. Wait for the transformants to grow and perform sequencing verification. The single colony with correct sequencing is inoculated into 2 ml of LB liquid medium containing ampicillin resistance and cultured at 37 °C for 12 h, and then the plasmid pBUA-P 43 -TyrRS-F2-P 224 -tRNA is obtained by using the Sangon plasmid extraction kit

[0056] (b) Use the plasmid pBUA-P 43 -TyrRS-F2-P 224 -tRNA obtained in step (a) as a template, and amplify the linearized plasmid fragment HPB-X2 with the primers HPB-Trs-F2 and HPB-Trs-R2; secondly, use the genes SDP1 and SDP3 as templates respectively (the SDP1 protein sequence is MSKGP-(RGYGSPDG) 20 -GY, the SDP3 protein sequence is MSKGP-(RGSPYGDG) 20-GY), the corresponding gene fragments SDP1-A and SDP3-A were amplified using primers SDP1-F1, SDP1-R1 and SDP3-F1, SDP3-R1; then, the linearized plasmid fragment HPB-X2 was ligated with SDP1-A and SDP3-A respectively by seamless cloning at an equimolar ratio, and the assembly was transformed into E. coli competent cells. After the transformants grew, they were sequenced and verified. The single colony with correct sequencing was inoculated into 2 ml of LB liquid medium containing ampicillin resistance and cultured at 37 °C for 12 h, and then the plasmid pBUA-P was extracted using the Sangon plasmid extraction kit 43 -TyrRS-SDP1-F2-P 224 -tRNA and pBUA-P 43 -TyrRS-SDP3-F2-P 224 -tRNA.

[0057] (c) Using the plasmid pBUA-P 43 -TyrRS-F2-P 224 -tRNA obtained in step (a) as a template, the linearized plasmid fragment HPB-X3 was amplified using primers HPB-Trs-F3 and HPB-Trs-R3; secondly, using Bacillus subtilis 168 as a template, the first 60 amino acids at the N-terminus of the gene divIVA were amplified using primers DIV-TY-F1 and DIV-TY-R1, named div (the sequence is shown in SEQ ID NO.10); then, the linearized plasmid fragment HPB-X3 was ligated with div by seamless cloning at an equimolar ratio, and the assembly was transformed into E. coli competent cells. After the transformants grew, they were sequenced and verified. The single colony with correct sequencing was inoculated into 2 ml of LB liquid medium containing ampicillin resistance and cultured at 37 °C for 12 h, and then the plasmid pBUA-P was extracted using the Sangon plasmid extraction kit 43 -div-TyrRS-F2-P 224 -tRNA.

[0058] (d) Using the plasmid pBUA-P 43 -div-TyrRS-F2-P 224 -tRNA obtained in step (c) as a template, the fragment HPB-X4 was amplified using primers DIVMUT-F1 and DIVMUT-R1 and directly transformed into E. coli competent cells. After the transformants grew, they were sequenced and verified. The single colony with correct sequencing was inoculated into 2 ml of LB liquid medium containing ampicillin resistance and cultured at 37 for 12 h, and then the plasmid pBUA-P was extracted using the Sangon plasmid extraction kit 43 -divmut-TyrRS-F2-P 224-tRNA (the divmut sequence is shown in SEQ ID NO. 11).

[0059] (e) Using the plasmid pBUA-P 43 -TyrRS-SDP1-F2-P 224 -tRNA obtained in step (b) as a template, amplifying the fragment HP-X5 with primers HPB-Trs-F4 and HPB-Trs-R4, and directly transforming it into E. coli competent cells. After the transformants grow, perform sequencing verification. Inoculate the single colony with correct sequencing into 2 ml of LB liquid medium containing ampicillin resistance and culture it at 37°C for 12 h, then extract the plasmid pBUA-P 43 -TyrRS-SDP1-P 224 -tRNA using the Sangon plasmid extraction kit.

[0060] (f) Using the plasmid pBUA-P 43 -TyrRS-SDP1-F2-P 224 -tRNA obtained in step (b) as a template, amplifying the fragment HP-X6 with primers HPB-Trs-F5 and HPB-Trs-R5, and performing seamless cloning connection with the fragment div in step (c) according to the equimolar ratio, and transforming the composition into E. coli competent cells. After the transformants grow, perform sequencing verification. Inoculate the single colony with correct sequencing into 2 ml of LB liquid medium containing ampicillin resistance and culture it at 37°C for 12 h, then extract the plasmid pBUA-P 43 -div-TyrRS-SDP1-F2-P 224 -tRNA using the Sangon plasmid extraction kit.

[0061] (g) Prepare the competent cells of Bacillus subtilis 168, and respectively transform the plasmids pBUA-P 43 -TyrRS-P 224 -tRNA, pBUA-P 43 -TyrRS-F2-P 224 -tRNA, pBUA-P 43 -div-TyrRS-F2-P 224 -tRNA, pBUA-P 43 -divmut-TyrRS-F2-P 224 -tRNA, pBUA-P 43 -TyrRS-SDP3-F2-P 224 -tRNA, pBUA-P 43 -TyrRS-SDP1-F2-P 224 -tRNA, pBUA-P 43-div-TyrRS-SDP1-F2-P 224 -tRNA and pBUA-P 43 -TyrRS-SDP1-P 224 -Transfer tRNA into them to construct strains OM0, OM1, OM2, OM3, OM4, OM5, OM6 and OM7.

[0062] (h) Prepare the competent cells of strains OM0, OM1, OM2, OM3, OM4, OM5, OM6 and OM7, and transfer pADK-P 43 -GFP 3TAG -6RTBA-P veg -mKate 3TAG into them respectively to obtain recombinant strains OM0-1, OM1-1, OM2-1, OM3-1, OM4-1, OM5-1, OM6-1 and OM7-1. In addition, transfer the pADK-P 43 -GFP 3TAG -RTBA-P veg -mKate 3TAG plasmids into the competent cells of strains OM1, OM2 and OM6 respectively to obtain recombinant strains OM1-2, OM2-2 and OM6-2.

[0063] (i) Culture the whole series of recombinant strains obtained in step (h) in a 15 mL test tube containing 2 mL of LB liquid medium at 30 °C and 220 rpm for 10 h to prepare the seed solution; then, transfer it to a 96-well fluorescence plate containing 200 μL of LB medium (containing kanamycin, ampicillin, 0.3 mM of OMeY) at an inoculation amount of 1% (v / v) and culture at 37 °C and 750 rpm for 10 h. Use a Cytation microplate reader to detect cell growth (OD 600 ), as well as the GFP fluorescence intensity, mKate fluorescence intensity (excitation: 589 nm; emission: 634 nm; gain value: 100) or CFP fluorescence intensity (excitation: 405 nm; emission: 480 nm; gain value: 70). The relative fluorescence intensity is defined as the ratio of the fluorescence intensity without background fluorescence to the OD 600 without background absorption. The relative translation intensity is normalized with the GFP relative fluorescence intensity of recombinant strain OM0-1 as the standard value (100%). The translation selectivity is normalized with the ratio of the GFP relative fluorescence intensity to the mKate relative fluorescence intensity of recombinant strain OM0-1 as the standard value 1.

[0064] (j) The results of the culture detection carried out according to step (i) are as Figure 2 shown.

[0065] Compared with the orthogonal translation system (the recombinant strain OM0-1 containing only TyrRS / tRNA), in system J (recombinant strain OM1-1) constructed by fusing F2 to the C-terminus of the TyrRS enzyme, the translation selectivity for GFP was increased to 1.54 times, while the relative translation efficiency decreased by 20.0%. The above results prove that the mRNA-protein interaction system can effectively improve the translation selectivity of target genes.

[0066] SDP1 and SDP3 were respectively fused to the C-terminus of the TyrRS enzyme to construct system JM1 (recombinant strain OM5-1) and JM2 (recombinant strain OM4-1). The results showed that the translation selectivity of system JM1 was 2.44 times, and the relative translation efficiency was 82.5%. The translation selectivity of system JM2 was 2.76 times, and the relative translation efficiency decreased to 51.1%. The above results prove that artificial membraneless organelles can provide a relatively independent working place for the orthogonal translation system and effectively reduce the mis-translation of background genes.

[0067] After that, the localization signal peptides of divIVA and its mutants were respectively fused to the N-terminus of the TyrRS enzyme to obtain system JD (recombinant strain OM2-1) and JDR (recombinant strain OM3-1). The translation selectivities of JD and JDR were increased to 2.15 times and 2.24 times respectively. In addition, the translation efficiency of system JD was basically the same as that of J, while the translation efficiency of JDR decreased to 68.6%.

[0068] Finally, based on system JD, SDP1 was fused to the C-terminus of the TyrRS enzyme to obtain system JDM1 (recombinant strain OM6-1), whose translation selectivity was increased to 4.01 times, and the relative translation intensity was 61.1%. In addition, to prove that the improvement of translation selectivity benefited from the RTBA-F2 interaction system, the number of RTBA repeats in the non-coding region of the target gene GFP was adjusted to 1, and the translation selectivities of system J-2 (recombinant strain OM1-2), JD-2 (recombinant strain OM2-2), and JDM-2 (recombinant strain OM6-2) all decreased significantly; when the F2 protein in the system was removed, system JS (recombinant strain OM7-1) did not show translation selectivity.

[0069] Primer sequences:

[0070] HPB-Trs-F1

[0071] GATCCGTAAACGTCTGTAAATTATGGAAAGGCGTGCC

[0072] HPB-Trs-R1

[0073] GTGTACATTCCTCTCTTACCTATAATGGTACCGCTATCACTTT

[0074] F2 - F1 CAGGCTCTGGTTCAGGGTCCATGGCACACGTTCGGGGGT

[0075] F2 - R1 CTTTCCATAATTTACAGTTTATCTCTCGGTGTCCGT

[0076] HPB - Trs - F2

[0077] CGAGAGATAAACTGTAAATTATGGAAAGGCGTGCCTGACAAGG

[0078] HPB - Trs - R2

[0079] ATGGACCCTGAACCAGAGCCTGATCCCAGACGTTTACGG

[0080] SDP1 - F1 CAGGGTCCATGTCGAAAGGGCCAAGGGGCTATG

[0081] SDP1 - R1 GAACGTGTGCCATCCCGTAGCCCCTACCATC

[0082] SDP3 - F1 TCAGGGTCCATGTCGAAAGGGCCAAGGGGAAGTC

[0083] SDP3 - R1 CGTGTGCCATATAGCCGCCATCTCCGTATGGA

[0084] HPB - Trs - F3

[0085] CGAGAGATAAACTGTAAATTATGGAAAGGCGTGCCTGACAAGG

[0086] HPB - Trs - R3 GCGTTAATGGCATGTGTACATTCCTCTCTTACCTATA

[0087] DIV - TY - F1

[0088] TAGGTAAGAGAGGAATGTACACATGCCATTAACGCCAAATGA

[0089] DIV - TY - R1

[0090] AACCAGAGCCTGATCCAGACCCAAAGTGTCCGATTCTTTCATCAA

[0091] DIVMUT-F1

[0092] AAAAAGTTTTTGCGGATATGATGAAGATGAAGTAAATGAA

[0093] DIVMUT-R1 ATCATATCCGCAAAAACTTTTTGTAAACGTCTTG

[0094] HPB-Trs-F4 TACGGAGATGGCGGCTATATGGCACACGTTCGGGG

[0095] HPB-Trs-R4 TTGGCCCTTTCGACATGGACCCTGAACCAGAGCC

[0096] HPB-Trs-F5

[0097] CCAGATGGTAGGGGCTACGGGATGGCACACGTTCGGGGGT

[0098] HPB-Trs-R5

[0099] CCATAGCCCCTTGGCCCTTTCGACATGGACCCTGAACCAGAG

[0100] Example 3 Verification of the universality of replacement target genes

[0101] (a) Using plasmid pADK-P 43 -GFP 3TAG -6RTBA-P veg -mKate 3TAG as a template, the linearized plasmid fragment PADK-X4 was amplified using primers HPADK-R4 and HPADK-F4; then, using the CFP gene (sequence shown in SEQ ID NO.12) as a template, the fragment CFP was amplified using primers CFP-F1 and CFP-R1; and further, it was seamlessly cloned and ligated with the PADK-X4 fragment. Finally, the assembled product was transformed into E. coli competent cells, and after the transformants grew out, they were subjected to sequencing verification. The single colonies with correct sequencing were inoculated into 2 ml of LB liquid medium containing kanamycin resistance and cultured at 37 °C for 12 h, and then the plasmid pADK-P 43 -CFP 3TAG -6RTBA-P veg -mKate 3TAG .

[0102] (b) pADK-P43 -CFP 3TAG -6RTBA-P veg -mKate 3TAG The plasmids were respectively transformed into competent cells of strains OM0, OM1, OM2, OM5 and OM6 to obtain recombinant strains OM0-2, OM1-3 (containing system J), OM2-3 (containing system JD), OM5-2 (containing system JM1) and OM6-3 (containing system JDM1). Then, cultivation and detection were carried out according to the method in step (i) of Example 2, and the relative translation intensity and translation selectivity were calculated according to the above method using the recombinant strain OM0-2 as the standard.

[0103] (c) The results of cultivation and detection carried out according to step (b) are as Figure 3 shown. After replacing GFP with CFP, the translation selectivity of the constructed system still meets the expected target. Among them, the CFP translation selectivity of the JDM1 system (recombinant strain OM6-3) is 3.6 times. The above results prove that the spatially separated orthogonal translation system has good universality and can be applied to different target genes.

[0104] Primer sequences:

[0105] HPADK-R4

[0106] GCATGGACGAACTCTATAAATAATAAAGACGGAGCTCGTCGGGGAAC

[0107] HPADK-F4 TCACCTTTCTAAACCATGTGTACATTTCACCTCCTTTG

[0108] CFP-F1 CTCCGTCTTTATTATTTATAGAGTTCGTCCATGCC

[0109] CFP-R1 GTACACATGGTTTAGAAAGGTGAAGAATT

[0110] Example 4 Application of the spatially separated orthogonal translation system

[0111] (a) Using the Bacillus subtilis 168 genome as a template, the gene fragment yesZ-U was amplified using primers yesZ-U-F and yesZ-U-R, and the gene fragment yesZ-D was amplified using primers yesZ-D-F and yesZ-D-R. Using the plasmid p7z6 as a template, the gene yesZ-Z was amplified using primers yesZ-Z-F and yesZ-Z-R. Artificially synthesized the gene fragment P that controls the expression of the fusion protein GAN1-AGE with the promoter P 43 controlling the expression of the fusion protein GAN1-AGE43 -GNA1-age. The obtained gene fragments yesZ-U, yesZ-D, yesZ-Z, and P 43 -GNA1-age were configured in equimolar ratio for fusion PCR ligation to obtain the gene fragment yesZ-P 43 -GNA1-age (P 43 -GNA1-age sequence is shown in SEQ ID NO.13, yesZ locus: UniProtKB / Swiss-Prot: O31529). According to the method of Example 1, 6RTBA was ligated to the age end to obtain yesZ-P 43 -GNA1-age-6RTBA. Using the laboratory-preserved strain S5 (B. subtilis 168ΔgamPΔgamAΔnagAΔnagBΔldhΔpta::lox72, P 43 -glmS) as the starting strain, competent cells were prepared. The fragment yesZ-P 43 -GNA1-age-6RTBA was transformed into the competent cells of strain S5, and then plated on an LB solid medium plate supplemented with bleomycin and cultured at 37°C for 12 h. The grown single colonies were Bacillus subtilis MA1.

[0112] (b) Prepare competent cells from the recombinant strain MA1 obtained in step (a), and transfer the plasmid pBUA-P 43 -TyrRS-P 224 -tRNA in step (a) of Example 2 into the competent cells of MA1, plate on an LB solid medium plate supplemented with chloramphenicol, and culture at 37°C for 12 h. The grown single colonies are Bacillus subtilis MA2.

[0113] (c) Inoculate the recombinant strains MA1 and MA2 on the solid LB plate into 2 ml of LB medium respectively, culture at 30°C and 220 rpm for 8 - 10 h, and then inoculate at an inoculation amount of 5% into a liquid medium containing 12.5 g / L dipotassium hydrogen phosphate trihydrate, 2.5 g / L potassium dihydrogen phosphate, 12.0 g / L yeast powder, 6.0 g / L peptone, 0.3 mM OMeY, 40.0 g / L glucose, and 10.0 g / L glycerol. During the fermentation process, 1 mL of the bacterial liquid was taken every 12 h for the detection of OD 600 , the intermediate metabolite N-acetylglucosamine (GlcNAc), and the target product N-acetylmannosamine (ManNAc). The conditions are as follows: The products were determined by high-performance liquid chromatography (HPLC, Agilent 1260). The injection volume was 10 μL, the mobile phase was 5 mM dilute sulfuric acid, the chromatographic column was Rezex ROA Organic Acid H+, the column temperature was set at 55°C, the flow rate was 0.6 mL / min, and the ultraviolet detector was at 210 nm. AsFigure 4 As shown, the ManNAc yield of the recombinant strain MA1 reached 1.2 g / L at the end of 48 h fermentation, while the ManNAc yield of the recombinant strain MA2 was only 0.7 g / L, which was 41.7% lower than that of MA1.

[0114] (d) Accidentally, it was found that combinatorial mutagenesis (M15L, N41D, E57Q, G169N, Q234L, T236N, T269W, N291K, S312A, R323E, Q343P, V373OMeY) of the AGE catalytic enzyme (amino acid sequence shown in SEQ ID NO. 14) derived from Bacteroides sp. CAG:598 could effectively improve its catalytic activity (the mutant is hereinafter referred to as AGE OMeY ). The K OMeY of the forward mutant AGE m was 1448.9 μM, and the k cat was 124.7 s -1 , which were 29.4 times and 54.2 times that of the wild-type AGE, respectively. In addition, the specificity constant k OMeY / K cat of AGE m was as high as 86078.9 s -1 ·M -1 , which was 86.0% higher than that of the wild-type AGE. The conditions for enzyme activity detection were as follows: The enzyme activity reaction system was a total of 1.0 mL, which contained 100 mM Tris-HCl, 500 mM NaCl, 10 mM MgCl2, 5 mM ATP, 0.15 g / L of the catalytic enzyme to be detected, and 2 - 200 g / L of the substrate GlcNAc. The reaction was stopped after 5 min at pH = 7.4 and 37 °C, and GlcNAc and ManNAc were detected using the method in step (c).

[0115] (e) Artificially synthesized the gene fragment P 43 -GNA1-age OMeY that controls the expression of the fusion protein GAN1-AGE 43 (the sequence is shown in SEQ ID NO. 15, where GNA1 is shown in SEQ ID NO. 16), and configured it with the gene fragments yesZ-U, yesZ-D, and yesZ-Z in step (a) in an equimolar ratio for fusion PCR connection to obtain the gene fragment yesZ-P OMeY -GNA1-age 43 -GNA1-age OMeY . Similarly, 6RTBA was ligated to the age OMeY end according to the method of Example 1 to obtain yesZ-P 43 -GNA1-age OMeY-6RTBA. Transfer the fragment yesZ-P 43 -GNA1-age OMeY -6RTBA into the competent cells of strain S5, then spread it on the LB solid medium plate supplemented with bleomycin and culture it at 37 °C for 12 h. The single colonies grown are Bacillus subtilis MAO.

[0116] (f) Prepare the competent cells of the recombinant strain MAO obtained in step (e), and transfer the plasmid pBUA-P 43 -TyrRS-P 224 -tRNA in step (a) of Example 2 and the plasmid pBUA-P 43 -div-TyrRS-SDP1-F2-P 224 -tRNA into the competent cells of MAO respectively, spread it on the LB solid medium plate supplemented with chloramphenicol and culture it at 37 °C for 12 h. The single colonies grown are Bacillus subtilis MAO1 and MAO2.

[0117] (g) The recombinant strains MAO1 and MAO2 are cultured and detected according to the culture and detection conditions in step (c), and the results are as Figure 5 shown. The ManNAc yield of the recombinant strain MAO1 reaches 1.5 g / L, which is 25.0% higher than that of the control strain MA1. In addition, the ManNAc yield of the recombinant strain MAO2 is 75.0% higher than that of the recombinant strain MA1, up to 2.1 g / L. The above experimental results prove the application feasibility of the spatially separated orthogonal translation system.

[0118] Primer sequences:

[0119] yesZ-U-F TCTCACCCGCCACTGCTTT

[0120] yesZ-U-R ACTGTATCATGGCGCTTGCTAGAGCGGATAACAATTTC

[0121] yesZ-D-F ACTGGGAAAACCCTCCGCATGAATACCGTGTGATT

[0122] yesZ-D-R AATGCTGTCTCCAGATGAAGAG

[0123] yesZ-Z-F GGCGCTTGCTAGAGCGGATAACAATTTCACACA

[0124] yesZ-Z-R GTCGTGACTGGGAAAACCCTCCGCATGAATA

[0125] Obviously, the above embodiments are merely examples for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A spatially separated orthogonal translation system, characterized in that, The orthogonal translation system is used for the translation of a target gene and includes: an aminoacyl-tRNA synthetase and a tRNA; thrombin and a thrombin-binding aptamer; A disordered protein for forming an artificial organelle, wherein the amino acid sequence of the disordered protein is MSKGP-(RGYGSPDG) n -GY or MSKGP-(RGSPYGDG) n -GY, wherein n is any integer from 15 to 30; a gene sequence encoding the thrombin-binding aptamer is fused to the end of the target gene, at least one codon of the target gene is replaced with an amber stop codon or the target gene contains at least one site of O-methyl-L-tyrosine mutation, and the aminoacyl-tRNA synthetase, thrombin are fusion-expressed with a disordered protein.

2. The orthogonal translation system according to claim 1, characterized in that The orthogonal translation system further includes a signal peptide fusion-expressed with the disordered protein.

3. The orthogonal translation system according to claim 1, wherein The thrombin-binding aptamer includes the sequence shown in SEQ ID NO.

3.

4. A polynucleotide encoding the orthogonal translation system according to any one of claims 1-3.

5. A recombinant cell containing the orthogonal translation system according to any one of claims 1-3.

6. Use of the orthogonal translation system according to any one of claims 1-3, the polynucleotide according to claim 4, or the recombinant cell according to claim 5 in the specific translation of a target gene.

7. The application according to claim 6, characterized in that, The use is: culturing a host bacterium containing the target gene and the orthogonal translation system under conditions containing O-methyl-L-tyrosine.

8. A method for producing N-acetylmannosamine, characterized in that, Under the culture conditions containing O-methyl-L-tyrosine, fermentation production is carried out using a recombinant bacterium containing the target gene and the orthogonal translation system according to any one of claims 1-3, and the target gene includes a coding gene of N-acetylglucosamine epimerase or a mutant thereof, and the mutant contains at least one site of O-methyl-L-tyrosine mutation relative to the wild type; The N-acetylglucosamine epimerase mutant is obtained by mutating the amino acid sequence shown in SEQ ID NO.14, and the mutations are: mutating methionine at position 15 to leucine, asparagine at position 41 to aspartic acid, glutamic acid at position 57 to glutamine, glycine at position 169 to asparagine, glutamine at position 234 to leucine, threonine at position 236 to asparagine, threonine at position 269 to tryptophan, asparagine at position 291 to lysine, serine at position 312 to alanine, arginine at position 323 to glutamic acid, glutamine at position 343 to proline, and valine at position 373 to O-methyl-L-tyrosine.

9. The method according to claim 8, wherein The recombinant bacterium uses Bacillus subtilis as the host bacterium, including or not including the following modifications: overexpressing the gene encoding glucosamine acetylase GNA1 , and / or inactivating the β-galactosidase gene yesZ .

10. A mutant N-acetylglucosamine epimerase, characterized in that, The N-acetylglucosamine epimerase mutant is obtained by mutating the amino acid sequence shown in SEQ ID NO. 14, and the mutations are as follows: mutating methionine at the 15th position to leucine, asparagine at the 41st position to aspartic acid, glutamic acid at the 57th position to glutamine, glycine at the 169th position to asparagine, glutamine at the 234th position to leucine, threonine at the 236th position to asparagine, threonine at the 269th position to tryptophan, asparagine at the 291st position to lysine, serine at the 312th position to alanine, arginine at the 323rd position to glutamic acid, glutamine at the 343rd position to proline, and mutating valine at the 373rd position to O-methyl-l-tyrosine.

Images