MiRNA targeting arg1 and use thereof

Abstract

The application provides a kind of miRNA for targeting ARG1 and its application, belong to gene therapy technical field.The application discloses the application of hsa-miR-4521 for targeting ARG1 in preparation of medicine for preventing and / or treating type 2 diabetes vascular endothelial dysfunction, hsa-miR-4521 can inhibit type 2 diabetes vascular endothelial dysfunction, and circHMGCS1 can be combined hsa-miR-4521 to regulate the expression of target gene ARG1, and then regulate the occurrence of type 2 diabetes vascular endothelial dysfunction, and the medicine related to type 2 diabetes vascular endothelial dysfunction has extensive application prospect, based on the application, the drug or detection kit for treating or preventing the disease related to type 2 diabetes vascular endothelial dysfunction can be prepared.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene therapy, and particularly relates to an ARG1-targeting miRNA and an application thereof. Background Art

[0002] Cardiovascular disease is the leading cause of morbidity and mortality in patients with type 2 diabetes. It is estimated that the incidence of cardiovascular disease in patients with type 2 diabetes is at least two to four times higher than in non-diabetic patients. Type 2 diabetes leads to metabolic abnormalities, including chronic hyperglycemia, dyslipidemia, insulin resistance, and inflammation. These processes ultimately lead to vascular endothelial damage, disrupting the maintenance of vascular homeostasis and permeability, thereby promoting the development of cardiovascular disease. Endothelial dysfunction is considered to be the root cause of vascular complications at all stages of type 2 diabetes. However, there is currently a lack of diagnostic methods for preventing and controlling the occurrence of endothelial dysfunction in type 2 diabetes, and there is no recognized effective treatment for endothelial dysfunction in type 2 diabetes.

[0003] Arginase (ARG) is a binuclear manganese metalloenzyme that catalyzes the hydrolysis of L-arginine to primarily produce L-ornithine and urea. Arginase has two isoforms, ARG1 and ARG2, present in vertebrates, including mammals. Although ARG1 and ARG2 share the same catalytic reaction, they are encoded by different genes and exhibit distinct immunological profiles. Elevated ARG1 activity in endothelial cells has been identified as an important contributor to endothelial dysfunction in patients with type 2 diabetes. This dysfunction has been attributed to excessive formation of reactive oxygen species (ROS) due to competition between ARG1 and eNOS for L-arginine. Consequently, oxidases or mitochondrial complexes are overactivated, leading to decreased NO levels and, in turn, endothelial dysfunction. Conversely, inhibition of ARG1 has been shown to significantly enhance endothelial function in patients with type 2 diabetes.

[0004] MicroRNAs (miRNAs) are a class of non-coding single-stranded RNA molecules containing 17-25 nucleotides, which post-transcriptionally regulate their target genes through the degradation or translational inhibition of complementary mRNAs. In this way, miRNAs regulate multiple physiological and pathological pathways of human diseases, including diabetes, cardiovascular disease, cancer and other diseases. Specifically, some miRNAs are involved in the development and function of beta cells, insulin secretion, and insulin resistance in the liver, skeletal muscle and adipose tissue, which play an important role in glucose homeostasis and the pathogenesis of diabetes. Changes in miRNA expression also affect the progression of diabetic complications in the kidney, retina and peripheral nerves. Since each miRNA has the potential to regulate multiple genes in biological processes such as cell proliferation, differentiation, apoptosis and development, it has been proven that the dysregulation of miRNAs affects many pathological pathways of diabetic complications. At the same time, many miRNAs have been found to be increased in the plasma or urine of diabetic patients, making them circulating biomarkers associated with type 2 diabetes. SUMMARY

[0005] The purpose of the present application is to provide a miRNA targeting ARG1 and its application, which can inhibit type 2 diabetes vascular endothelial dysfunction, and circHMGCS1 can competitively bind the expression of the target gene ARG1 regulated by hsa-miR-4521, thereby regulating the occurrence of type 2 diabetes vascular endothelial dysfunction.

[0006] The present application provides a use of a hsa-miR-4521 targeting ARG1 in the preparation of a medicament for preventing and / or treating type 2 diabetes vascular endothelial dysfunction.

[0007] Preferably, the hsa-miR-4521 targets the 3'UTR region of ARG1.

[0008] Preferably, the hsa-miR-4521 comprises hsa-miR-4521 and / or a mimic of hsa-miR-4521.

[0009] Preferably, the sequence of the primer of the mimic of hsa-miR-4521 is shown in SEQ ID No. 1 and SEQ ID No. 2.

[0010] The present invention also provides the use of hsa-miR-4521, an hsa-miR-4521 mimetic, an hsa-miR-4521 inhibitor and / or circHMGCS1 in the preparation of a medicament for regulating vascular endothelial dysfunction in type 2 diabetes. The sequences of the primers for the hsa-miR-4521 mimetic are shown in SEQ ID No. 1 and SEQ ID No. 2; the sequence of the hsa-miR-4521 inhibitor is shown in SEQ ID No. 3.

[0011] Preferably, the regulation includes at least one of the following:

[0012] (1) Overexpression of hsa-miR-4521 inhibits the occurrence of vascular endothelial dysfunction in type 2 diabetes, and inhibits hsa-miR-4521 from promoting the occurrence of vascular endothelial dysfunction in type 2 diabetes;

[0013] (2) Overexpression of hsa-miR-4521 restores the NO content and eNOS activity in the vascular endothelium of type 2 diabetes, inhibits the expression of ROS and adhesion factors, and inhibiting the expression of hsa-miR-4521 can inhibit the NO content and eNOS activity in the vascular endothelium of type 2 diabetes, and promote the expression of ROS and adhesion factors;

[0014] (3) overexpression of hsa-miR-4521 inhibits the expression of ARG1, and inhibition of hsa-miR-4521 promotes the expression of ARG1;

[0015] (4) The circHMGCS1 competitively binds to the hsa-miR-4521, promoting the occurrence of vascular endothelial dysfunction.

[0016] The present invention also provides the use of hsa-miR-4521, an hsa-miR-4521 mimetic, an hsa-miR-4521 inhibitor and / or circHMGCS1 in preparing a reagent for regulating ARG1 expression, wherein the sequences of the primers for the hsa-miR-4521 mimetic are shown in SEQ ID No. 1 and SEQ ID No. 2; the sequence of the hsa-miR-4521 inhibitor is shown in SEQ ID No. 3.

[0017] Preferably, the regulation includes: overexpressing hsa-miR-4521 to significantly reduce the expression of ARG1, and inhibiting hsa-miR-4521 to significantly increase the expression of ARG1.

[0018] The present invention also provides a drug for preventing and / or treating vascular endothelial dysfunction in type 2 diabetes, comprising hsa-miR-4521 and / or a mimetic of hsa-miR-4521;

[0019] The sequences of the primers of the hsa-miR-4521 mimetic are shown in SEQ ID No.1 and SEQ ID No.2.

[0020] The present invention also provides a kit for detecting vascular endothelial dysfunction in type 2 diabetes, comprising reagents for detecting ARG1 and / or circHMGCS1.

[0021] Beneficial Effects: The present invention demonstrates the role of hsa-miR-4521 targeting ARG1 in vascular endothelial dysfunction in type 2 diabetes, particularly the use of hsa-miR-4521 targeting ARG1 in the preparation of a drug for treating vascular endothelial dysfunction in type 2 diabetes. The present invention discovers for the first time that hsa-miR-4521 can target and bind to the 3'UTR region of ARG1, inhibiting the occurrence of vascular endothelial dysfunction in type 2 diabetes. Overexpression of hsa-miR-4521 can restore NO content and eNOS activity in the vascular endothelium of type 2 diabetes, inhibit the expression of ROS and adhesion factors, and inhibit hsa-miR-4521 can inhibit NO content and eNOS activity in the vascular endothelium of type 2 diabetes, and promote the expression of ROS and adhesion factors. Overexpression of hsa-miR-4521 can significantly reduce ARG1 expression, and inhibition of hsa-miR-4521 can significantly increase ARG1 expression. Overexpression of circHMGCS1 significantly promotes endothelial dysfunction, while overexpression of hsa-miR-4521 can counteract this effect and restore the original function of HUVECs. CircHMGCS1 competitively binds to hsa-miR-4521, inhibiting the development of endothelial dysfunction. This invention provides a new therapeutic strategy and new target for the treatment of endothelial dysfunction in type 2 diabetes. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a graph showing the experimental results of hsa-miR-4521 inhibiting high-glucose and high-fat-induced vascular endothelial dysfunction;

[0023] Figure 2 This is a graph showing the experimental results of hsa-miR-4521 targeting downregulation of ARG1;

[0024] Figure 3 This is a diagram showing the results of a validation experiment demonstrating that circHMGCS1 can act as a ceRNA to competitively bind to hsa-miR-4521;

[0025] Figure 4 This is a diagram showing the experimental results that circHMGCS1 can act as a ceRNA to competitively bind to hsa-miR-4521 and regulate vascular endothelial dysfunction;

[0026] Figure 5 This is the plasmid map of the pmirGLO vector. DETAILED DESCRIPTION

[0027] The present invention provides an application of hsa-miR-4521 targeting ARG1 in the preparation of a medicament for preventing and / or treating vascular endothelial dysfunction in type 2 diabetes.

[0028] The hsa-miR-4521 of the present invention preferably targets the 3'UTR region of ARG1. The hsa-miR-4521 of the present invention preferably includes hsa-miR-4521 and / or hsa-miR-4521 mimics (hsa-miR-4521-mimic), wherein the hsa-miR-4521 sequence is preferably as shown in SEQ ID No. 21: GCUAAGGAAGUCCUGUGCUCAG.

[0029] In the present invention, the sequences of the primers of the hsa-miR-4521 mimetic are preferably as shown in SEQ ID No. 1 (GAGCACAGGACUUCCUUAGCUU) and SEQ ID No. 2 (GCUAAGGAAGUCCUGUGCUCAG).

[0030] The examples of the present invention confirm that the hsa-miR-4521 can target and bind to the 3'UTR region of ARG1, and can inhibit the occurrence of vascular endothelial dysfunction in type 2 diabetes; overexpression of hsa-miR-4521 can restore the NO content and eNOS activity in the vascular endothelium of type 2 diabetes, and inhibit the expression of ROS and adhesion factors; inhibition of hsa-miR-4521 can inhibit the NO content and eNOS activity in the vascular endothelium of type 2 diabetes, and promote the expression of ROS and adhesion factors; overexpression of hsa-miR-4521 can significantly reduce the expression of ARG1, and inhibition of hsa-miR-4521 expression can significantly increase the expression of ARG1. Therefore, the hsa-miR-4521 or hsa-miR-4521 mimetic can be used to prevent and / or treat vascular endothelial dysfunction in type 2 diabetes.

[0031] The present invention also provides the use of hsa-miR-4521, an hsa-miR-4521 mimetic, an hsa-miR-4521 inhibitor (hsa-miR-4521-inhibitor) and / or circHMGCS1 (hsa_circ_0008621) in the preparation of a medicament for regulating vascular endothelial dysfunction in type 2 diabetes. The sequences of the primers for the hsa-miR-4521 mimetic are shown in SEQ ID No. 1 and SEQ ID No. 2; the sequence of the hsa-miR-4521 inhibitor is shown in SEQ ID No. 3 (CUGAGCACAGGACUUCCUUAGC).

[0032] The regulation of the present invention preferably includes at least one of the following:

[0033] (1) Overexpression of hsa-miR-4521 inhibits the occurrence of vascular endothelial dysfunction in type 2 diabetes, and inhibits hsa-miR-4521 from promoting the occurrence of vascular endothelial dysfunction in type 2 diabetes;

[0034] (2) Overexpression of hsa-miR-4521 restores the NO content and eNOS activity in the vascular endothelium of type 2 diabetes, inhibits the expression of ROS and adhesion factors, and inhibiting the expression of hsa-miR-4521 can inhibit the NO content and eNOS activity in the vascular endothelium of type 2 diabetes, and promote the expression of ROS and adhesion factors;

[0035] (3) overexpression of hsa-miR-4521 inhibits the expression of ARG1, and inhibition of hsa-miR-4521 promotes the expression of ARG1;

[0036] (4) The circHMGCS1 competitively binds to the hsa-miR-4521, promoting the occurrence of vascular endothelial dysfunction.

[0037] The present invention also provides the use of hsa-miR-4521, an hsa-miR-4521 mimetic, an hsa-miR-4521 inhibitor and / or circHMGCS1 in preparing a reagent for regulating ARG1 expression, wherein the sequences of the primers for the hsa-miR-4521 mimetic are shown in SEQ ID No. 1 and SEQ ID No. 2; the sequence of the hsa-miR-4521 inhibitor is shown in SEQ ID No. 3.

[0038] The regulation, preferably, comprises that overexpression of hsa-miR-4521 significantly reduces the expression of ARG1, and inhibition of hsa-miR-4521 significantly increases the expression of ARG1. In the embodiments of the present application, overexpression of hsa-miR-4521 can inhibit the expression of ARG1 in HUVEC, and inhibition of hsa-miR-4521 can promote the expression of ARG1 in HUVEC; overexpression of hsa-miR-4521 can significantly reduce the expression of ARG1, and inhibition of hsa-miR-4521 can significantly increase the expression of ARG1; overexpression of circHMGCS1 significantly promotes vascular endothelial dysfunction, and overexpression of hsa-miR-4521 can offset this effect and restore the original function of HUVEC, and circHMGCS1 competitively binds hsa-miR-4521 to promote the occurrence of vascular endothelial dysfunction.

[0039] The present application also provides a drug for preventing and / or treating type 2 diabetes vascular endothelial dysfunction, comprising hsa-miR-4521 and / or a mimic of hsa-miR-4521.

[0040] The sequences of the primers for amplifying the mimic of hsa-miR-4521 are shown in SEQ ID No. 1 and SEQ ID No. 2.

[0041] The present application also provides a kit for detecting type 2 diabetes vascular endothelial dysfunction, comprising reagents for detecting ARG1 and / or circHMGCS1.

[0042] The method for detecting ARG1 and / or circHMGCS1 is not particularly limited in the present application, for example, qRT-PCR is used to detect the expression of ARG1 mRNA in the embodiments, the sequence of the upstream primer of ARG1 is shown in SEQ ID No. 22: 5'-TTCTCAAAGGGACAGCCACG-3', and the sequence of the downstream primer is shown in SEQ ID No. 23: 5'-CGCTTGCTTTTCCCACAGAC-3'; Western Blot is used to detect the expression of ARG1 protein level, and the antibody used is Abcam with the item number ab315110.

[0043] In order to further illustrate the present application, the following embodiments will describe in detail a miRNA targeting ARG1 and its application provided by the present application, but they should not be understood as limiting the scope of protection of the present application.

[0044] The test methods or test methods described in the following embodiments are all conventional methods unless otherwise specified; the reagents and materials are all obtained from conventional commercial channels or prepared by conventional methods unless otherwise specified.

[0045] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0046] Currently, cardiovascular disease caused by type 2 diabetes is the leading cause of death in patients with the disease. Endothelial dysfunction is a key initiating factor in the development of cardiovascular disease. Therefore, it is crucial to delve deeper into the pathogenesis of endothelial dysfunction in type 2 diabetes, identify new therapeutic targets, and develop effective therapeutic drugs.

[0047] Definition and Use of Terms

[0048] Individual: In the present invention, the term "individual" refers to mammals, including but not limited to rats, mice, non-human primates, humans, dogs, cats, horses, cattle, sheep, pigs, and goats, preferably humans or mice.

[0049] Treatment: The term "treatment" as used in the present invention refers to reducing the degree of vascular endothelial dysfunction in type 2 diabetes, or curing and normalizing it, or slowing down the progression of vascular endothelial dysfunction in type 2 diabetes.

[0050] The present invention demonstrates through the following examples that hsa-miR-4521 can inhibit ARG1 expression and significantly alleviate vascular endothelial dysfunction in type 2 diabetes.

[0051] Example 1 Verification of the function of hsa-miR-4521

[0052] The mature sequence information of hsa-miR-4521 was obtained from the miRBase database. hsa-miR-4521 mimics / miR-NC / hsa-miR-4521 inhibitors / miR-NC inhibitors were designed and synthesized by Beijing Qingke Biotechnology Co., Ltd. The sequence information is shown in Table 1.

[0053] Table 1 hsa-miR-4521 related sequence information

[0054]

[0055] HUVECs were cultured in 6-well plates and transfected with hsa-miR-4521 mimics / miR-NC / hsa-miR-4521 inhibitors / miR-NC inhibitors when the cell density reached 80%. 48 hours after cell transfection, cellular RNA was extracted and hsa-miR-4521 expression was detected by RT-qPCR. The results showed that the mimics / inhibitor groups significantly increased / inhibited hsa-miR-4521 expression compared with the miR-NC / miR-NC inhibitor groups ( Figure 1AB). Subsequently, the function of hsa-miR-4521 in HUVEC was verified using NO content detection kit, eNOS activity detection kit and DHE fluorescent probe. The results showed that overexpression / inhibition of hsa-miR-4521 could significantly inhibit / promote the dysfunction of HUVEC ( Figure 1 Western Blot and RT-qPCR assays revealed that overexpression / inhibition of hsa-miR-4521 could significantly inhibit / increase the expression of cell dysfunction-related genes ET-1, ICAM1, and VCAM1 ( Figure 1 The primer sequence information is shown in Table 2.

[0056] Table 2 RT-qPCR primer sequence information

[0057]

[0058] Example 2 Exploring the molecular regulatory mechanism of hsa-miR-4521

[0059] The downstream target genes of hsa-miR-4521 were predicted using the TargetScan database, and the ARG1 gene was screened out. Studies have shown that ARG1 can compete with eNOS to hydrolyze L-arginine, thereby leading to eNOS uncoupling, causing excessive formation of ROS, inhibiting the generation of NO levels, and thus leading to endothelial dysfunction. The wild-type and mutant ARG1 3'UTR sequences were constructed into the pmirGLO vector (purchased from Shanghai Newpro Biotechnology Co., Ltd., catalog number V011462#, plasmid map as shown in Figure 2). Figure 5 shown) on NheI and SalI ( Figure 2 Middle A), the results of the dual luciferase assay showed that compared with the control group, overexpression / inhibition of hsa-miR-4521 could significantly reduce / increase luciferase activity, while there was no significant difference after site mutation, indicating that hsa-miR-4521 could target and bind to the ARG1 3'UTR region ( Figure 2 Middle B).

[0060] Further Western blot and RT-qPCR detection revealed that overexpression / inhibition of hsa-miR-4521 could significantly reduce / increase the expression of ARG1 ( Figure 2 In addition, the miRanda database revealed that circHMGCS1 can act as a ceRNA to competitively bind to hsa-miR-4521 and regulate downstream target genes ( Figure 2 E), and RT-qPCR detection showed that overexpression of circHMGCS1 could significantly increase the expression of ARG1 ( Figure 2 (Medium FG).

[0061] The primers used are as follows:

[0062] ARG1-F (SEQ ID No. 24): TTCTCAAAGGGACAGCCACG;

[0063] ARG1-R (SEQ ID No. 25): CGCTTGCTTTTCCCACAGAC;

[0064] β-actin-F (SEQ ID No. 26): CTCACCATGGATGATGATATCGC;

[0065] β-actin-R (SEQ ID No. 27): CACATAGGAATCCTCTGACCCA.

[0066] The wild-type and mutant circHMGCS1 and hsa-miR-4521 binding site sequences were constructed into the NheI and SalI residues of the pmirGLO vector, respectively. Figure 2 As shown in Figure E, the results of the dual luciferase assay showed that compared with the control group, overexpression / inhibition of hsa-miR-4521 could significantly reduce / increase luciferase activity, while there was no significant difference after site mutation, indicating that hsa-miR-4521 could interact with circHMGCS1 ( Figure 3 In addition, the results of RNA pull-down, RNA CO-IP and RNA-FISH experiments showed that circHMGCS1 and miR-4521 could bind to each other and exist in the cytoplasm ( Figure 3 BD). Further RT-qPCR detection revealed that overexpression of circHMGCS1 could significantly reduce the expression of hsa-miR-4521 ( Figure 3 E). The vector construction gene information is shown in Table 3.

[0067] The primer sequences used for RT-qPCR are as follows:

[0068] hsa-miR-4521-F (SEQ ID No. 28): CGGCTAAGGAAGTCCTGTGC;

[0069] hsa-miR-4521-R(SEQ ID No.29):CGCAGGGTCCGAGGTATTC;

[0070] U6-F (SEQ ID No. 30): ATTGGAACGATACAGAGAAGATT;

[0071] U6-R (SEQ ID No. 31): GGAACCGTCACGAATTTG.

[0072] Table 3 Vector construction gene sequence information

[0073]

[0074]

[0075]

[0076] Example 3 circHMGCS1 competitively binds to hsa-miR-4521 to regulate vascular endothelial function

[0077] To further confirm that circHMGCS1 functions as a ceRNA for hsa-miR-4521, we overexpressed circHMGCS1 and hsa-miR-4521 and performed complementation experiments. Functional assays were performed using a NO content detection kit (Beyotime: S0019), an eNOS activity detection kit (Beyotime: S0025), and a DHE fluorescent probe (Beyotime: S0063).

[0078] The results showed that overexpression of circHMGCS1 significantly promoted HUVEC dysfunction, while overexpression of hsa-miR-4521 could offset this effect and restore the original function of HUVEC ( Figure 4 Further Western blot and RT-qPCR detection revealed that the expression changes of ARG1 and adhesion factors ET-1, ICAM1 and VCAM1 were consistent with the results of functional tests ( Figure 4 (EG).

[0079] The present invention found that hsa-miR-4521 can inhibit the occurrence of HUVEC dysfunction, and circHMGCS1 can competitively bind to hsa-miR-4521 to regulate the expression of the target gene ARG1, thereby affecting the expression of endothelial function signaling molecules.

[0080] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Use of hsa-miR-4521 targeting ARG1 in the preparation of a medicament for preventing and / or treating vascular endothelial dysfunction in type 2 diabetes, characterized in that: The hsa-miR-4521 includes hsa-miR-4521 and / or hsa-miR-4521 mimics, the sequences of the hsa-miR-4521 mimics are shown in SEQ ID No.1 and SEQ ID No.2, and the nucleotide sequence of the hsa-miR-4521 is shown in SEQ ID No.

21.

2. The application according to claim 1, characterized in that The hsa-miR-4521 targets the 3'UTR region of ARG1.

3. Use of hsa-miR-4521 and / or a mimetic of hsa-miR-4521 in the preparation of a medicament for regulating vascular endothelial dysfunction in type 2 diabetes, characterized in that: The sequences of the hsa-miR-4521 mimics are shown in SEQ ID No.1 and SEQ ID No.2; the nucleotide sequence of the hsa-miR-4521 is shown in SEQ ID No.

21.

4. The application according to claim 3, characterized in that The regulation includes at least one of the following: (1) Overexpression of hsa-miR-4521 inhibits the occurrence of vascular endothelial dysfunction in type 2 diabetes; (2) Overexpression of hsa-miR-4521 restored NO content and eNOS activity in the vascular endothelium of type 2 diabetic patients and inhibited the expression of ROS and adhesion factors; (3) Overexpression of hsa-miR-4521 inhibits the expression of ARG1.

Images