An engineered bacterium for producing L-homoserine by fermentation, and its construction method and application

Abstract

The present invention discloses an engineering bacterium for producing L-homoserine by fermentation, and a construction method and application thereof, and relates to the field of genetic engineering technology. The construction method includes taking Escherichia coli as a starting strain, introducing an expression vector expressing a thrA mutant gene, an expression vector overexpressing a ppc gene, and an expression vector overexpressing an asd gene, knocking out the thrB gene, the tdh gene, the ltaE gene, and the tdcB gene, and constructing the steps of obtaining the engineering bacterium. The engineering bacterium constructed by the present invention can reduce the amount of threonine, an auxotrophic amino acid, in the fermentation process of L-homoserine, thereby reducing the fermentation cost, and has important industrial application value.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to an engineering bacterium for producing L-homoserine by fermentation, and a construction method and application thereof. Background Art

[0002] L-homoserine (2-amino-4-hydroxybutyric acid) is a precursor of methionine, lysine and threonine, and participates in a variety of physiological and biochemical reactions and multiple biological metabolic processes in the body, and has important physiological functions and application values. L-homoserine is also an important platform compound, which is used as a raw material or intermediate to synthesize a variety of chemical products and is widely used in the fields of food, cosmetics, medicine and feed. At present, most of the commercially available glufosinate ammonium is a mixture of D and L types, but only L-glufosinate ammonium has herbicidal activity. L-homoserine can be used to synthesize L-glufosinate ammonium, reduce the amount and cost of herbicides, and reduce harm to soil and crops. Therefore, L-homoserine is used to synthesize the new pesticide L-glufosinate ammonium, which has broad market prospects.

[0003] At present, the synthesis methods of L-homoserine are mainly chemical method and biological enzyme method. The chemical method uses relatively expensive L-methionine as raw material, uses iodomethane or bromomethane with serious biological toxicity as methylating agent, and generates sulfide, which pollutes the environment. The biological enzyme method uses pyruvic acid and aldehyde compounds as raw materials, and reacts to obtain homoserine under the common catalysis of aldolase, formate dehydrogenase and amino acid dehydrogenase, and also needs to use toxic raw materials (formaldehyde and formic acid) and expensive coenzymes. Microbial fermentation has many advantages such as low cost, mild conditions and less environmental pollution, and is the preferred process for producing various amino acids.

[0004] At present, the metabolic engineering transformation strategy for producing L-homoserine by fermentation mainly includes the enhanced expression of aspartate kinase feedback inhibition mutant gene thrA or lysC, L-aspartate semialdehyde dehydrogenase gene asd, pyruvate carboxylase gene pyc or phosphoenolpyruvate carboxylase gene ppc, etc. After knocking out the gene thrB of homoserine degradation metabolic pathway, the engineered bacteria are threonine and isoleucine auxotrophic. Since isoleucine can be produced by threonine metabolism, the accumulation of isoleucine will feedback inhibit the activity of threonine deaminase expressed by ilvA gene. Therefore, the homoserine fermentation process only needs to add threonine to maintain normal cell growth. However, Escherichia coli also has degradation pathways other than IlvA, which consumes threonine and increases the amount of amino acids required to maintain the growth of engineered bacteria, thereby increasing the fermentation cost. The present invention intends to develop new L-homoserine engineering bacteria to reduce the amount of threonine, a nutritional deficiency amino acid, in the homoserine fermentation process, and reduce the fermentation cost. Summary of the invention

[0005] The purpose of the present invention is to provide an engineered bacterium for producing L-homoserine by fermentation, and a construction method and application thereof, so as to solve the problems existing in the above-mentioned prior art. The engineered bacterium can reduce the amount of threonine, an auxotrophic amino acid, used in the L-homoserine fermentation process, thereby reducing the fermentation cost and having important industrial application value.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a method for constructing an engineered bacterium for producing L-homoserine by fermentation, comprising the steps of taking Escherichia coli as a starting strain, introducing an expression vector expressing a thrA mutant gene, an expression vector overexpressing a ppc gene and an expression vector overexpressing an asd gene, and completely or partially knocking out the thrB gene, the tdh gene, the ltaE gene and the tdcB gene to construct the engineered bacterium;

[0008] The nucleotide sequence of the thrA mutant gene is obtained by mutating the bases at 1297-1299 bp of the nucleotide sequence shown in SEQ ID NO.1 to bases encoding arginine;

[0009] The nucleotide sequence of the ppc gene is shown in SEQ ID NO.2;

[0010] The nucleotide sequence of the asd gene is shown in SEQ ID NO.3;

[0011] The nucleotide sequence of the thrB gene is shown in SEQ ID NO.4;

[0012] The nucleotide sequence of the tdh gene is shown in SEQ ID NO.20;

[0013] The nucleotide sequence of the ltaE gene is shown in SEQ ID NO.31;

[0014] The nucleotide sequence of the tdcB gene is shown in SEQ ID NO.42.

[0015] Furthermore, the Escherichia coli is Escherichia coli K12 MG1655.

[0016] The present invention also provides an engineering bacterium for producing L-homoserine by fermentation, which is constructed according to the above construction method.

[0017] The present invention also provides the use of the above-mentioned engineering bacteria in the fermentation production of L-homoserine.

[0018] The present invention also provides a method for producing L-homoserine by fermentation, comprising the step of producing L-homoserine by fermentation using the above-mentioned engineering bacteria.

[0019] The present invention also provides a method for reducing the amount of threonine used in the L-homoserine fermentation process, comprising the step of using the above-mentioned engineered bacteria to ferment and produce L-homoserine.

[0020] Further, the fermentation medium used in the fermentation production includes the following components: 20.0 g / L glucose, 15.0 g / L ammonium sulfate, 2.0 g / L potassium dihydrogen phosphate, 2.0 g / L magnesium sulfate heptahydrate, 2.0 g / L yeast powder, 2.0 g / L corn steep liquor, 0.3 g / L threonine, 0.05 g / L FeSO4·7H2O and 0.05 g / L MnSO4·4H2O;

[0021] The glucose stock solution used for feeding in the fermentation production comprises the following components: 600 g / L glucose and 12 g / L threonine.

[0022] The present invention discloses the following technical effects:

[0023] The present invention constructs an engineered bacterium for producing L-homoserine by fermentation by completely or partially knocking out the threonine degradation pathway genes tdcB, ltaE and / or tdh other than ilvA of Escherichia coli. The engineered bacterium can reduce the amount of threonine, an auxotrophic amino acid, in the L-homoserine fermentation process, thereby reducing the fermentation cost and having important industrial application value. DETAILED DESCRIPTION

[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0025] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0026] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0027] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0028] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0029] Unless otherwise specified in the following examples, the technical means used in the examples are conventional means well known to those skilled in the art and commonly used instruments and reagents on the market. References may be made to Molecular Cloning Experiment Guide (3rd Edition) (Science Press), Microbiology Experiment (4th Edition) (Higher Education Press) and the manufacturer's instructions of corresponding instruments and reagents.

[0030] The strains and vectors used in the present invention can be purchased from commercial and publicly available strains and plasmid collections, including Escherichia coli K12 MG1655: ATCC number 700926; pACYC184 plasmid: NEB, product catalog number E4152S; plasmid pcas9 purchased from Addgene, item number 62225; plasmid pTargetF purchased from Addgene, item number 62226.

[0031] The construction methods of the engineered bacteria E. coli MG1655ΔthrB / pCas and E. coli MG1655ΔthrB used in the following examples have been disclosed in Chinese patent application publication CN116925992A, and the examples of the present invention will not be repeated here.

[0032] Example 1 Construction of expression vector pACYC184-thrA-ppc-asd

[0033] Using the E. coli MG1655 genome as a template, upstream fragment primers H1 and H2, and downstream fragment primers H3 and H4 were used, and the upstream and downstream fragments of thrA (the thrA gene sequence is shown in SEQ ID NO.1) were amplified using Novozymes Phanta Flash high-fidelity DNA polymerase. The upstream and downstream fragments of thrA were recovered by gel excision and these two fragments were used as templates. The end primers H1 and H4 were used to obtain the gene thrA introduced with mutations by overlapping primers H2 and primers H3 by overlapping PCR (overlap PCR). G433R The promoter PJ23105 was introduced by primer H1.

[0034] After the PCR reaction is completed, the PCR product is detected by gel electrophoresis, and the gel is cut to recover the band of the correct size and purified for later use.

[0035] The pACYC184 plasmid and the amplified thrA fragment were double-digested with Xba I and HindIII restriction endonucleases, and the gene fragments after digestion were recovered using a gel recovery kit. The digested pACYC184 plasmid and the thrA fragment were ligated with T4 ligase. PL , transformed into DH5α competent cells, screened positive transformants after subculture, extracted plasmids and sequenced for verification, and the plasmid pACYC184-thrA with the correct sequence was further connected to the ppc gene.

[0036] H1:GC TCTAGA TTTACggctagctcagtcctaggtactatgctagcTTTTCGACCAAAGGTAACGAG (SEQ ID NO.5), the underlined sequence is the XbaI restriction enzyme recognition site, and the sequence in italics is the promoter PJ23105;

[0037] H2:CGTTCAGAAGATCTTCTGAGCAATGGCGACA (SEQ ID NO. 6);

[0038] H3:TGTCGCCATTGCTCAGAGATCTTCTGAACG (SEQ ID NO.7);

[0039] H4:CCC AAGCTT AGACTCCTAACTTCCATGAGA (SEQ ID NO. 8), the underlined sequence is the HindIII restriction enzyme recognition site;

[0040] H5:CCC AAGCTT ACATTTCCATAAGTTACGCTT (SEQ ID NO. 9), the underlined sequence is the HindIII restriction enzyme recognition site;

[0041] H6:AA GATATC GTGTTAGAACAGAAGTATTTCAG (SEQ ID NO. 10), the underlined sequence is the EcoRV restriction enzyme recognition site;

[0042] H7:GC TCTAGA GACTTTCTGCGTGCTAACA (SEQ ID NO. 11), the underlined sequence is the XbaI restriction enzyme recognition site;

[0043] H8:GC TCTAGA TCCTGTATTACGCACTAACA (SEQ ID NO. 12), the underlined sequence is the XbaI restriction enzyme recognition site.

[0044] Phanta Flash ultra-fidelity DNA polymerase PCR reaction system is shown in Table 1:

[0045] Table 1

[0046] Element volume 2× DNA polymerase buffer 25μL Forward primer (10 μmol / L) 2μL Reverse primer (10 μmol / L) 2μL DNA template 0.5μL Sterile deionized water Make up to 50 μL

[0047] The PCR reaction conditions are shown in Table 2:

[0048] Table 2

[0049]

[0050]

[0051] Using E. coli MG1655 genome as template, primers H5, H6 and Novozyme Phanta Flash high-fidelity DNA polymerase were used to amplify the ppc gene (sequence shown in SEQ ID NO. 2). After the PCR reaction was completed, the PCR product was detected by gel electrophoresis, and the band of the correct size was recovered by gel excision and purified for later use.

[0052] Hind III and EcoR V restriction endonucleases were used to double-digest the pACYC184-thrA plasmid and the ppc fragment, respectively, and the digested fragments were recovered again using a gel recovery kit; the double-digested pACYC184-thrA plasmid fragment and the ppc gene fragment were connected with T4 ligase and transformed into DH5α competent cells. After subculture, positive transformants were screened, the plasmid was extracted and sequenced for verification, and the correct recombinant vector pACYC184-thrA-ppc was obtained, and the asd gene was further connected.

[0053] Using the E. coli MG1655 genome as a template, primers H7 and H8 and Novozyme Phanta Flash high-fidelity DNA polymerase were used to amplify the asd gene (sequence shown in SEQ ID NO. 3). After the PCR reaction was completed, the PCR product was detected by gel electrophoresis, and the band of the correct size was recovered by gel excision and purified for later use.

[0054] The pACYC184-thrA-ppc plasmid and the amplified asd gene were digested separately using XbaI restriction endonuclease, and the digested fragments were recovered using a gel recovery kit again; the digested pACYC184-thrA-ppc was treated with alkaline phosphatase, and then the double-digested asd gene fragments were ligated with T4 ligase and transformed into DH5α competent cells. After subculture, positive transformants were screened, and the plasmid was extracted for sequencing verification to obtain the correct recombinant vector pACYC184-thrA-ppc-asd.

[0055] Example 2 Knockout of thrB gene

[0056] The gene mutation kit from NEB was used ( Site-Directed Mutagenesis Kit, catalog number E0552S), primers H9 and H10 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence was TGGTTCTGACGGCAGCTTAT (SEQ ID NO.13), targeting the thrB gene (sequence shown in SEQ ID NO.4). The mutated pTargetF was named pTargetFtB.

[0057] Using the E. coli MG1655 genome as a template, primers H11, H12 and Novozymes Phanta Flash high-fidelity DNA polymerase were used to amplify the upstream sequence of the thrB gene, and primers H13 and P14 were used to amplify the downstream sequence of the thrB gene. The upstream and downstream fragments were recovered by gel excision and these two fragments were used as templates. The gene editing template DonortB for knocking out thrB was obtained by overlapping PCR using primers H11 and H14 at both ends.

[0058] The pCas9 plasmid was transformed into MG1655 coated with 50 mg / L kanamycin resistance plates and cultured at 30°C to obtain strain MG655 / pCas9. The MG1655 / pCas9 bacterial lawn was picked up and placed in a 500 mL shake flask containing 50 mL of LB containing kanamycin and cultured at 30°C and 220 rpm. When the culture medium OD 600 When the OD was 0.2, arabinose was added to a final concentration of 10 mM for induction. 600Prepare competent cells when the p-value is 0.4. Take 2 μL of pTargetFtB plasmid and 10 μL of DonortB template DNA, electrotransform into E.coliMG655 / pCas9 competent cells, apply double-resistant plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and culture at 30°C. Use primers H11 and H14 to identify single colonies with bases 91-795 knocked out in the thrB gene. Select the single colonies with the correct sequencing, add 0.2 mM IPTG to culture, eliminate the pTargetFtB plasmid, and obtain the engineered bacteria E.coli MG1655△thrB / pCas. Further inoculate with non-resistant LB liquid culture medium, culture at 37°C for 12 hours, dilute and apply on LB plates, and obtain the engineered bacteria E.coli MG1655△thrB that eliminates the pCas9 plasmid.

[0059] H9:GCAGCTTATGTTTTAGAGCTAGAAATAGC (SEQ ID NO. 14);

[0060] H10:CGTCAGAACCAGACTAGTATTATACCTAGG(SEQ ID NO.15);

[0061] H11:GGCAATGACGTTACAGCT (SEQ ID NO.16);

[0062] H12:CTTGTCACACAGAGCGAACAATGCACCATCAACAGGTGTCA (SEQ ID NO. 17);

[0063] H13: TGACACCTGTTGATGGTGCATTGTTCGCTCTGTGTGACAAG (SEQ ID NO. 18);

[0064] H14: TTAGTTTTCCAGTACTCGTG (SEQ ID NO. 19).

[0065] Example 3 Knockout of tdh gene

[0066] The nucleotide sequence of the tdh gene referred to in the present invention is shown in SEQ ID NO. 20. The sequence of the tdh gene after knockout in this example is shown in SEQ ID NO. 21.

[0067] Using genetic mutations Site-Directed Mutagenesis kit, designed primers HS31 and HS32 to mutate pTargetF vector. The mutated N20 sequence was ATCCGTAAAACAGCCATCTG (SEQ ID NO.22), targeting tdh gene. The mutated pTargetF was named pTargetFtdh.

[0068] Using the E. coli MG1655 genome as a template, primers HS33, HS34 and Novozymes Phanta Flash high-fidelity DNA polymerase were used to amplify the upstream sequence of the tdh gene, and primers HS35 and HS36 were used to amplify the downstream sequence of the tdh gene. The upstream and downstream fragments were recovered by gel excision and these two fragments were used as templates. The gene editing template Donortdh for knocking out the tdh gene was obtained by overlapping PCR using primers HS33 and HS36 at both ends.

[0069] E. coli MG1655△thrB / pCas was selected and placed in a 500 mL shake flask containing 50 mL of LB containing kanamycin and cultured at 30°C and 220 rpm. 600 When the OD was 0.2, arabinose was added to a final concentration of 10 mM for induction. 600 Prepare competent cells when the p-value is 0.4. Take 2 μL of pTargetFtdh plasmid and 10 μL of Donortdh template DNA, electrotransform into E.coli MG655△thrB / pCas competent cells, apply double-resistant plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and culture at 30°C. Use primers HS37 and HS38 to identify single colonies with bases 70 to 492 of the tdh gene knocked out. Select the single colonies with the correct sequencing, add 0.2 mM IPTG to culture, eliminate the pTargetFtB plasmid, and obtain the engineered bacteria E.coliMG1655△thrBtdh / pCas. Further inoculate with non-resistant LB liquid culture medium, culture at 37°C for 12 hours, dilute and apply on LB plates, and obtain the engineered bacteria E.coli MG1655△thrBtdh that eliminates the pCas9 plasmid.

[0070] HS31:AGCCATCTGGTTTTAGAGCTAGAAATAGC (SEQ ID NO. 23);

[0071] HS32:GTTTTACGGATGACTAGTATTATACCTAGG (SEQ ID NO. 24);

[0072] HS33: CGTGCAGTAGAAGCATTTAC (SEQ ID NO. 25);

[0073] HS34:CAGAAACCAGCACATCTTCGAGTTCCGGTACAGGAAC (SEQ ID NO. 26);

[0074] HS35:GTTCCTGTACCGGAACTCGAAGATGTGCTGGTTTCTG (SEQ ID NO. 27);

[0075] HS36:GCCATCACGTCATTGAGA (SEQ ID NO. 28);

[0076] HS37:GTATTCGTACCCAGATGTCT(SEQ ID NO.29);

[0077] HS38:ACATTTCCAGACCGACATC (SEQ ID NO. 30).

[0078] Example 4 Knockout of the ltaE gene

[0079] The nucleotide sequence of the ltaE gene referred to in the present invention is shown in SEQ ID NO. 31. The sequence of the ltaE gene after knockout in this example is shown in SEQ ID NO. 32.

[0080] Using genetic mutations Site-Directed Mutagenesis kit, designed primers HS41 and HS42 to mutate pTargetF vector. The mutated N20 sequence was ATCCAGCGGTAGCGTGCCGT (SEQ ID NO.33), targeting the ltaE gene. The mutated pTargetF was named pTargetFltaE.

[0081] Using the E. coli MG1655 genome as a template, primers HS43 and HS44 were used to amplify the upstream sequence of the ltaE gene using Novozymes Phanta Flash high-fidelity DNA polymerase, and primers HS45 and HS46 were used to amplify the downstream sequence of the ltaE gene. The upstream and downstream fragments were recovered by gel excision and these two fragments were used as templates. The gene editing template DonorltaE for knocking out the ltaE gene was obtained by overlapping PCR using primers HS43 and HS46 at both ends.

[0082] E. coli MG1655△thrBtdh / pCas was selected and placed in a 500 mL shake flask containing 50 mL of LB containing kanamycin and cultured at 30°C and 220 rpm. 600When the OD was 0.2, arabinose with a final concentration of 10 mM was added for induction. 600 Prepare competent cells when the p-value is 0.4. Take 2 μL pTargetFltaE plasmid and 10 μL DonorltaE template DNA, electrotransform into E.coli MG655△thrBtdh / pCas competent cells, apply double resistance plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and culture at 30°C. Use primers HS47 and HS48 to identify single colonies with bases 210 to 563 of the ltaE gene knocked out. Select the single colonies with correct sequencing, add 0.2 mM IPTG for culture, eliminate the pTargetFtB plasmid, and obtain the engineered bacteria E.coliMG1655△thrBtdhltaE / pCas. Further inoculate into LB liquid culture medium without resistance, culture at 37°C for 12 hours, dilute and apply on LB plates, and obtain the engineered bacteria E.coli MG1655△thrBtdhltaE that eliminates the pCas9 plasmid.

[0083] HS41: AGCGTGCCGTGTTTTAGAGCTAGAAATAGC (SEQ ID NO. 34);

[0084] HS42:ACCGCTGGATGACTAGTATTATACCTAGG (SEQ ID NO. 35);

[0085] HS43: GATTGATTTACGCATGATAC (SEQ ID NO. 36);

[0086] HS44:GGCAAATGGTGAACGAATCACAGTGACTGAGCAGAGC (SEQ ID NO. 37);

[0087] HS45:GCTCTGCTCAGTCACTGTGATTCGTTCACCATTTGCC (SEQ ID NO. 38);

[0088] HS46: AGCGTTGTCGTGGTCTTC (SEQ ID NO. 39);

[0089] HS47:GCGAAAACAAACTGGCTAAG (SEQ ID NO. 40);

[0090] HS48: GTCCTGACGCATCACATC (SEQ ID NO. 41).

[0091] Example 5 Knockout of tdcB gene

[0092] The nucleotide sequence of the tdcB gene referred to in the present invention is shown in SEQ ID NO. 42. The sequence of the tdcB gene after knockout in this example is shown in SEQ ID NO. 43.

[0093] Using genetic mutations Site-Directed Mutagenesis kit, designed primers HS51 and HS52 to mutate pTargetF vector. The mutated N20 sequence was GTTTGAAAATATGCAGCGTA (SEQ ID NO.44), targeting tdcB gene. The mutated pTargetF was named pTargetFtdcB.

[0094] Using the E. coli MG1655 genome as a template, primers HS53 and HS54 were used to amplify the upstream sequence of the tdcB gene using Novozymes Phanta Flash high-fidelity DNA polymerase, and primers HS55 and HS56 were used to amplify the downstream sequence of the tdcB gene. The upstream and downstream fragments were recovered by gel excision and these two fragments were used as templates. The gene editing template DonortdcB for knocking out the tdcB gene was obtained by overlapping PCR using primers HS53 and HS56 at both ends.

[0095] E. coli MG1655△thrBtdhltaE / pCas was selected and placed in a 500 mL shake flask containing 50 mL of LB containing kanamycin and cultured at 30°C and 220 rpm. 600 When the OD was 0.2, arabinose with a final concentration of 10 mM was added for induction. 600 Prepare competent cells when the p-value is 0.4. Take 2 μL of pTargetFtdcB plasmid and 10 μL of DonortdcB template DNA, electrotransform into E.coli MG655△thrBtdh ltaE / pCas competent cells, spread on double-resistant plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and culture at 30°C. Use primers HS57 and HS58 to identify single colonies with bases 128 to 454 of the tdcB gene knocked out. Select the single colonies with the correct sequencing, add 0.2 mM IPTG to culture, eliminate the pTargetFtB plasmid, and obtain the engineered bacteria E.coli MG1655△thrBtdhltaEtdcB / pCas. The cells were further inoculated into LB liquid culture medium without resistance, cultured at 37°C for 12 h, and diluted and coated on LB plates to obtain the engineered bacteria E. coli MG1655△thrBtdhltaEtdcB that eliminated the pCas9 plasmid.

[0096] HS51:ATGCAGCGTAGTTTTAGAGCTAGAAATAGC (SEQ ID NO. 45);

[0097] HS52:ATTTTCAAACGACTAGTATTATACCTAGG (SEQ ID NO. 46);

[0098] HS53:tgCATATTACATACGATCTG (SEQ ID NO. 47);

[0099] HS54:CACTTTCGGATCATCGTAAGCACCTTTGCAACGTTCACTA (SEQ ID NO. 48);

[0100] HS55:TAGTGAACGTTGCAAAGGTGCTTACGATGATCCGAAAGTG (SEQ ID NO. 49);

[0101] HS56:GCCAATAACACGAATGGTC (SEQ ID NO.50);

[0102] HS57: GTCGGTTACGGTTACCTAC (SEQ ID NO. 51);

[0103] HS58:GGAGACATCACAACCATC (SEQ ID NO. 52).

[0104] Example 6

[0105] The vector pACYC184-thrA-ppc-asd constructed in Example 1 was transformed into the above-mentioned engineering bacteria E. coli MG1655△thrB, E. coli MG1655△thrBtdh, E. coli MG1655△thrBtdhltaE and E. coli MG1655△thrBtdhltaEtdcB, respectively, to obtain the engineering bacteria E. coli MG1655△thrB / pACYC184-thrA-ppc-asd, E. coli MG1655△thrBtdh / pACYC184-thrA-ppc-asd, E. coli MG1655△thrBtdhltaE / pACYC184-thrA-ppc-asd and E. coli MG1655△thrBtdhltaEtdcB / pACYC184-thrA-ppc-asd, used for fermentation production of L-homoserine.

[0106] Example 7 Fermentation experiment of L-homoserine engineering bacteria

[0107] Seed shake flask culture process: streak the engineered bacteria stored in -80℃ cryopreservation tubes on LB plates, place in a 37℃ incubator for 12h, pick a single colony and inoculate it into a test tube containing 3mL LB medium, place it in a 37℃ shaker, and incubate it at 180rpm for 12h. Take the bacterial liquid at a 3% inoculation rate and inoculate it into a 500mL shake flask containing 50mL seed medium, place it in a 37℃ shaker, and incubate it at 220rpm for 5h. The resulting bacterial culture liquid is used as the seed for the upper tank fermentation.

[0108] LB medium: peptone 10 g / L, yeast powder 5 g / L and sodium chloride 10 g / L.

[0109] Fermentation medium formula: glucose 20.0 g / L, ammonium sulfate 15.0 g / L, potassium dihydrogen phosphate 2.0 g / L, magnesium sulfate heptahydrate 2.0 g / L, yeast powder 2.0 g / L, corn steep liquor 2.0 g / L, threonine 0.3 g / L, FeSO4.7H2O 0.05 g / L and MnSO4.4H2O0.05 g / L.

[0110] Glucose stock solution 1: 600 g / L glucose and 16 g / L threonine.

[0111] Glucose stock solution 2: 600 g / L glucose and 12 g / L threonine.

[0112] The fermentation conditions of the fermenter were controlled as follows: 3% inoculation rate was added to the fermenter with 3L fermentation liquid, and the fermentation temperature was controlled at 37°C by a heating jacket and cooling water; air was introduced to provide dissolved oxygen, and a mixture of oxygen and air was introduced at a ratio of 1:1 when necessary, and the rotation speed and dissolved oxygen signal were cascaded to control the dissolved oxygen to 50%; 25% ammonia water was added to adjust the pH to maintain at 6.8; glucose stock solution 1 or 2 was continuously added to maintain the residual sugar concentration at 5-10 g / L.

[0113] The samples taken out during the fermentation process were diluted and the absorbance at a wavelength of 600nm was measured. Another part of the sample was placed in a centrifuge, centrifuged at 12000×g for 2min, the precipitate was discarded, the supernatant was diluted 50 times, and the residual sugar concentration was detected using a biosensor analyzer SBA-40D. The remaining supernatant was used to detect the production of L-homoserine, and the production of L-homoserine amino acids was detected by HPLC. Mobile phase A: pure acetonitrile. Mobile phase B: 50mM sodium acetate buffer, pure water, acetonitrile, triethylamine (82.8:17:0.2) acetic acid to adjust the pH to 4.9. Derivatization reagent I: 0.2700g CNBF (3,5-dinitro-4-chloro-trifluoromethylbenzene) / 10mL acetonitrile; buffer II: pH9.0 H3BO3-Na2B4O7 buffer: 0.2mol / L boric acid and 0.05mol / L borax solution. After preparation, it needs to be stored away from light. Derivatization method: dilute the sample to 0.1-2g / L, 100μL sample, 300μL derivatization reagent I, 500μL buffer II. Place in a mixer, 60℃, 400rpm, and react in the dark for 1h. After the reaction, filter through a 0.22μm syringe organic filter membrane and keep it for detection. Detection conditions: chromatographic column: J&K C18-H Column (4.6×250mm, 5μm); flow rate: 0.80mL / min; column temperature: 30℃; injection volume: 10.0μL; detection wavelength: 260nm.

[0114] At 12h in the exponential growth phase, the engineered bacteria with three threonine degradation pathways knocked out grew better than the control bacteria under two glucose storage conditions with different threonine contents; and when the threonine dosage was reduced (stock 2), the OD of the fermentation liquid of the engineered bacteria E. coli MG1655△thrBtdhltaEtdcB / pACYC184-thrA-ppc-asd at 12h was 600 The value is equivalent to that of the E. coli MG1655△thrB / pACYC184-thrA-ppc-asd engineering bacteria under the condition of high threonine dosage (stock solution 1), and the final homoserine yield is also basically the same. This shows that the present invention reduces the threonine supplement dosage in the fermentation process by 25%, and has the benefit of significantly saving fermentation costs.

[0115] Table 3 Fermentation results of L-homoserine engineering bacteria

[0116]

[0117] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for constructing an engineered bacterium for producing L-homoserine by fermentation, characterized in that: Including using E. coli as the starting strain, introducing expression thrA Expression vectors and overexpression of mutant genes ppc Gene expression vectors and overexpression asd Gene expression vector, all knockout tB Gene, td Gene, oeLh Genes and tD Gene, the step of constructing the engineered bacteria; Said thrA The nucleotide sequence of the mutant gene is obtained by mutating the bases at 1297-1299 bp of the nucleotide sequence shown in SEQ ID NO.1 to bases encoding arginine; Said ppc The nucleotide sequence of the gene is shown in SEQ ID NO.2; Said asd The nucleotide sequence of the gene is shown in SEQ ID NO.3; Said tB The nucleotide sequence of the gene is shown in SEQ ID NO.4; Said td The nucleotide sequence of the gene is shown in SEQ ID NO.20; Said oeLh The nucleotide sequence of the gene is shown in SEQ ID NO.31; Said tD The nucleotide sequence of the gene is shown in SEQ ID NO.42; The Escherichia coli is Escherichia coli K12 MG1655.

2. An engineered bacterium for producing L-homoserine by fermentation, obtained by the construction method according to claim 1.

3. Use of the engineered bacteria as claimed in claim 2 in the fermentation production of L-homoserine.

4. A method for producing L-homoserine by fermentation, characterized in that: The method comprises the step of using the engineered bacteria according to claim 2 to ferment and produce L-homoserine.

5. A method for reducing the amount of threonine in the L-homoserine fermentation process, characterized in that: The method comprises the step of using the engineered bacteria according to claim 2 to ferment and produce L-homoserine.

6. The method according to claim 5, characterized in that: The fermentation medium used in the fermentation production includes the following components: 20.0 g / L glucose, 15.0 g / L ammonium sulfate, 2.0 g / L potassium dihydrogen phosphate, 2.0 g / L magnesium sulfate heptahydrate, 2.0 g / L yeast powder, 2.0 g / L corn steep liquor, 0.3 g / L threonine, 0.05 g / L FeSO4·7H2O and 0.05 g / L MnSO4·4H2O; The glucose stock solution used for feeding in the fermentation production comprises the following components: 600 g / L glucose and 12 g / L threonine.

Images