Application of Phloretin in the Fight against Insects

Abstract

The present application belongs to the field of molecular detection and plant breeding, and specifically relates to the application of a protease in the hydrolysis preparation of phloretin and plant insect resistance. The present application generates phloretin by regulating the expression or enzyme activity of BGLU13.1‑A or BGLU13.1‑a, which can be used for plant pest control and resistance breeding.

Description

[0001] This application is a divisional application of the Chinese invention patent application with application date of October 19, 2023 and application number CN202311357388.6. Technical Field

[0002] The present application belongs to the field of biomolecule detection and breeding technology, and specifically relates to the application of a protease in the hydrolysis preparation of phloretin and in plant insect resistance. Background Art

[0003] Phloretin belongs to the flavonoid aglycone, which is harmful to plant growth and development and cannot be accumulated in large quantities in plants (Dare et al. 2017; Gutierrez et al. 2018). Therefore, in plants, phloretin is glycosylated under the catalysis of corresponding glycosyltransferases to form less toxic phloretin or trilobatin, which are then transported to the vacuole for storage (Gosch et al., 2010; Dare et al. 2017; Wang et al., 2020). However, when plants are subjected to adverse stress, the phloretin and trilobatin stored in their bodies will be released and hydrolyzed under the catalysis of corresponding hydrolases to produce phloretin.

[0004] Insect pests are one of the important factors that restrict crop yield and quality. At present, my country mainly relies on chemical pesticides to control insect pests, but chemical control is costly and has a significant negative impact on the ecological environment. Therefore, if the natural product phloretin can be used, or the metabolism of phloretin in plants can be regulated by genetic engineering to improve the insect resistance of plants, it will be of great significance and application value for green biological control of plant pests or biological breeding.

[0005] In view of this, this application is filed. Summary of the invention

[0006] In response to the above technical problems, the present application has discovered through intensive research that the proteases BGLU13.1-A and BGLU13.1-a have plant anti-insect activity. Among them, BGLU13.1-A can hydrolyze phlorizin to produce phlorizin, and BGLU13.1-a can hydrolyze trilobatin to produce phlorizin. The present application also found that for different plants, compared with phlorizin and trilobatin, phlorizin has significant anti-insect activity. Therefore, the present application hydrolyzes phlorizin and trilobatin to produce phlorizin by regulating the expression or enzyme activity of BGLU13.1-A and BGLU13.1-a, or directly applies phlorizin or phlorizin-containing biological pesticides, which has important application value for plant pest control and resistance breeding.

[0007] This application specifically provides the following technical solutions:

[0008] The present application first provides a protease having the following amino acid sequence:

[0009] It has at least 90% homology to SEQ ID NO. 3 or 4 and is derived from the genus Malus.

[0010] In some embodiments, the proteases are BGLU13.1-A and BGLU13.1-a, and the sequences are shown in SEQ ID NO. 3 or 4, respectively.

[0011] In some embodiments, the protease sequence can achieve a change in the catalytic substrate by mutation, such as when the six amino acids Asn346Phe350Gln356Ala414Ala415Ala615 in BGLU13.1-A are all mutated to the six amino acids Thr322Leu326Lys332Val390Thr391Glu591 in BGLU13.1-a, or Thr322Leu326Lys332Val390Thr391Glu591 in BGLU13.1-a. When all six amino acids hr391Glu591 mutate to the six amino acids Asn346Phe350Gln356Ala414Ala415Ala615 in BGLU13.1-A, the activities of the two proteins will also be exchanged, that is, MBGLU13.1-A (the mutated BGLU13.1-A) loses the activity of hydrolyzing phlorizin and gains the activity of hydrolyzing trilobatin, and MBGLU13.1-a (the mutated BGLU13.1-a) also changes from hydrolyzing trilobatin to hydrolyzing phlorizin.

[0012] Therefore, the protease of the present application also includes the following sequence:

[0013] In some embodiments, the protease sequence is as shown in SEQ ID NO.3, and the six amino acids 346Asn350Phe 356Gln 414Ala 415Ala 615Ala of SEQ ID NO.3 are replaced by Thr Leu Lys ValThr Glu respectively.

[0014] In some other embodiments, the protease sequence is as shown in SEQ ID NO.4, and the six amino acids 322Thr326Leu 332Lys 390Val 391Thr 591Glu of SEQ ID NO.4 are replaced by Asn Phe Gln AlaAla Ala respectively.

[0015] The present application also provides an isolated nucleic acid encoding any of the above-mentioned proteases.

[0016] In some preferred embodiments, the nucleic acid sequence is as shown in SEQ ID NO.1 or 2.

[0017] The present application also provides a recombinant vector, which comprises the above-mentioned nucleic acid.

[0018] In some embodiments, the vector is an expression vector.

[0019] In some preferred embodiments, the expression vector comprises a prokaryotic expression vector or a eukaryotic expression vector;

[0020] In some specific preferred embodiments, the expression vector includes but is not limited to: prokaryotic expression vector Pet28a, overexpression vector pCambia 2300 or silencing vector PK7WIWG2D.

[0021] The present application also provides a recombinant cell or a recombinant microorganism, comprising the above-mentioned recombinant vector.

[0022] In some specific embodiments, the recombinant cell or recombinant microorganism is Escherichia coli BL21 (DE3) or Agrobacterium GV3101.

[0023] The present application also provides any of the following applications of the above-mentioned protease:

[0024] 1) Application in the hydrolysis preparation of phloretin;

[0025] 2) Application in plant insect resistance;

[0026] 3) Application in plant breeding.

[0027] Furthermore, the insect resistance includes resistance to two-spotted spider mites, resistance to leaf rollers and resistance to red spider mites.

[0028] In addition, since the present application firstly discovered the application of phloretin in plant resistance, the present application also provides any of the following applications of phloretin:

[0029] 1) Application in plant insect resistance;

[0030] 2) Application in plant breeding.

[0031] Furthermore, the insect resistance includes but is not limited to resistance to two-spotted spider mites, resistance to leaf rollers and resistance to red spider mites.

[0032] The present application also provides a method for improving the insect resistance of plants, the method comprising any of the following steps:

[0033] 1) by regulating the expression amount or enzyme activity of the above-mentioned protease in the plant body, and improving the hydrolysis of phlorizin and trilobatin to produce phlorizin to achieve insect resistance;

[0034] or,

[0035] 2) Directly applying phloretin or a biopesticide containing phloretin to the plant.

[0036] Preferably, the improving the insect-resistant activity of plants mentioned above is to increase the insect-resistant activity of plants; and the regulating the expression level or enzyme activity of the protease mentioned above is to increase and regulate the expression level or enzyme activity of the protease mentioned above.

[0037] Compared with the prior art, this application has at least the following advantages:

[0038] 1) The present application discovered that proteases BGLU13.1-A and BGLU13.1-a can hydrolyze phlorizin and trilobatin into phlorizin.

[0039] 2) In this application, the protease is stably expressed in apple GL3. The overexpressed transgenic plants show stronger resistance to pests than the wild type, while the silenced plants have reduced resistance to pests compared to the wild type. Therefore, it has important application value in plant pest control and resistance breeding.

[0040] 3) The present application found that phloretin can significantly improve the insect resistance of plants compared with phloretin and trilobatin by exogenous phloretin treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0042] Figure 1 The results of ion chromatography of crude protein extracted from Fuji flower petals as described in Example 1;

[0043] Figure 2 The results of hydrophobic chromatography of crude protein extracted from Fuji flower petals as described in Example 1;

[0044] Figure 3 The results of gel filtration chromatography of crude protein extracted from Fuji flower petals as described in Example 1;

[0045] Figure 4 The SDS-PAGE gel electrophoresis result described in Example 1;

[0046] Figure 5 The results of the determination of the hydrolysis activity of the BGLU13.1-A and BGLU13.1-a recombinant proteins on phlorizin and trilobatin described in Example 1;

[0047] Figure 6 Modeling the protein homology of BGLU13.1-A and BGLU13.1-a described in Example 2;

[0048] Figure 7 The results of the determination of the hydrolysis activity of the mutated BGLU13.1-A and BGLU13.1-a recombinant proteins on phlorizin and trilobatin described in Example 2;

[0049] Figure 8 The detection of RNA levels of the overexpression and silencing BGLU13.1-A transgenic lines described in Example 3;

[0050] Fig. 9 is the number of two-spotted spider mites after infection by the two-spotted spider mites described in Example 3;

[0051] Fig.10 is the number of red spider mites after the red spider mites infection described in Example 3;

[0052] Fig.11 is the consumption of leaves eaten by the leaf roller described in Example 3;

[0053] Fig.12 The effect of the exogenously applied compound on the survival rate of two-spotted spider mite as described in Example 4;

[0054] Fig.13 The effect of the exogenously applied compound on the survival rate of red spider mites as described in Example 4;

[0055] Fig.14 This is the effect of the exogenously applied compound as described in Example 4 on the leaf consumption by leaf rollers. DETAILED DESCRIPTION

[0056] The technical solution of the present application will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are part of the embodiments of the present application, rather than all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present application.

[0057] The following terms or definitions are provided only to help understand the present application. These definitions should not be construed as having a scope less than that understood by those skilled in the art.

[0058] Unless otherwise defined below, the meaning of all technical terms and scientific terms used in the specific embodiments of the present application is intended to be the same as those generally understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain the present application.

[0059] As used in this application, the terms "comprises", "comprising", "having", "containing" or "involving" are inclusive or open-ended and do not exclude other unrecited elements or method steps. The term "consisting of" is considered a preferred embodiment of the term "comprising". If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists of only these embodiments.

[0060] When referring to a singular noun an indefinite or definite article e.g. "a" or "an", "the" or "an" is used, this includes a plural of that noun.

[0061] The terms "approximately" and "substantially" in this application represent the accuracy range that can be understood by those skilled in the art to still ensure the technical effect of the feature in question. The term usually represents ±10% deviation from the indicated value, preferably ±5%.

[0062] In addition, the terms first, second, third, (a), (b), (c), and the like in the specification and claims are used to distinguish similar elements and are not necessarily required to describe a sequential or chronological order. It should be understood that the terms so used are interchangeable under appropriate circumstances, and the embodiments described in this application can be implemented in other sequences than those described or illustrated in this application.

[0063] The following are specific embodiments.

[0064] Example 1 Protease Allele Cloning and Prokaryotic Expression

[0065] The crude protein of Malus domestica Fuji petals was extracted and then ion chromatography ( Figure 1 )、Hydrophobic chromatography( Figure 2 ) and gel filtration chromatography ( Figure 3 ) for separation, during which the activity of each crude protein component in hydrolyzing phlorizin was detected, and the active target protein was gradually separated and purified. The protein band marked by the red dotted line ( Figure 4 ) and phlorizin hydrolysis activity trends are consistent ( Figure 3 ), so it was identified as the target protein.

[0066] The protein bands in lanes 5-6 with relatively few impurities and relatively high target proteins were selected for QE mass spectrometry analysis. The target protein MD03G1069500 ​​was identified based on the relevant information of the apple genome and named BGLU13.1 after functional annotation. The cDNA of different germplasm resources of the genus Malus was used as a template for amplification, and two sequences were obtained. The upstream and downstream sequences of the amplified genes proved that the two sequences were alleles of each other and were named BGLU13.1-A and BGLU13.1-a respectively. Specifically:

[0067] Primers were designed to amplify the target genes BGLU13.1-A and BGLU13.1-a, BGLU13.1-AF: ATGTTCAGACTTAACTCG; BGLU13.1-AR: TTATCCAAGGAAATATTTGAA; BGLU13.1-aF: ATGGCAGCCATCCACTC; BGLU13.1-aR: TTATCCAAGGAAATATTTGAA, and cDNAs of different germplasm resources of the genus Malus were used as templates for amplification and connected to the PMD-19T (Takara) vector for sequencing to obtain two sequences BGLU13.1-A and BGLU13.1-a. The specific gene sequences are shown in SEQ ID NO.1-2, and the encoded amino acid sequences are shown in SEQ ID NO.3-4.

[0068] SEQ ID NO.1 (BGLU13.1-A)

[0069]

[0070] SEQ ID NO.2(BGLU13.1-a)

[0071]

[0072] SEQ ID NO.3(BGLU13.1-A)

[0073] MFRLNSVPLPTLSQRSAMAAIHSIAAQSFLSLPNPKPRKRIAAHPKPILTSKLPKNPTFPRNKQKGRRVLNSAVKREECDVIPVQSSDSTDQQEGVVASRVESEAGDQGELVSQVGGFGASEGRLSFEGAGGFGSTGVGSERESEEFERPVEKLLTNIPSRYSSASLNRSSASLNRSSFPSGFVFGSASASYQYEGAWNEGGKGPSIWDNFTHQYPEKISDGSNGDVANDQYHRYKEDVKIMKDMGLDAYRFSISWSRLLPNGKLSGGVSKEGVQYYNNLINELQNKGIAPYVTIFHWDLPQALEEEYGGFLNRQIVNHFRDYAELCFKLFGDRVKHWITLNEPYNFINFGYASGQLAPGRCSAWQNLNCTGGDSATEPYIVAHHFLLAHAHAVEVYKTKYQASQEGVIGITLAANWFVPISNETRHQNAANRSLDFMFGWFMEPLTSGQYPHSMQVLVKERLPKFTEEESKLIKGSFDFVGMNYYTTHYSSDQPDNNSANPSFLTDACVFESTELNGVPIGPPAASSWLVIYPKGIREILLYAKHKYNNPVIYITENGMDEFDDPKLSLPQSLNDTHRIDYHYHHLDYLRKAIDDGVNVKGYFAWSLTDNFEWAAGYTLRFGFVYIDYNDGLKRHPKLSASWFKYFLG

[0074] SEQ ID NO.4(BGLU13.1-a)

[0075] .

[0076] The full-length CDS sequence of BGLU13.1 was further connected to the Pet28a vector by one-step cloning (Vazyme ligase-independent single fragment rapid cloning kit) and transformed into Escherichia coli BL21 (DE3) strain. The positive colonies were activated and induced with 0.5 mM IPTG for 24 h (18 °C, 120 rpm). The bacterial solution was centrifuged to remove the supernatant and the supernatant was removed using a buffer (50 mM NaH 2 PO 4 , 30 mM NaCl, 20 mM imidazole, pH adjusted to 8.0 with NaOH) and then 2 mg L -1 The lysozyme was incubated at 37°C for 30 min, frozen and thawed three times in liquid nitrogen, and centrifuged at 12,000 g for 10 min at 4°C. The supernatant was used to measure the enzyme activity.

[0077] Using the recombinant proteins of prokaryotically expressed BGLU13.1-A and BGLU13.1-a, the substrate phlorizin or trilobatin with a final concentration of 0.5 mM, 100 μL of enzyme solution, and 90 μL of citric acid buffer (100 mM, pH 6.0) were added to the enzymatic reaction solution. After mixing the components, incubate at 37 ° C for 20 minutes, and add 400 μL of methanol solution to terminate the reaction. Then, the reaction solution was centrifuged and filtered, and the amount of product phlorizin produced was analyzed by high performance liquid chromatography.

[0078] The results showed that BGLU13.1-A could hydrolyze phlorizin into phlorizin, but it did not hydrolyze trilobatin; whereas BGLU13.1-a did not hydrolyze phlorizin, but it could hydrolyze trilobatin into phlorizin ( Figure 5 ).

[0079] Example 2 Protease homology modeling and point mutation assay

[0080] The online software HHPred (https: / / toolkit.tuebingen.mpg.de / tools / hhpred) was used to complete the homology modeling of BGLU13.1-A and BGLU13.1-a proteins. The key active center for substrate binding was found through the three-dimensional protein structure model, and the amino acid difference sites near the active center of BGLU13.1-A and BGLU13.1-a were compared and found as the objects of point mutation.

[0081] The protein three-dimensional structures of BGLU13.1-A and BGLU13.1-a were predicted, and it was found that there were 6 amino acid differences near the active center of the two proteins, corresponding to Asn346Phe350Gln356Ala414Ala415Ala615 in BGLU13.1-A and Thr322Leu326Lys332Val390Thr391Glu591 in BGLU13.1-a ( Figure 6 ).

[0082] Through point mutation experiments, the six amino acid mutation sites between the two alleles were subjected to directed mutation, that is, the six amino acids in BGLU13.1-A were mutated to the six amino acids corresponding to BGLU13.1-a, or the six amino acids in BGLU13.1-a were mutated to the six amino acids corresponding to BGLU13.1-A. It was found that the activities of the two proteins would also be exchanged after the mutation, that is, MBGLU13.1-A (mutated BGLU13.1-A) lost the activity of hydrolyzing phlorizin and gained the activity of hydrolyzing trilobatin, and MBGLU13.1-a also changed from hydrolyzing trilobatin to hydrolyzing phlorizin ( Figure 7 ).

[0083] Example 3 Test on insect resistance of transgenic apples

[0084] 1) Construction of apple genetic transformation vector

[0085] Overexpression vector construction: The full-length CDS sequence of BGLU13.1-A was ligated to the pCambia 2300 vector by one-step cloning (Vazyme ligase-independent single fragment rapid cloning kit), and the target gene was transcribed by the 35S promoter.

[0086] Construction of silencing vector: The vector used for RNAi was PK7WIWG2D. The specific fragment of BGLU13.1-A was found in the NCBI database, and primers were designed to clone the specific fragment. The specific fragment was first connected to the intermediate vector pDONR 222 through BP reaction (GatewayBP Clonase, Invitrogen) by the Gate-way method, and then connected to the destination vector through LR reaction (Gateway LRClonase, Invitrogen).

[0087] The target gene BGLU13.1-A was overexpressed and silenced by RNA interference in GL-3 apple seedlings by Agrobacterium-mediated leaf disc transformation. The results showed that the target gene was upregulated to a certain extent in the six overexpression lines at the RNA level, and the expression of the target gene in the silenced line was also significantly reduced ( Figure 8 ).

[0088] 2) Experiment on changing gene expression to affect plant insect resistance

[0089] 1) Anti-two-spotted spider mite experiment

[0090] Two-spotted spider mites were raised on broad bean seedlings for 2-3 weeks, and then the broad bean seedlings with two-spotted spider mites were placed between wild-type and transgenic apple seedlings. After 10 days, the number of adult two-spotted spider mites on each apple seedling was counted, and the average number of two-spotted spider mites per leaf was used as the evaluation index.

[0091] 2) Anti-red spider test

[0092] Red spider mites were raised on broad bean seedlings for 2-3 weeks, and then the broad bean seedlings with red spider mites were placed between wild-type and transgenic apple seedlings. After 10 days, the number of red spider mites on each apple seedling was counted, and the average number of two-spotted spider mites per leaf was used as the evaluation index.

[0093] 3) Experiment on anti-leaf-roller

[0094] The 3rd to 4th mature leaves at the top of wild-type apple seedlings and transgenic seedlings were selected, and each leaf was weighed. The petiole was wrapped with wet cotton and placed in a glass culture dish. The second to third instar larvae of leaf rollers that had been starved for 2 hours were placed in the dish. After 6 hours, the degree of damage to the plants was observed, photographed and recorded, and the weight of the leaves was weighed to calculate the consumption.

[0095] The results showed that during the process of being infested by two-spotted spider mites, red spider mites and leaf rollers, the transgenic plants overexpressing BGLU13.1-A showed stronger resistance to two-spotted spider mites, red spider mites and leaf rollers than the wild type, while the silent plants had reduced resistance to two-spotted spider mites, red spider mites and leaf rollers compared with the wild type. The number of two-spotted spider mites and red spider mites on different transgenic plants and wild-type plants, as well as the consumption of leaves by leaf rollers before and after gnawing, were counted. Consistent with the trend of the degree of plant damage, the number of two-spotted spider mites, red spider mites and leaf rollers in the overexpressing materials were significantly lower than those in the wild type and silent plants ( Figure 9-11 ).

[0096] Example 4 Insect resistance test of external application of phloretin

[0097] 1) Anti-two-spotted spider mite experiment

[0098] The compound was dissolved in 50mM Tris-HCl (pH 7.4) buffer containing 20% ​​methanol, and the dissolved compound was evenly applied to healthy broad bean leaves with a No. 0 brush, and the final concentration was 1μg of phlorotrin per mg of fresh leaves, 1.5μg of phlorotrin per mg of fresh leaves, and 1.5μg of trilobatin per mg of fresh leaves. The petiole of the leaf was wrapped with wet cotton and placed in a clean bench to dry the applied solution. From the broad bean leaves where two-spotted spider mites were cultured in the early stage, the mites were gently transferred to the broad bean leaves coated with the compound with a No. 0 brush. Each leaf was inoculated with 20 mites, and the leaves were placed in a disposable culture dish in a light incubator. After 3 days, the survival rate of the two-spotted spider mites was counted, and the same volume of buffer was applied as a control.

[0099] Statistics show that compared with the control, several compounds have a certain degree of effect on the number of two-spotted spider mites, and phloretin treatment significantly reduces the survival rate of two-spotted spider mites ( Fig.12 ).

[0100] 2) Anti-red spider test

[0101] Similar to the experiment against two-spotted spider mites.

[0102] The results were consistent with those of two-spotted spider mites. Several compounds had some effects on the number of spider mites, and phloretin treatment significantly reduced the survival rate of spider mites ( Fig.13 ).

[0103] 3) Experiment on anti-leaf-roller

[0104] Healthy broad bean leaves were weighed and smeared with the above compounds, while the control was smeared with the same volume of buffer. The petiole was wrapped with wet cotton and placed in a glass culture dish. After drying, the third-instar larvae of leaf rollers that had been starved for 2 hours were placed in it. After 6 hours, the degree of damage to the plants was observed, photographed, and recorded, and the weight of the leaves was weighed to calculate the consumption.

[0105] The results were consistent with those for spider mites and red spiders. For the third-instar larvae of leaf rollers, phloretin treatment significantly reduced the consumption of broad bean leaves ( Fig.14 ),

[0106] The above results indicate that phloretin can be used for insect resistance of apples and soybeans, and plays an important role in the insect resistance of apples and soybeans.

[0107] The foregoing description of the specific exemplary embodiments of the present application is for the purpose of illustration and illustration. These descriptions are not intended to limit the present application to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present application and its practical application, so that those skilled in the art can realize and utilize the various exemplary embodiments of the present application and various selections and changes. The scope of the present application is intended to be limited by the claims and their equivalents.

Claims

1. Application of phloretin in plant resistance to two-spotted spider mites or red spiders.

2. A method for improving the activity of plants against two-spotted spider mites or red spider mites, It is characterized in that The method comprises the following steps: applying phloretin or a biological pesticide containing phloretin to plants in vitro.

Images