A method for inducing complex emblica with transgenic hairy roots without tissue culture

Abstract

The present invention relates to the field of crop genetic breeding, and in particular to an efficient induction method for obtaining a composite type of emblica with transgenic hairy roots without tissue culture. The present invention uses pretreated emblica seedlings as explants, infects the explants with Agrobacterium rhizogenes carrying a reporter gene and a target gene, and then transfers the infected explants to a culture matrix for culture; the emblica seedlings are emblica seedlings with a radicle length of ≥1 cm and <1.5 cm. Compared with traditional emblica genetic transformation methods, this method does not require tissue culture, improves transformation efficiency, shortens the transformation cycle, and also reduces consumables and manpower consumption.

Description

Technical Field

[0001] The invention relates to the field of crop genetic breeding, and in particular to an induction method for obtaining composite emblica with transgenic hairy roots without tissue culture. Background Art

[0002] Phyllanthus emblica L. is an economic fruit tree with great development potential for both medicine and food. Its mature fruits have biological activities such as anti-inflammatory, antioxidant and hypoglycemic. At the same time, Phyllanthus emblica is also an excellent afforestation tree species with low soil requirements. It is mostly planted in mountainous areas with poor soil in my country. It has a well-developed root system and strong adaptability to poor soil. It can effectively prevent soil erosion and improve soil fertility. In my country's widely distributed ecologically fragile areas such as dry river valleys and rocky mountains, Phyllanthus emblica has been widely used as a high-quality ecological and economic afforestation tree species. my country's Phyllanthus emblica breeding started late and faced many challenges. It is urgent to establish Phyllanthus emblica germplasm resources with broad-spectrum adaptability suitable for planting in various ecological environments in my country. The Phyllanthus emblica genetic transformation system is not only an important prerequisite for achieving molecular precision breeding, but also a key tool for studying the functions of genes related to stress resistance in Phyllanthus emblica. It is of great significance to the establishment of Phyllanthus emblica germplasm with broad-spectrum adaptability.

[0003] At present, there is no mature genetic transformation system for Phyllanthus emblica. The mainstream idea is to use Agrobacterium co-cultivation under tissue culture conditions to obtain transgenic plants. As early as 2002, Zhang Shouying had successfully induced tissue culture seedlings of Phyllanthus emblica using young shoots and stem segments as explants. However, under tissue culture conditions, the transformation system of obtaining transgenic plants using Agrobacterium co-cultivation with young tissues of Phyllanthus emblica as materials currently has the following defects:

[0004] 1. Long cycle and low conversion rate: Since polyphenol oxides in Phyllanthus emblica tissues have an inhibitory effect on Agrobacterium tumefaciens, the rooting speed is slow and the rooting rate is low during tissue culture propagation, which makes the conversion cycle too long and increases the risk of tissue infection and necrosis, resulting in low conversion efficiency;

[0005] 2. Occupies a large number of instruments and consumables: During tissue culture experiments, some instruments and equipment need to be used for a long time, such as clean benches and incubators. At the same time, each step also requires a large number of consumables, such as centrifuge tubes, culture dishes, and pipette tips.

[0006] 3. A large amount of human resources are required: The transformation process is relatively complicated and requires strict control of various parameters of the explant growth environment, including culture temperature, hormone concentration, lighting time, light intensity, and pH value; these operations need to be performed regularly by professional technicians and require a large amount of human resources.

[0007] Therefore, finding a simple, efficient and short-cycle method is of great significance for the breeding of Phyllanthus emblica. Summary of the invention

[0008] The purpose of the present invention is to provide an induction method for obtaining a composite type of Phyllanthus emblica with transgenic hairy roots without tissue culture, so as to solve the problems existing in the above-mentioned prior art. The efficient induction method provided by the present invention can quickly obtain transgenic Phyllanthus emblica, and also has the advantages of simplicity and high efficiency.

[0009] To achieve the above object, the present invention provides the following solutions:

[0010] The present invention provides a highly efficient induction method for obtaining composite emblica with transgenic hairy roots without tissue culture, comprising the following steps:

[0011] The pretreated Phyllanthus emblica seedlings are used as explants, the explants are infected with Agrobacterium rhizogenes carrying a reporter gene and a target gene, and then the infected explants are transferred to a culture medium for culture;

[0012] The emblica seedlings are emblica seedlings with a radicle length of ≥1 cm and <1.5 cm.

[0013] Preferably, the pretreatment includes the step of cutting off the underground part of the emblica seedlings at an oblique angle of 45° to form a smooth incision.

[0014] Preferably, the activation method of the Agrobacterium rhizogenes carrying the reporter gene and the target gene is to spread the Agrobacterium rhizogenes carrying the reporter gene and the target gene on a YEP solid culture medium containing 50 mg / L spectinomycin, and culture at 28° C. for 24 hours.

[0015] Preferably, the Agrobacterium rhizogenes is Agrobacterium rhizogenes K599.

[0016] Preferably, the infection is by injection.

[0017] The number of times of infection is 1 time.

[0018] Preferably, the culture matrix includes quartz sand and vermiculite; the volume ratio of the quartz sand to the vermiculite is 1:1.

[0019] Preferably, the culture matrix covers the wound site of the pretreated Phyllanthus emblica seedlings.

[0020] Preferably, after the infected explants are transferred to the culture matrix, a film-covering step is also included.

[0021] Preferably, the culture includes dark culture and light culture; the dark culture time is 2 days, and the temperature is 25°C; the light culture time is 15-25 days, and the temperature is 25°C.

[0022] The present invention discloses the following technical effects:

[0023] The invention establishes a tissue culture-free genetic transformation system of Phyllanthus emblica. The invention selects Phyllanthus emblica seedlings with a radicle length of 1-1.5 cm as experimental materials, utilizes the high vitality of the experimental materials, effectively improves the hairy root occurrence rate and the positive rate, and reduces the pollution rate of the materials. After 15-25 days of induction, the hairy roots can be induced to generate, and the hairy root occurrence rate and the positive rate are both over 80%. High-temperature sterilized quartz sand mixed with vermiculite is selected as a culture matrix, and sterile water is sprayed for moisture retention, thereby ensuring the water retention, air permeability and cleanliness of the matrix, and effectively improving the hairy root occurrence rate and the positive rate. , while reducing the contamination rate. This culture method is simple to operate, low-consumption, and can achieve high-throughput processing; the use of recombinant Agrobacterium rhizogenes K599 to induce the formation of hairy roots in the emblica seedlings avoids the complex process of tissue culture in the Agrobacterium tumefaciens transformation system; the use of solid YEP medium to activate the recombinant Agrobacterium rhizogenes K599 simplifies the vacuum infection steps required for liquid bacterial liquid, and prolongs the time for the bacterial body to infect the incision, simplifies the genetic transformation process, and increases the incidence and positive rate of hairy roots; the pretreatment method of emblica seedlings: cut the underground part of the seedlings at an angle of 45° to form a flat incision. Then, use a sterile needle to dip the recombinant Agrobacterium rhizogenes K599 and inject it into the seedlings. After injection infection, directly cover the infected seedling wound with the bacteria. The needle and incision treatment can ensure that the bacteria directly infect the seedling stele, thereby increasing the incidence and positive rate of hairy roots; the optimal activation condition of recombinant Agrobacterium rhizogenes K599 is: activation at 28℃ for 1d, under which the incidence and positive rate of hairy roots are both high; the use of Bar gene and GUS tag protein can achieve rapid and batch detection of positive hairy roots. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 The effect of different emblica seedling materials on the transformation efficiency of emblica; A is the hairy root occurrence rate; B is the positive rate;

[0026] Figure 2 The effect of different activation time of Agrobacterium rhizogenes K599 on the transformation efficiency of Phyllanthus emblica; A is the incidence of hairy roots; B is the positive rate; C is the length of root hairs;

[0027] Figure 3The figure is an experimental flow chart; A is the activation of recombinant Agrobacterium rhizogenes K599 (referred to as Agrobacterium); B is the germination of Phyllanthus emblica seeds by paper culture; C is the treatment of Phyllanthus emblica seedlings and infection with Agrobacterium rhizogenes K599; D is the wound covering bacteria; E is sand culture; F is dark culture; G is artificial incubator culture (light culture); H is the positive transgenic Phyllanthus emblica plant;

[0028] Figure 4 This is the electrophoresis diagram of Bar gene PCR detection;

[0029] Figure 5 It is a positive hairy root GUS staining detection picture; Among them, A is the control (wild-type Phyllanthus emblica seedlings), and B is the positive transgenic Phyllanthus emblica plant;

[0030] Figure 6 The results of microscopic observations; A is the result of stereoscopic observation of root hairs of the control (wild-type Phyllanthus emblica seedlings), and B is the result of stereoscopic observation of root hairs of positive transgenic Phyllanthus emblica plants;

[0031] Figure 7 This is the induction situation of Phyllanthus emblica seedlings as explants 15 days after germination. The red box part is the part that should produce root hairs after induction treatment. DETAILED DESCRIPTION

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0034] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0035] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0036] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0037] Example 1 Effect of different emblica seedling materials on emblica transformation efficiency

[0038] In order to study whether there are differences in the genetic transformation efficiency of different emblica seedling materials, we selected emblica seedlings with radicle lengths ranging from 0 cm < radicle length < 0.5 cm (0-0.5 cm), 0.5 cm ≤ radicle length < 1 cm (0.5-1 cm), 1 cm ≤ radicle length < 1.5 cm (1-1.5 cm), and 1.5 cm ≤ radicle length < 2 cm (1.5-2 cm) for experiments. The specific experimental steps are as follows:

[0039] (1) Agrobacterium rhizogenes transformation

[0040] The Agrobacterium rhizogenes used in the experiment was Agrobacterium rhizogenes K599, and the vector was pTF102 containing the GUS reporter gene. The competent cells of Agrobacterium rhizogenes K599 were transformed by freeze-thaw method, and then added to 0.5mL YEP liquid culture medium, cultured at 28℃ for 1h, and then about 50μL of bacteria were pipetted with a pipette and spread on a YEP solid plate containing 50mg / L spectinomycin, and cultured at 28℃ for 2d. A single colony was picked, and after sequencing and verification, it was stored at -80℃ for standby use, which was the recombinant Agrobacterium rhizogenes K599.

[0041] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0042] Recombinant Agrobacterium rhizogenes K599 was taken out from the -80°C refrigerator and inoculated on YEP solid medium containing 50 mg / L spectinomycin. It was cultured at 28°C for 24 h. The effective viable count of the culture was 10 9 CFU / mL.

[0043] (3) Paper culture germination of Phyllanthus emblica

[0044] After the seeds of Phyllanthus emblica were disinfected with 5% sodium hypochlorite, the seeds were germinated by paper culture. After the seeds germinated, the Phyllanthus emblica seedlings with different radicle lengths and good growth status were selected for further experiments.

[0045] (4) Inducing the formation of transgenic hairy roots

[0046] Afterwards, use a scalpel to cut off the underground part of the emblica seedlings at an angle of 45° to form a smooth incision. Then, use a sterile needle to pick up the recombinant Agrobacterium rhizogenes K599 and inject it to infect the seedlings. After injection infection, directly cover the infected seedling wounds with the bacteria. Then, the emblica seedlings into which the treated seedlings were transferred were transferred to the culture matrix, in which the volume ratio of quartz sand and vermiculite was 1:1, and both quartz sand and vermiculite were sterilized. During the culture process, ensure that the wound area of ​​the seedlings is covered by the matrix, and cover the seedlings with a layer of plastic wrap, and spray water several times a day to keep the matrix moist. First, culture at 25°C in the dark for 2 days and then move to an artificial climate box for light culture. The culture conditions are as follows: light time 12h / d, light intensity 800μmolm -2 s -1 , temperature 25℃, time 15d, induced the formation of capillary roots, and obtained transgenic Phyllanthus emblica composite plants.

[0047] Afterwards, the positive identification of transgenic plants was carried out, and the DNA in the hairy roots was extracted by the CTAB method. Specifically, after the hairy roots of the transgenic emblica composite plants were formed, about 0.05 g of hairy roots were taken into a 1.5 mL centrifuge tube, and 1000 μL CTAB (CTAB contains: 12.114 g / L Tris, 7.44 g / L EDTA-Na2, 81.9 g / L NaCl, 20 g / L CTAB, 10g / LPVP-40), after adding steel beads to the centrifuge tube, the sample was completely crushed, heated in a water bath at 65°C for 30min, allowed to stand and cool, an equal volume of chloroform: isoamyl alcohol mixture (the volume ratio of chloroform to isoamyl alcohol in the mixture is 24:1) was added, mixed and allowed to stand for 5min, centrifuged at 12000rpm for 8min, the supernatant was aspirated into a new 1.5mL centrifuge tube, 2 / 3 volume ratio of isopropanol was added, mixed and allowed to stand for 10min, centrifuged at 12000rpm for 5min, the supernatant was discarded, the DNA was washed twice with 70% (volume percentage) ethanol, air-dried on a clean bench, 10μL ddH2O was added to dissolve the DNA and the concentration was determined.

[0048] Then, Bar gene PCR detection was performed, specifically: PCR identification was performed using Bar gene primers (F: CAACCACTACATCGAGACAAGCA, SEQ ID NO.1; R: TCATCAGATCTCGGTGACGGG, SEQ ID NO.2), and the PCR program was set to: 94°C 3min, 30 repeated cycles (specifically including: 94°C 30s, 60°C 30s, 72°C 1min), 72°C 10min, and the hairy roots that could amplify a Bar gene band of about 50bp were positive.

[0049] The results are as follows Figure 1As shown in the results, the Phyllanthus emblica seedlings with radicle length in the range of 1 cm ≤ radicle length < 1.5 cm showed the highest transformation efficiency, with the hairy root incidence rate reaching 88.3% and the hairy root positive rate reaching 83.4%. Therefore, in the subsequent transformation experiments, we chose to uniformly use the Phyllanthus emblica seedlings with radicle length in the range of 1 cm ≤ radicle length < 1.5 cm as the genetic transformation materials.

[0050] Example 2 Analysis of the transformation efficiency of Phyllanthus emblica by different activation times of recombinant Agrobacterium rhizogenes K599

[0051] In order to determine the activation time of the recombinant Agrobacterium rhizogenes K599 with the highest genetic transformation efficiency, the present invention uses the recombinant Agrobacterium rhizogenes K599 activated for 24h, 48h and 72h to genetically transform the emblica seedlings.

[0052] (1) Agrobacterium rhizogenes transformation

[0053] Same as Example 1.

[0054] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0055] Recombinant Agrobacterium rhizogenes K599 was taken out from the -80℃ refrigerator and inoculated on YEP solid medium containing 50 mg / L spectinomycin. It was cultured at 28℃ for 24 h (1d), 48 h (2d) and 72 h (3d). The effective viable counts of the cultures were 10 9 CFU / mL, 10 11 CFU / mL and 10 15 CFU / mL.

[0056] (3) Paper culture germination of Phyllanthus emblica

[0057] After disinfecting the seeds of Phyllanthus emblica with 5% sodium hypochlorite, the seeds were germinated by paper culture method. After the seeds germinated, the Phyllanthus emblica seedlings with radicle length within the range of 1 cm ≤ radicle length < 1.5 cm and good growth status were selected for further experiments.

[0058] (4) Inducing the formation of transgenic hairy roots

[0059] Afterwards, use a scalpel to cut off the underground part of the emblica seedlings at an angle of 45° to form a smooth incision. Then, use a sterile needle to pick up the recombinant Agrobacterium rhizogenes K599 and inject it to infect the seedlings. After injection infection, directly cover the infected seedling wounds with the bacteria. Then, the emblica seedlings into which the treated seedlings were transferred were transferred to the culture matrix, in which the volume ratio of quartz sand and vermiculite was 1:1, and both quartz sand and vermiculite were sterilized. During the culture process, ensure that the wound area of ​​the seedlings is covered by the matrix, and cover the seedlings with a layer of plastic wrap, and spray water several times a day to keep the matrix moist. First, culture at 25°C in the dark for 2 days and then move to an artificial climate box for light culture. The culture conditions are as follows: light time 12h / d, light intensity 800μmolm -2 s -1 , temperature 25℃, time 15d, induced the formation of capillary roots, and obtained transgenic Phyllanthus emblica composite plants.

[0060] Then, positive identification of transgenic plants and PCR detection of Bar gene were performed, and the steps were the same as those in Example 1.

[0061] The results are as follows Figure 2 As shown in the figure, the recombinant Agrobacterium rhizogenes K599 activated for 24 hours had the highest genetic transformation efficiency, with the hairy root incidence rate reaching 86.6%, the hairy root positive rate reaching 82.1%, and the average length of the hairy roots reaching 2.1 cm on the 15th day after genetic transformation. Therefore, in subsequent transformation experiments, we uniformly used the recombinant Agrobacterium rhizogenes K599 activated for 24 hours for genetic transformation to improve the transformation efficiency.

[0062] Example 3 Analysis of transformation efficiency of different explants on Phyllanthus emblica

[0063] In order to study whether there are differences in the genetic transformation efficiency of different Phyllanthus emblica explants, we selected Phyllanthus emblica semi-lignified branches, leaves, seedlings after germination for 15 days, tender shoots, and Phyllanthus emblica seedlings with radicle lengths within the range of 1 cm ≤ radicle length < 1.5 cm and good growth status for experiments. The specific experimental steps are as follows:

[0064] (1) Agrobacterium rhizogenes transformation

[0065] Same as Example 1.

[0066] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0067] Example 1.

[0068] (3)Explant

[0069] After disinfecting the seeds of Phyllanthus emblica with 5% sodium hypochlorite, the seeds were germinated by paper culture. After the seeds germinated, the Phyllanthus emblica seedlings with radicle length within the range of 1 cm ≤ radicle length < 1.5 cm and good growth status (before the first true leaf unfolded) were selected, and the underground part of the Phyllanthus emblica seedlings was cut off at an angle of 45° with a scalpel to form a smooth incision;

[0070] Germinate seeds using soil culture method, and pick Phyllanthus emblica seedlings after the first true leaf unfolds (seedlings after germination for 15 days);

[0071] Emblica semi-lignified branches;

[0072] Phyllanthus emblica leaves;

[0073] Young sprouts of Phyllanthus emblica.

[0074] (4) Inducing the formation of transgenic hairy roots

[0075] Afterwards, a sterile needle was used to pick up the recombinant Agrobacterium rhizogenes K599 and injected to infect different explants. After the injection infection, the infected explant wound was directly covered with the bacteria. The subsequent steps were the same as in Example 1 to obtain a transgenic Phyllanthus emblica composite plant.

[0076] Afterwards, positive identification of transgenic plants and PCR detection of Bar gene were performed. The results of the survey are shown in Table 1 and Figure 7 As shown in Table 1, the transgenic hairy roots could not be obtained from seedlings, semi-lignified branches, leaves and buds of Phyllanthus emblica within 15 days after germination. This shows that different explants have a great influence on the transformation efficiency of Phyllanthus emblica. Figure 7 It can be seen that when the Phyllanthus emblica seedlings 15 days after germination were used as explants, the wounds could not produce root hairs after induction treatment.

[0077] Table 1 Analysis of transformation efficiency of different explants on Phyllanthus emblica

[0078]

[0079] Example 4 Analysis of transformation efficiency of Phyllanthus emblica by different infection methods

[0080] In order to study whether different infection methods have different effects on the genetic transformation efficiency of Phyllanthus emblica, we selected injection infection and coating infection for experiments. The specific experimental steps are as follows:

[0081] (1) Agrobacterium rhizogenes transformation

[0082] Same as Example 1.

[0083] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0084] Same as Example 1.

[0085] (3) Paper culture germination of Phyllanthus emblica

[0086] Same as Example 1.

[0087] (4) Inducing the formation of transgenic hairy roots

[0088] Afterwards, use a scalpel to cut off the underground part of the emblica seedlings at an angle of 45° to form a smooth incision.

[0089] For half of the materials, recombinant Agrobacterium rhizogenes K599 was dipped into a sterile needle and injected into the seedlings. After the injection and infection, the infected seedling wounds were directly covered with the bacteria. For the other half of the materials, the recombinant Agrobacterium rhizogenes K599 was directly applied to the wound surface.

[0090] Then, the Emblica officinalis seedlings into which the treated seedlings were transferred were transferred to a culture matrix, and the subsequent steps were the same as those in Example 1 to obtain transgenic Emblica officinalis composite plants.

[0091] Afterwards, positive identification of transgenic plants and PCR detection of Bar gene were performed. The survey results are shown in Table 2. As shown in Table 2, the incidence rate and positive rate of hairy roots in injection infection reached more than 82%, while that in coating infection was only about 73%. Therefore, we chose the injection infection method to treat the seedlings.

[0092] Table 2 Analysis of transformation efficiency of Phyllanthus emblica by different infection methods

[0093] Injection infection Spreading infection Hair root incidence (%) 86.2 73.5 Hair root positive rate (%) 82.2 72.4

[0094] Example 5 Analysis of transformation efficiency of different Agrobacterium rhizogenes

[0095] In order to study whether there are differences in the genetic transformation efficiency of different rhizogenes of Emblica officinalis, we selected injection infection and coating infection for experiments. The specific experimental steps are as follows:

[0096] (1) Agrobacterium rhizogenes transformation

[0097] The Agrobacterium used in the experiment was Agrobacterium K599, MSU440 and ATCC15834, and the vector was pTF102 containing the GUS reporter gene. The competent cells of Agrobacterium K599 were transformed by freeze-thaw method, and then added to 0.5mL YEP liquid medium, cultured at 28℃ for 1h, and then 50μL of the bacteria were pipetted and spread on a YEP solid plate containing 50mg / L spectinomycin, and cultured at 28℃ for 2d. A single colony was picked, and after sequencing and verification, it was stored at -80℃ for standby use, which was the recombinant Agrobacterium K599.

[0098] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0099] Same as Example 1.

[0100] (3) Paper culture germination of Phyllanthus emblica

[0101] Same as Example 1.

[0102] (4) Inducing the formation of transgenic hairy roots

[0103] The steps are the same as those in Example 1 to obtain transgenic Phyllanthus emblica composite plants.

[0104] Afterwards, positive identification of transgenic plants and PCR detection of Bar gene were performed. The results are shown in Table 3. As shown in Table 3, the root incidence and hairy root positive rate of Agrobacterium rhizogenes K599 reached more than 82%, while the root incidence and hairy root positive rate of Agrobacterium rhizogenes MSU440 and Agrobacterium rhizogenes ATCC15834 were both below 80%. Therefore, we chose Agrobacterium rhizogenes K599.

[0105] Table 3 Analysis of transformation efficiency of different rhizogenes of Agrobacterium tumefaciens on Phyllanthus emblica

[0106] Recombinant Agrobacterium rhizogenes K599 Recombinant Agrobacterium rhizogenes MSU440 Recombinant Agrobacterium rhizogenes ATCC15834 Hair root incidence (%) 85.9 75.4 73.5 Hair root positive rate (%) 86.3 72.6 74.7

[0107] Example 6 Effects of different activation modes of recombinant Agrobacterium rhizogenes K599 on the transformation efficiency of Phyllanthus emblica

[0108] In order to study whether different activation methods of different recombinant Agrobacterium rhizogenes K599 have different effects on the genetic transformation efficiency of Phyllanthus emblica, we selected two methods, solid activation and liquid activation, for experiments. The specific experimental steps are as follows:

[0109] (1) Agrobacterium rhizogenes transformation

[0110] Same as Example 1.

[0111] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0112] Solid activation: Take out the recombinant Agrobacterium rhizogenes K599 from the -80℃ refrigerator, inoculate it on the YEP solid medium containing 50mg / L spectinomycin, and culture it at 28℃ for 24h. The effective viable count of the culture is 10 9 CFU / mL;

[0113] Liquid activation: Take out the recombinant Agrobacterium rhizogenes K599 from the -80℃ refrigerator, inoculate it in YEP liquid medium containing 50mg / L spectinomycin, and culture it at 28℃ for 24h. The effective viable count of the culture is 10 9 CFU / mL.

[0114] (3) Paper culture germination of Phyllanthus emblica

[0115] The steps are the same as in Example 1.

[0116] (4) Inducing the formation of transgenic hairy roots

[0117] Afterwards, use a scalpel to cut off the underground part of the Phyllanthus emblica seedlings at an angle of 45° to form a smooth incision. Then, use a sterile needle to obtain recombinant Agrobacterium rhizogenes K599 obtained by different activation methods, and inject and infect the seedlings. After injection and infection, directly cover the infected seedling wound with the bacteria. The steps are the same as in Example 1 to obtain a transgenic Phyllanthus emblica composite plant.

[0118] Afterwards, positive identification of transgenic plants and PCR detection of Bar gene were performed. The test results are shown in Table 4. As shown in Table 3, on the 15th day after induction treatment, the root incidence rate and hairy root positive rate of Agrobacterium rhizogenes K599 obtained by solid activation reached about 82%, while the hairy root incidence rate of Agrobacterium rhizogenes obtained by liquid activation was less than 25%, and the hairy root positive rate was below 77%. Therefore, we chose to activate Agrobacterium rhizogenes K599 with solid culture medium.

[0119] Table 3 Analysis of transformation efficiency of different rhizogenes of Agrobacterium tumefaciens on Phyllanthus emblica

[0120] Solid Activation Liquid Activation Hair root incidence (%) 82.4 24.5 Hair root positive rate (%) 81.8 76.1

[0121] Example 7

[0122] 1. Obtaining transgenic Phyllanthus emblica composite plants

[0123] The experimental process is detailed in Figure 3 , specifically:

[0124] (1) Agrobacterium transformation

[0125] The Agrobacterium rhizogenes used in the experiment was Agrobacterium rhizogenes K599, and the vector was pTF102 containing the GUS reporter gene. The competent cells of Agrobacterium rhizogenes K599 were transformed by freeze-thaw method, added to 0.5 mL of YEP liquid medium, cultured at 28 ° C for 1 h, and then 50 μL of the bacteria were pipetted and spread on a YEP solid plate containing 50 mg / L spectinomycin, and cultured at 28 ° C for 2 days. A single colony was picked, and after sequencing and verification, it was stored at -80 ° C for standby use, which was the recombinant Agrobacterium rhizogenes K599.

[0126] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0127] Recombinant Agrobacterium rhizogenes K599 was taken out from the -80℃ refrigerator, inoculated on YEP solid medium containing 50 mg / L spectinomycin, and cultured at 28℃ for 24 h ( Figure 3 A), the effective viable count of the culture is 10 9 CFU / mL.

[0128] (3) Paper culture germination of Phyllanthus emblica

[0129] After disinfecting the seeds of Phyllanthus emblica with 5% sodium hypochlorite, the seeds were germinated by paper culture method ( Figure 3 B). After the seeds germinated, the well-growing seedlings of Phyllanthus emblica with different radicle lengths were selected for further experiments.

[0130] (4) Inducing the formation of transgenic hairy roots

[0131] After that, the underground part of the Phyllanthus emblica seedlings was cut off at an angle of 45° using a scalpel to form a smooth incision. Then, a sterile needle was used to pick up the recombinant Agrobacterium rhizogenes K599 and injected into the seedlings ( Figure 3 C). After injection infection, directly cover the wound of the infected seedlings with bacteria ( Figure 3 Then, the treated seedlings were transferred to the emblica seedlings and cultured in sand medium ( Figure 3 E), the volume ratio of the culture medium quartz sand and vermiculite is 1:1, and both quartz sand and vermiculite are sterilized. During the culture process, ensure that the wound of the seedling is covered with the medium, and cover the seedling with a layer of plastic wrap, and spray water several times a day to keep the medium moist. First, culture at 25℃ in the dark for 2 days ( Figure 3 After F) in the artificial climate box, the culture conditions were as follows: light duration 12h / d, light intensity 800μmol / m -2 s -1 , temperature 25℃, time 20d, ( Figure 3 G in the cultivar), induced the formation of capillary roots, and obtained transgenic Phyllanthus emblica composite plants ( Figure 3 H in.

[0132] 2. Positive identification of transgenic plants

[0133] (1) Bar gene PCR detection

[0134] DNA extraction from hairy roots using CTAB method

[0135] After the hairy roots of the transgenic emblica composite plants were formed, about 0.05 g of hairy roots were taken into a 1.5 mL centrifuge tube and 1000 μL CTAB (CTAB contains: 12.114 g / L Tris, 7.44 g / L EDTA-Na2, 81.9g / LNaCl, 20g / LCTAB, 10g / LPVP-40), after adding steel beads to the centrifuge tube, the sample was completely crushed, heated in a 65℃ water bath for 30min, allowed to stand and cool, an equal volume of chloroform: isoamyl alcohol mixture (the volume ratio of chloroform to isoamyl alcohol in the mixture is 24:1) was added, mixed and allowed to stand for 5min, centrifuged at 12000rpm for 8min, the supernatant was aspirated into a new 1.5mL centrifuge tube, 2 / 3 volume ratio of isopropanol was added, mixed and allowed to stand for 10min, centrifuged at 12000rpm for 5min, the supernatant was discarded, the DNA was washed twice with 70% (volume percentage) ethanol, air-dried on a clean bench, 10μL ddH2O was added to dissolve the DNA and the concentration was determined.

[0136] Bar gene PCR detection

[0137] PCR identification was performed using Bar gene primers, and the PCR program was set as: 94°C for 3 min, 30 repeated cycles (specifically including: 94°C for 30 s, 60°C for 30 s, 72°C for 1 min), 72°C for 10 min. The roots that could amplify a Bar gene band of about 50 bp were positive roots, and the positive roots were retained for subsequent GUS staining experiments. At the same time, some negative roots were retained as controls for subsequent experiments.

[0138] (2) GUS staining verification

[0139] Rinse the hair roots twice with secondary water, and then transfer them to GUS staining solution (the formula of GUS staining solution: 1mM X-Gluc and 0.1M Na2HPO4 / NaH2PO4, pH 7.2). Then, vacuum the sample for 40 minutes and transfer it to 37°C to stain overnight in the dark. The stained hair roots are positive hair roots, which are transferred to 75% (volume percentage) ethanol for storage, and their staining is observed and photographed using a stereo microscope.

[0140] (3) Results:

[0141] DNA from the hairy roots of Phyllanthus emblica was extracted and conventional PCR was performed using Bar gene primers. The hairy roots that could amplify a Bar gene band of about 500 bp were positive, while the DNA of the roots of wild-type Phyllanthus emblica seedlings could not extend the Bar gene band ( Figure 4 ).

[0142] Further GUS staining of hairy roots showed good GUS activity staining effect on positive hairy roots, while the roots of wild-type Phyllanthus emblica seedlings could not be stained ( Figure 5 ), through stereomicroscope observation, it can be observed that the GUS tag protein can be stably expressed in hairy roots and has strong expression in all parts of the root system ( Figure 6 ).

[0143] The above experimental results show that the technical path of using Agrobacterium K599 to transform the emblica seedling material under tissue culture-free conditions to obtain transgenic composite plants is feasible and efficient. The present invention uses emblica seedlings germinated by paper culture as materials, and uses high-temperature sterilized quartz sand mixed with vermiculite as a culture medium under relatively open experimental conditions, directly cuts off the underground part of the emblica seedlings, and obtains transgenic hairy roots by infecting the seedling incision with recombinant Agrobacterium K599, and then uses the GUS tag protein stably expressed in the positive hairy roots to quickly and efficiently identify the positive hairy roots. Compared with the traditional emblica genetic transformation method, this method does not require tissue culture, improves the transformation efficiency, shortens the transformation cycle, and also reduces consumables and manpower consumption.

[0144] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for inducing complex emblica with transgenic hairy roots without tissue culture, characterized in that: The following steps are involved: The pretreated Phyllanthus emblica seedlings are used as explants, the explants are infected with Agrobacterium rhizogenes carrying a reporter gene and a target gene, and then the infected explants are transferred to a culture medium for culture; The emblica seedlings are emblica seedlings with a radicle length of ≥1 cm and <1.5 cm; the method for obtaining the emblica seedlings is paper culture method; The pretreatment comprises the steps of cutting off the underground part of the emblica seedlings at an oblique angle of 45° to form a smooth incision; The activation method of the Agrobacterium rhizogenes carrying the reporter gene and the target gene is to spread the Agrobacterium rhizogenes carrying the reporter gene and the target gene on a YEP solid culture medium containing 50 mg / L spectinomycin, and culture at 28° C. for 24 hours; The Agrobacterium rhizogenes is Agrobacterium rhizogenes K599; The infection method is injection infection; the infection frequency is 1 time; The culture matrix includes quartz sand and vermiculite; the volume ratio of the quartz sand to the vermiculite is 1:1; The culture matrix covers the wound site of the pretreated Phyllanthus emblica seedlings; After the infected explants are transferred to the culture matrix, the step of covering with a film is also included; The culture includes dark culture and light culture; the dark culture time is 2 days and the temperature is 25°C; the light culture time is 15-25 days and the temperature is 25°C.

Images