A kind of Escherichia coli for synthesizing blue and its construction method and application

Abstract

The present application relates to an Escherichia coli for synthesizing indigo blue and its construction method and application, and belongs to the technical field of biosynthesis of natural dyes. The indigo blue synthesizing Escherichia coli of the present application is characterized in that the Escherichia coli overexpresses glucose-promoting protein glf, glucose kinase glk and cell division inhibitory protein sulA; the Escherichia coli knocks out the fission protein ftsZ, the dynamic cytoskeleton protein mreB, and weakens the ribonucleoside reductase nrdA. The present application knocks out the cell fission protein ftsZ, the dynamic cytoskeleton protein mreB and the weakened ribonucleoside reductase nrdA of Escherichia coli, overexpresses the cell division inhibitory protein, glucose-promoting protein and glucose kinase, which can effectively prolong the cell division cycle without affecting its growth rate, increase the average cell volume, and thus achieve an increase in the indigo blue yield.

Description

Technical Field

[0001] The present application relates to the technical field of biosynthetic natural dyes, and in particular to a blue-synthetic Escherichia coli and a construction method and application thereof. Background Art

[0002] Indigoidine is a natural blue pigment with no toxic side effects. It is synthesized in vivo mainly by 4'-phosphopantetheinyl transferase activating indigo synthase, which synthesizes 2 molecules of glutamine in the body into 1 molecule of indigo. Indigoidine presents a bright and deep blue color similar to indigo, and can be widely used in printing and dyeing, food and pharmaceutical industries as a new natural blue pigment and dye.

[0003] In the prior art, the biosynthesis of indigofera can be achieved by modifying Escherichia coli. However, since a large number of exogenous genes are introduced into the biosynthetic pathway and Escherichia coli is highly dependent on the blue pigment synthase (bpsA) during the synthesis of indigofera, the cell membrane of Escherichia coli is stressed and the cell may even rupture, resulting in instability in the biosynthetic pathway of indigofera and the inability to further increase the yield. Therefore, it is urgent to modify Escherichia coli to increase its cell volume, thereby increasing the yield of indigofera. Summary of the invention

[0004] The purpose of the present application is to overcome the shortcomings of the prior art and provide an Escherichia coli for producing blue indigo, which increases the blue indigo yield by changing the cell morphology, prolonging the cell division cycle, and improving the sugar uptake capacity to reduce the problem of slow growth of the modified strain.

[0005] To achieve the above purpose, the technical solution adopted by this application is:

[0006] In a first aspect, the present application provides an Escherichia coli for synthesizing blue pigment, wherein the Escherichia coli overexpresses a glucose-promoting protein glf, a glucose kinase glk, and a cell division inhibitory protein sulA, and expresses a blue pigment synthase bpsA;

[0007] The Escherichia coli knocks out the fission protein ftsZ and the dynamic cytoskeleton protein mreB, and weakens the ribonucleoside reductase nrdA.

[0008] The present application knocks out the cell division protein ftsZ, the dynamic cytoskeleton protein mreB and the weakened ribonucleoside reductase nrdA of Escherichia coli, overexpresses cell division inhibitory protein, glucose-promoting protein and glucose kinase, and can effectively extend the cell division cycle without affecting its growth rate, thereby increasing the average volume of cells, thereby achieving an increase in the yield of blue. The cell division protein ftsZ can regulate the C phase of cell division, the ribonucleoside reductase nrdA can regulate the D phase of cell division, and the cell division inhibitory protein sulA can promote the expression of the division inhibitory protein. The knockout or weakening of the above three genes can effectively extend the cell division cycle, thereby increasing the cell volume. The dynamic cytoskeleton protein mreB can regulate the ductility of the cell structure, and knocking out mreB can enhance the ductility of the cell structure and further increase the cell volume.

[0009] As a preferred embodiment of the Escherichia coli described in the present application, the glucose-promoting protein glf is derived from Zymomonas mobilis; the coding sequence of the glucose-promoting protein glf is shown in SEQ ID NO.1.

[0010] As a preferred embodiment of the Escherichia coli described in the present application, the glucose kinase glk is derived from Escherichia coli; the coding sequence of the glucose kinase glk is shown in SEQ ID NO. 2. Since the strain growth rate may be slowed down during the editing of the coding genes related to cell division of Escherichia coli, glucose kinase and glucose promoting protein are introduced to promote the transport and absorption of glucose by Escherichia coli and enhance its ability to utilize glucose.

[0011] As a preferred embodiment of the Escherichia coli described in the present application, the overexpression is to replace the original promoter of the cell division inhibitory protein with a strong promoter; the coding sequence of the cell division inhibitory protein sulA is shown in SEQ ID NO.3.

[0012] In a second aspect, the present application provides a method for constructing the above-mentioned Escherichia coli, which comprises the following steps:

[0013] A1. The gene encoding the cell division protein ftsZ on Escherichia coli IN10 was knocked out using gene editing technology to obtain engineered bacteria A.

[0014] A2. Using gene editing technology, the promoter of ribonucleoside reductase nrdA on the engineered bacteria A obtained in step A1 is replaced with a weak promoter to obtain engineered bacteria B;

[0015] A3, using gene editing technology to knock out the gene encoding the cytoskeletal protein mreB in the engineered bacteria B obtained in step A2, to obtain engineered bacteria C;

[0016] A4, using gene editing technology to replace the promoter of the cell division inhibitory protein sul A on the engineered bacteria C obtained in step A3 with a strong promoter to obtain engineered bacteria D;

[0017] A5. Using gene editing technology, the pseudogene ybdR on the engineered bacteria D obtained in step A4 is replaced with the glucose-promoting protein glf to obtain the engineered bacteria E;

[0018] A6. Use gene editing technology to replace the pseudogene yghX on the engineered bacteria E obtained in step A5 with glucose kinase glk, and then insert the blue pigment synthase bpsA to obtain engineered bacteria F. The obtained engineered bacteria F is Escherichia coli that synthesizes blue pigment.

[0019] As a preferred embodiment of the construction method described in the present application, in step A5, the glucose-promoting protein glf is first constructed into a glucose-promoting protein glf expression cassette with a strong promoter by gene editing technology before replacing the pseudogene ybdR;

[0020] In step A6, the glucose kinase glk is first constructed into a glucose kinase glk expression cassette with a strong promoter by gene editing technology before replacing the pseudogene yghX.

[0021] As a preferred embodiment of the construction method described in this application, it includes at least one of the following (I) to (II):

[0022] (I) In step A2, the weak promoter includes at least one of BBa-j23109, BBa-j23114 and BBa-j23117;

[0023] (II) In steps A4-A6, the strong promoter includes at least one of BBa-j23119, BBa-j23101 and BBa-j23105.

[0024] In order to avoid the modification of cell division cycle-related genes from having too great an impact on the growth rate of the strain, a promoter was used to weaken the expression level of the corresponding coding gene to extend the cell division cycle.

[0025] In a third aspect, the present application provides the use of the above-mentioned Escherichia coli in synthesizing indigo.

[0026] In a fourth aspect, the present application provides a method for synthesizing indigo, which is obtained by fermenting the above-mentioned Escherichia coli seed liquid and fermentation medium in a bioreactor.

[0027] The present application provides a method for synthesizing indigo blue, which is prepared by inducing Escherichia coli IN10-07 through a series of biochemical reactions. The cell division cycle of Escherichia coli IN10-07 used in the synthesis process is extended, so that the cell volume becomes larger, providing new space for the cell biosynthesis of indigo blue, thereby increasing the yield of management, and the shake flask fermentation yield of the obtained indigo blue can reach 12.75g / L.

[0028] As a preferred embodiment of the method described in the present application, the fermentation conditions are fermentation at 20-30°C and 180-225rpm for 16-24h;

[0029] The bioreactor also contained a kanamycin solution with a final concentration of 40-55 μg / mL.

[0030] Compared with the prior art, the beneficial effects of this application are:

[0031] (1) The present application knocks out the cell division protein ftsZ, the dynamic cytoskeleton protein mreB and the weakened ribonucleoside reductase nrdA of Escherichia coli, overexpresses cell division inhibitory protein, glucose promoting protein and glucose kinase, which can effectively prolong the cell division cycle without affecting its growth rate, increase the average cell volume, and thus achieve an increase in blue yield.

[0032] (2) The present application provides a method for synthesizing indigo blue, which is prepared by inducing Escherichia coli IN10-07 to undergo a series of biochemical reactions. The cell division cycle of the Escherichia coli IN10-07 used in the synthesis process is prolonged, so that the cell volume becomes larger, providing new space for the cell biosynthesis of indigo blue, thereby increasing the yield of the product. The shake flask fermentation yield of the obtained indigo blue can reach 12.75 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 These are the results of microscopic examination of the engineered bacteria IN10-06 and IN10 in the effect examples of this application. DETAILED DESCRIPTION

[0034] In order to better illustrate the purpose, technical solutions and advantages of the present application, the present application will be further described below in conjunction with specific embodiments.

[0035] Unless otherwise specified, the materials, reagents, etc. used in the embodiments, comparative examples and experimental examples can be obtained from commercial sources.

[0036] Escherichia coli DH5α (hereinafter referred to as DH5α) is used for vector construction and can be obtained from commercial channels.

[0037] Escherichia coli IN10 is the Escherichia coli IN10 previously constructed by the applicant and capable of biosynthesizing blue. The construction method is shown in 2024101358243.

[0038] Plasmid pTarget was purchased from Bio-Wind.

[0039] High-fidelity DNA polymerase, restriction endonuclease, In- Snap Assembly Master Mix was purchased from TAKARA.

[0040] Plasmid extraction kit, DNA purification kit, gel recovery kit, and bacterial genomic DNA extraction kit were purchased from OMEGA.

[0041] LB medium: 5g / L yeast powder, 10g / L peptone, 10g / L NaCl, the balance is water, sterilized at 121℃ for 20min; if prepared as solid culture medium, add 15-20g / L agar powder.

[0042] TB medium: 12 g / L peptone, 24 g / L yeast powder, 2.31 g / L KH2PO4, 12.54 g / L K2HP4, 0.4% v / v glycerol, the remainder is water, sterilized at 121°C for 20 min.

[0043] ZYM fermentation medium: 10 g / L tryptone, 5 g / L yeast powder, 3.55 g / L Na2HPO4, 3.4 g / L KH2PO4, 0.71 g / L Na2SO4, 0.5 g / L MgSO4·7H2O, 10 mL / L 100× trace elements, 0.5% v / v glycerol, 0.5 g / L glucose and 2.0 g / L L-arabinose, NH4Cl adjusted pH = 6.8-7.2;

[0044] The formula of 100× trace elements (100× means that the mother liquor concentration is 100 times the final working concentration) is: 0.32g / L CuSO4, 1.5-3.1g / L CaCl2·2H2O, 0.32g / L MnCl2·4H2O, 5.75g / L ZnSO4·7H2O, 0.47g / L CoCl2·6H2O, 2.8g / L FeSO4·7H2O, 0.48g / L Na2MO4·2H2O, 80mL / L 0.5M EDTA.

[0045] In the following embodiments and comparative examples, unless otherwise specified, the method for transferring plasmids into Escherichia coli DH5α is chemical transformation, and the chemical transformation includes the following steps: adding the transformation system to the DH5α transfection competent medium melted on ice, ice bathing for 30 minutes, heat shocking at 42°C for 1 minute, ice bathing again for 2 minutes, then adding 900uL of pre-cooled LB, incubating at 37°C and 220rpm for 60 minutes; taking 100μL of the incubated bacterial solution and adding it to LB medium containing streptomycin resistance, and culturing it at 30°C / 37°C overnight.

[0046] In the following examples and comparative examples, unless otherwise specified, the method for transferring plasmids into Escherichia coli IN10 series engineering bacteria is electroporation, and the electroporation comprises the following steps: taking the target fragment and adding it to the electroporation competent cells of the corresponding IN10 series engineering bacteria, gently mixing and adding it to the electroporation cup, ice bathing for 5-10 minutes, 2.5kV electric shock, quickly adding pre-cooled LB liquid culture medium, placing it in a 30°C shaker for incubation for 2 hours, taking 100 μL of the bacterial solution and applying it to the LB solid culture medium, and culturing it at 30°C for 24 hours;

[0047] The preparation method of electroporated competent cells is as follows:

[0048] 1. Pick up a single clone colony with a pipette tip and put it into a 50mL centrifuge tube containing 10mL LB liquid culture medium (also make a blank control of the culture medium and pipette tip);

[0049] 2.37℃, 220rpm, culture for 14-16h, inoculate the bacterial solution into 50mL LB liquid culture medium at a ratio of 1:100, 37℃, 220rpm, culture for 2-3h, measure OD every half hour, and stop culturing when OD value reaches 0.6-0.8;

[0050] 3. Precool the bacterial solution on ice for 30 minutes, then divide the bacterial solution into 50mL precooled centrifuge cups, centrifuge at 4℃, 4500rpm for 10 minutes, discard the supernatant, suspend the precipitate with sterile water, centrifuge at 4℃, 4500rpm for 10 minutes, discard the supernatant, suspend the precipitate with 10% sterile glycerol, centrifuge at 4℃, 4500rpm for 10 minutes, discard the supernatant, add 300μL of 10% glycerol to each centrifuge cup, suspend the precipitate, divide the bacterial solution into 1.5ml centrifuge tubes at 100μL / tube, and store in a -80℃ refrigerator.

[0051] In the following examples and comparative examples, unless otherwise specified, the method for screening and eliminating pCas plasmids comprises the following steps: applying the competent cells after electroporation to LB solid medium containing kanamycin and spectinomycin, culturing at 30° C. for 24 h, picking the transformants and performing colony PCR verification using corresponding primers;

[0052] After the positive transformants are verified, the colonies are picked and induced in LB liquid medium containing IPTG, diluted and spread on LB solid medium containing kanamycin, and cultured at 30°C for 12-16 hours. Single colonies are picked and inoculated into LB solid medium containing kanamycin and spectinomycin for culture. Single colonies that only grow in kanamycin single resistance medium and do not grow in kanamycin-spectinomycin double resistance medium are selected as strains that have eliminated the sg-pTarget plasmid;

[0053] The strain with the sg-pTarget plasmid eliminated was inoculated into a non-resistant LB solid medium, cultured at 42°C until a single colony grew, and antibiotic verification was performed according to the above method. The strain that only grew on the non-resistant LB solid medium and did not grow in the kanamycin monoresistant LB solid medium was selected as the strain that eliminated the pCas plasmid, and the strain was a non-resistant stable engineered bacterium;

[0054] The final concentrations of kanamycin and spectinomycin in the above LB solid medium were 50 μg / mL and 50 μg / mL, respectively; the final concentration of IPTG in the above LB liquid medium was 0.1 mM.

[0055] The Gibson assembly technique (hereafter referred to as Gibson) is operated with reference to the following literature:

[0056] Gibson,DG,et al.(2009).Enzymatic assembly of DNA molecules up toseveral hundred kilobases.Nature Methods,6(5),343-345.

[0057] Gibson,DG,et al.(2010).Creation of a bacterial cell controlled byachemically synthesized genome.Science,329(5987),52-56.

[0058] Promoters BBa-j23109 and j23109, BBa-j23114 and j23114, BBa-j23117 and j23117, BBa-j23119 and j23119, BBa-j23101 and j23101, and BBa-j23105 and j23105 are all different expressions of the same promoter.

[0059] Example 1

[0060] This embodiment provides a synthetic blue-producing Escherichia coli and a construction method thereof, wherein the construction method comprises the following steps:

[0061] 1. Construction of engineered bacteria IN10-01

[0062] 1.1 Primers 800ftsZA-UF, 800ftsZA-UR, 800ftsZA-DF, and 800ftsZA-DR were designed based on the ftsZA gene sequence of E. coli. The E. coli IN10 genome was used as a template for amplification to obtain fragments ftsZA-UP and ftsZA-Down. The two fragments were connected by nested PCR using 500ftsZA-UF and 500ftsZA-DR as primers to obtain the ftsZA deletion expression cassette.

[0063] 1.2 The plasmid pCas carrying the transporter gene was electroporated into IN10 electroporation competent cells and spread on LB solid medium plates containing kanamycin resistance. The single colony grown was IN10 / pCas;

[0064] 1.3 Design the sgRNA primers Sg-FtsZA-F and Sg-FtsZA-R for the FtsZA site, perform PCR using the pTarget plasmid as a template, purify the obtained gene fragment by DpNI digestion, and transfer it into DH5α by chemical transformation to obtain the transformation product. Spread the transformation product on a LB solid culture medium plate containing spectinomycin, extract the plasmid from the grown single colony and sequence it to verify that the correct strain is the transformant carrying the sg-FtsZA-pTarget plasmid;

[0065] 1.4 The ftsZA deletion expression cassette obtained in step 1.1 and the sg-pTarget plasmid obtained in step 1.3 were transformed into the IN10 / pCas electroporation competent cells obtained in step 1.2 by electroporation. After screening, the primers 800ftsZA-UF and 800ftsZA-DR were used for colony PCR verification. The empty IN10 / pCas electroporation competent cells were used as controls. Positive transformants were screened and then the positive transformants were treated to eliminate the sg-FtsZA-pTarget plasmid and the pCas plasmid to obtain the non-resistant and stably knocked-out ftsZ engineered bacteria IN10-01;

[0066] The primer sequences used above are shown in Table 1.

[0067] Table 1 Primers used in the construction of engineered bacteria IN10-01

[0068] Primer name Primer sequence (5'-3') 800FtsZA-UF tcgccgcaataatggaacgc 800FtsZA-UR aattcttaatcagcttgcttcttgatcattgttgttctgc 800FtsZA-DF aagcaagctgattaagaatt 800FtsZA-DR caggccgtcttcgttcagta 500FtsZA-UF tcagaaagcagtggcctgat 500FtsZA-DR cagtctctttgatgcgaaca Sg-FtsZA-F ggtgaacgacctcgaatccggttttagagctagaaatagcaagtt Sg-FtsZA-R cggattcgaggtcgttcaccactagtattatacctaggactgagc

[0069] 2. Construction of engineered bacteria IN10-02

[0070] Use the database Ecocyc (https: / / ecocyc.org / ) to predict the promoter of the gene, select the appropriate editing site based on the original promoter sequence, and then use the Crispr-cas9 fragment replacement strategy to replace the target promoter:

[0071] 2.1 Primers 800nrdA-UF, J109-nrdA-R, J109-nrdA-F, 800nrdA-DR were designed based on the nrdA gene and promoter sequence, and the E. coli IN10 genome was used as a template for amplification to obtain fragments nrdA-UP and nrdA-Down. The two fragments were connected by nested PCR using 500nrdA-UF and 500nrdA-DR as primers to obtain the j23109-nrdA expression cassette;

[0072] 2.2 Design nrdA site sgRNA primers Sg-nrdA-F and Sg-nrdA-R, use pTarget plasmid as template and use Sg-nrdA-F and Sg-nrdA-R primers for PCR, and prepare sg-nrdA-pTarget plasmid according to the method of step 1.3;

[0073] 2.3 The j23109-nrdA expression cassette obtained in step 2.1 and the sg-nrdA-pTarget plasmid obtained in step 2.2 were co-transformed into the IN10-01 / pCas electroporation competent cells obtained in step 1.2. After screening, the primers 800nrdA-UF and 800nrdA-DR were used for colony PCR verification. The empty IN10 / pCas electroporation competent cells were used as controls to screen positive transformants. The positive transformants were then treated to eliminate the sg-nrdA-pTarget plasmid and the pCas plasmid to obtain the non-resistant, stable and weakened nrdA engineered bacteria IN10-02;

[0074] The primer sequences used above are shown in Table 2.

[0075] Table 2 Primers used in the construction of engineered bacteria IN10-02

[0076] Primer name Primer sequence (5'-3') Sg-NrdA-F taagcagcttcccgtactacgttttagagctagaaatagcaagtt Sg-NrdA-R gtagtacgggaagctgcttaactagtattatacctaggactgagc 800NrdA-UF gctggcgttattggtcatat 800NrdA-DR gatcagtacgcaggagctga 500NrdA-UF gcgtagaaagataatccgca 500NrdA-DR tcacgcggttctgtaccaga J109-nrdA-R accagcagattctgattcatggtctgtttcctgctagcacagtcccta J109-nrdA-F gcacttgcaagagggtcatcagctagctcagtcctagggactgt

[0077] 3. Construction of engineered bacteria IN10-03

[0078] 3.1 Primers 800mreB-UF, 800mreB-UR, 800mreB-DF, and 800mreB-DR were designed based on the ftsZA gene sequence of Escherichia coli and amplified using the Escherichia coli IN10 genome as a template to obtain fragments mreB-UP and mreB-Down. Using 500mreB-UF and 500mreB-DR as primers, the two fragments were connected by nested PCR to obtain the mreB deletion expression cassette.

[0079] 3.2 Design the mreB site sgRNA primers Sg-mreB-F and Sg-mreB-R, use the pTarget plasmid as a template and use the Sg-mreB-F and Sg-mreB-R primers for PCR, and prepare the sg-mreB-pTarget plasmid according to the method in step 1.3;

[0080] 3.3 The mreB deletion expression cassette obtained in step 3.1 and the sg-mreB-pTarget plasmid obtained in step 3.2 were co-transformed into the IN10-01 / pCas electroporation competent cells obtained in step 1.2. After screening, the primers 800mreB-UF and 800mreB-DR were used for colony PCR verification. The empty IN10 / pCas electroporation competent cells were used as controls to screen positive transformants. The positive transformants were then treated to eliminate the sg-mreB-pTarget plasmid and the pCas plasmid to obtain the non-resistant and stably knocked-out mreB engineered bacteria IN10-03;

[0081] The primer sequences used above are shown in Table 3.

[0082] Table 3 Primers used in the construction of engineered bacteria IN10-03

[0083]

[0084]

[0085] IV. Construction of engineered bacteria IN10-04

[0086] 4.1 Primers 800SulA-UF, J119-UR, J119-UF, 800SulA-DR were designed based on the sulA gene sequence, and the E. coli IN10 genome was used as a template for amplification to obtain fragments SulA-UP and SulA-Down. The two fragments were connected by nested PCR using 500SulA-UF and 500SulA-DR as primers to obtain the j23119-SulA expression cassette; the sulA gene sequence is shown in SEQ ID NO.3;

[0087] 4.2 Design SulA site sgRNA primers Sg-sulA-F and Sg-sulA-R, use pTarget plasmid as template and use Sg-sulA-F and Sg-sulA-R primers for PCR, and prepare sg-sulA-pTarget plasmid according to the method of step 1.3;

[0088] 4.3 The j23119-SulA expression cassette obtained in step 4.1 and the sg-sulA-pTarget plasmid obtained in step 2.2 were co-transformed into IN10-03 obtained in step 3.3. After screening, the primers 800sulA-UF and 800sulA-DR were used for colony PCR verification. The empty IN10 / pCas electroporation competent state was used as a control. The positive transformants were screened and then the sg-sulA-pTarget plasmid and pCas plasmid were eliminated from the positive transformants to obtain the non-resistant and stably overexpressed sulA engineered bacteria IN10-04;

[0089] The primer sequences used above are shown in Table 4.

[0090] Table 4 Primers used in the construction of engineered bacteria IN10-04

[0091] Primer name Primer sequence (5'-3') 800SulA-UF gcattactgcctgagattgg J119-UR acctaggactgagctagctgtcaaatgaaaagcctctcctata J119-UF gtcctaggtataatgctagcattatgtacacttcaggctat 800SulA-DR cctggcgatgtaaagtctac 500SulA-UF agcgctgcatcgagagaata 500SulA-DR ttgccgcatcaacaagttca Sg-sulA-F acatccatacagtaactcacgttttagagctagaaatagcaagtt Sg-sulA-R gtgagttatactgtatggatgtactagtattatacctaggactgagc

[0092] 5. Construction of engineered bacteria IN10-05

[0093] 5.1 According to the sequence of glucose-promoting protein glf of Zymomonas mobilis, the target gene was optimized and synthesized, and the glf fragment was obtained by PCR amplification using primers glf-95S-F and glf-95S-R. The 95S plasmid backbone and glf upstream and downstream fragments were assembled by Gibson, and DH5α was transformed to obtain the 95S-glf plasmid; the optimized glf sequence is shown in SEQ ID NO.1;

[0094] 5.2 Using the engineered bacteria IN10-03 obtained in step 3.3 as a template, PCR amplification was performed using primers 800ybdR-UR and 800ybdR-UF to obtain the ΔybdR::glf up fragment;

[0095] Using the engineered bacteria IN10-03 obtained in step 3.3 as a template, PCR amplification was performed using primers 800ybdR-DF and ybdR-down800R to obtain the ΔybdR::glf down fragment;

[0096] Using the 95S-glf obtained in step 5.1 as a template, PCR amplification was performed using primers tac / 119-F1 and rrnB-R1 to obtain the J23119-glf fragment;

[0097] 5.3 Using the ΔybdR::glf up fragment, ΔybdR::glf down fragment and J23119-glf fragment obtained in step 5.2 as templates, overlap extension PCR amplification was performed using 500ybdR-UF and 500ybdR-UR primers to obtain the ΔybdR::glf donor expression cassette;

[0098] 5.4 Prepare IN10-03 obtained in step 3.3 into electroporation competent cells, electroporate the plasmid pCas carrying the transporter gene into competent cells, and spread them on a kanamycin-resistant LB solid culture medium plate. The single colony that grows is IN10-03 / pCas;

[0099] 5.5 Design ybdR site sgRNA primers Sg-ybdR-F and Sg-ybdR-R, perform PCR using the pTarget plasmid as a template, and prepare the sg-ybdR-pTarget plasmid according to the method in step 1.3;

[0100] 5.6 The ΔybdR::glf donor expression cassette obtained in step 5.3 and the sg-ybdR-pTarget plasmid obtained in step 5.5 were co-transformed into the IN10-03 / pCas electroporation competent cell obtained in step 5.4. After screening, 800ybdR-UF and 800ybdR-DR were used for colony PCR verification. The empty IN10-03 / pCas was used as a control to screen the positive transformants. The positive transformants were then treated to eliminate the sg-ybdR-pTarget plasmid and the pCas plasmid to obtain the non-resistant engineered bacteria IN10-05 that stably overexpressed glf.

[0101] The primer sequences used above are shown in Table 5.

[0102] Table 5 Primers used in the construction of engineered bacteria IN10-05

[0103]

[0104]

[0105] VI. Construction of engineered bacteria IN10-05

[0106] 6.1 According to the sequence of Escherichia coli glucose-promoting protein glk, the target gene was optimized and synthesized, and the glf fragment was obtained by PCR amplification using primers glk-95S-F and glk-95S-R. The 95S plasmid backbone and glk upstream and downstream fragments were assembled by Gibson, and DH5α was transformed to obtain 95S-glk plasmid; the optimized glk sequence is shown in SEQ ID NO.2;

[0107] 6.2 Using the engineered bacteria IN10-03 obtained in step 3.3 as a template, PCR amplification was performed using primers 800 yghX-UR and 800 yghX-UF to obtain the ΔyghX::glk up fragment;

[0108] Using the engineered bacteria IN10-03 obtained in step 3.3 as a template, PCR amplification was performed using primers 800yghX-DF and yghX-down800R to obtain the ΔyghX::glk down fragment;

[0109] Using the 95S-glk obtained in step 6.1 as a template, PCR amplification was performed using primers T5 / tac / 119-F1 and rrnB-R1 to obtain the J23119-glk fragment;

[0110] 6.3 Using the ΔyghX::glk up fragment, ΔyghX::glk down fragment and J23119-glk fragment obtained in step 6.2 as templates, overlap extension PCR amplification was performed using 500yghX-UF and 500yghX-UR primers to obtain the ΔyghX::glk donor expression cassette;

[0111] 6.4 Prepare IN10-05 obtained in step 5.6 into electroporation competent cells, electroporate the plasmid pCas carrying the transporter gene into competent cells, and spread them on a kanamycin-resistant LB solid culture medium plate. The single colony that grows is IN10-05 / pCas;

[0112] 6.5 Design yghX locus sgRNA primers Sg-yghX-F and Sg-yghX-R, perform PCR using the pTarget plasmid as a template, and prepare the sg-yghX-pTarget plasmid according to the method in step 1.3;

[0113] 6.6 The ΔyghX::glk donor expression cassette obtained in step 6.3 and the sg-yghX-pTarget plasmid obtained in step 6.5 were co-transformed into the IN10-05 / pCas electrocompetent obtained in step 6.4. After screening, 800yghX-UF and 800yghXD-R were used for colony PCR verification. The empty IN10-05 / pCas was used as a control to screen the positive transformants. The positive transformants were then treated to eliminate the sg-ybdR-pTarget plasmid and the pCas plasmid to obtain the non-resistant engineered bacteria IN10-06 that stably overexpressed glf.

[0114] 6.7 According to the method of patent 2024101358243, the expression vector pRK-bpsA was transferred into the engineered bacteria IN10-06 obtained in step 6.6 to obtain the synthetic blue IN10-07.

[0115] The engineered bacteria IN10-06 (Escherichia coli IN10-06) obtained in step 6.6 was deposited in the China Center for Type Culture Collection on March 18, 2024, with a deposit number of CCTCC NO: M 2024514.

[0116] The primer sequences used above are shown in Table 6.

[0117] Table 6 Primers used in the construction of engineering bacteria IN10-06

[0118] Primer name Primer sequence (5'-3') 800yghX-UF tctggcgagtaagaggagat 800yghX-UR acgacgtggtgttagctgtgaaatcaaacaacgctaatgcc 800yghX-DF tcgatatcgcaggtgagtacttctcctgataggtttatctc 800yghX-DR agcagagattccgtacaacc 500yghX-UF ggcccgtaattgttggctaa 500yghX-DR cgatatcatgatactgcggc Sg-yghX-F gtgaagcccgcaaagatgaggttttagagctagaaatagcaagtt Sg-yghX-R agaccgagctcaccgaattcctcatctttgcgggcttcac glK-95S-F cgtaacaggaggaattaaccatgagctccgaatcctctca glK-95S-R agaccgagctcaccgaattctttctggctgcgccacatt

[0119] Example 2

[0120] This embodiment provides a method for synthesizing blue, which comprises the following steps:

[0121] (1) The engineered bacteria IN10-07 of Example 1 was inoculated into LB medium and cultured at 30°C for 24 hours, and a single colony was picked and inoculated into 5 mL of BHISG medium, and cultured at 30°C and 220 rpm for 12-16 hours to obtain the primary seed solution of IN10-05;

[0122] (2) Take 500 μL of the IN10-07 primary seed liquid obtained in step (1) and inoculate it into 50 mL of ZYM fermentation medium containing kanamycin with a final concentration of 50 μg / mL, and culture it at 30°C until the final concentration of glucose reaches 4 mg / L. Continue culturing in a shaker at 30°C, 225 rpm, and 16 h to obtain IN10-05 fermentation liquid. The IN10-05 fermentation liquid is centrifuged and filtered to obtain blue.

[0123] Comparative Example 1

[0124] This comparative example provides a synthetic blue-staining Escherichia coli and a construction method thereof. The construction method is carried out according to the method of the applicant's previously constructed Escherichia coli IN10 related patent (2024101358243), and the expression vector pRK-bpsA is transferred into the engineered bacteria IN10 and named IN10-08.

[0125] Comparative Example 2

[0126] This comparative example provides a synthetic blue-producing Escherichia coli and a construction method thereof. The construction method is similar to that of comparative example 1, except that the engineered bacterium IN10 is replaced by the engineered bacterium IN10-04, and the resulting engineered bacterium is named IN10-09.

[0127] Comparative Example 3

[0128] This comparative example provides a synthetic blue-producing Escherichia coli and a construction method thereof. The construction method is similar to that of comparative example 1, except that the engineered bacterium IN10 is replaced by the engineered bacterium IN10-05, and the resulting engineered bacterium is named IN10-10.

[0129] Effect example

[0130] The engineered bacteria IN10-04 to IN10-09 of Example 1 and Comparative Examples 1-3 were used to synthesize indigo plants according to the method of Example 2.

[0131] The OD value was measured at a wavelength of 612 nm using a 1-18 μg / mL standard solution of indigo plantarum. The concentration of indigo plantarum was used as the horizontal axis, and the OD 612 The standard curve is drawn as the ordinate, and the obtained standard curve is Y = 0.0694X + 0.0087, R 2 =0.999.

[0132] The OD values ​​of different samples at 612 nm were measured by UV spectrophotometer, and the yield of blue was calculated according to the standard curve. The results are shown in Table 7.

[0133] IN10-06 and IN10 obtained in Example 1 were subjected to Gram staining and observed under a microscope. The results are shown in Figure 1 .

[0134] Table 7 Shake flask fermentation yield of blue (g / L)

[0135] Group Corresponding engineered bacteria Blue yield (g / L) Example 1 IN10-07 12.75 Comparative Example 1 IN10-08 10.20 Comparative Example 2 IN10-09 10.77 Comparative Example 3 IN10-10 11.39

[0136] As shown in Table 7, the engineered bacteria IN10-07 of the present application can successfully synthesize indigo blue by shake flask fermentation, and the yield of indigo blue is 12.75 g / L; Figure 1 As shown, compared with the IN10 cell morphology before modification, the cell morphology of the engineered bacteria IN10-06 has changed significantly and its volume has increased, indicating that the IN10-06 of the present application can change the cell morphology of Escherichia coli and increase the average cell volume, thereby achieving the effect of increasing the blue yield.

[0137] The genetically engineered strain of the present application reduces the consumption of glutamine during cell division, and at the same time directionally expands the physiological structure of the cell, increases the average cell volume, is beneficial to the expression of exogenous genes, and promotes the production of indigo. After 16 hours of induced culture, the indigo production can reach a maximum of 12.75 g / L, which is significantly improved compared with previous strains, and reduces production costs, which can further promote the process of industrial production.

[0138] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present application rather than to limit the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, ordinary technicians in this field should understand that the technical solution of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present application.

Claims

1. A synthetic blue Escherichia coli, characterized in that The Escherichia coli is based on Escherichia coli IN10 and over-expresses glucose-promoting protein glf, glucose kinase glk and cell division inhibitory protein sulA, and expresses blue pigment synthase bpsA; The Escherichia coli is based on Escherichia coli IN10, in which the fission protein ftsZ and the dynamic cytoskeleton protein mreB are knocked out, and the ribonucleoside reductase gene nrdA is weakened; The glucose-promoting protein glf is derived from Zymomonas mobilis; the coding sequence of the glucose-promoting protein glf is shown in SEQ ID NO.1; The glucose kinase glk is derived from Escherichia coli; the coding sequence of the glucose kinase glk is shown in SEQ ID NO.

2.

2. The Escherichia coli according to claim 1, characterized in that The overexpression is to replace the original promoter of the cell division inhibitor protein with a strong promoter; the coding sequence of the cell division inhibitor protein sulA is shown in SEQ ID NO.

3.

3. The method for constructing Escherichia coli according to any one of claims 1 to 2, characterized in that: The following steps are involved: A1. The gene encoding the cell division protein ftsZ on Escherichia coli IN10 was knocked out using gene editing technology to obtain engineered bacteria A. A2. Using gene editing technology, the promoter of ribonucleoside reductase nrdA on the engineered bacteria A obtained in step A1 is replaced with a weak promoter to obtain engineered bacteria B; A3, using gene editing technology to knock out the gene encoding the cytoskeletal protein mreB in the engineered bacteria B obtained in step A2, to obtain engineered bacteria C; A4, using gene editing technology to replace the promoter of the cell division inhibitory protein sul A on the engineered bacteria C obtained in step A3 with a strong promoter to obtain engineered bacteria D; A5. Using gene editing technology, the pseudogene ybdR on the engineered bacteria D obtained in step A4 is replaced with the glucose-promoting protein glf to obtain the engineered bacteria E; A6. Use gene editing technology to replace the pseudogene yghX on the engineered bacteria E obtained in step A5 with glucose kinase glk, and then insert the blue pigment synthase bpsA to obtain engineered bacteria F. The obtained engineered bacteria F is Escherichia coli that synthesizes blue pigment.

4. The construction method according to claim 3, characterized in that: In step A5, the glucose-promoting protein glf is first constructed into a glucose-promoting protein glf expression cassette with a strong promoter by gene editing technology before replacing the pseudogene ybdR; In step A6, the glucose kinase glk is first constructed into a glucose kinase glk expression cassette with a strong promoter by gene editing technology before replacing the pseudogene yghX.

5. The construction method according to claim 3 or 4, characterized in that: Including at least one of the following (I) to (II): (I) In step A2, the weak promoter includes at least one of BBa-j23109, BBa-j23114 and BBa-j23117; (II) In steps A4-A6, the strong promoter includes at least one of BBa-j23119, BBa-j23101 and BBa-j23105.

6. Use of the Escherichia coli as described in any one of claims 1 to 2 in synthesizing indigo plant.

7. A method for synthesizing indigo, characterized in that: The method is obtained by fermenting the seed liquid of the Escherichia coli according to any one of claims 1 to 2 with a fermentation medium in a bioreactor.

8. The method according to claim 7, characterized in that The fermentation conditions are 20-30°C, 180-225rpm for 16-24h; The bioreactor also contained a kanamycin solution with a final concentration of 40-55 μg / mL.

Images