A tsRNA molecule tRF-28-Q99P9P9NH50E and its application

Abstract

The present invention discloses a tsRNA molecule, tRF-28-Q99P9P9NH50E, and its applications. This novel molecule is associated with liver cancer. Next-generation sequencing and quantitative polymerase chain reaction (qPCR) validation confirm its upregulated expression in liver cancer. This tsRNA molecule has not been previously discovered in studies of liver cancer, other tumor types, or non-tumor conditions. The tRF-28-Q99P9P9NH50E inhibitor inhibits liver cancer cell proliferation, invasion, and migration, has profound clinical significance, and enhances the potential for liver cancer treatment.

Description

Technical field:

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a liver cancer-related tsRNA molecule tRF-28-Q99P9P9NH50E and its application in the treatment of liver cancer. Background technology:

[0002] Hepatocellular carcinoma (HCC) is a primary liver cancer with a high mortality rate and is the most common malignant tumor in the world. The prognosis of HCC patients is poor, with a 5-year survival rate of only 12.7%. Current treatments mainly include surgical resection, liver transplantation, immunotherapy, and local ablative therapy. Among these conventional treatments, only surgical resection and liver transplantation are considered potential cures. However, only 15% of patients have the opportunity to receive potentially curative treatment. Most patients are already in the late metastatic stage when they are discovered, which poses a huge challenge to the treatment of HCC. Discovering new pathogenesis and finding possible therapeutic targets are of great significance to optimizing the overall management of multiple myeloma. In order to better elucidate the pathogenesis of HCC and better treatment methods, it is important to screen for targets for early diagnosis and treatment.

[0003] tsRNA (transferRNA-derived small RNA) is a class of RNA molecules with a length of 70-90 nucleotides. Its 3' end binds to specific amino acids and, through the principle of base complementarity between codons, translates mRNA into polypeptide chains, playing a key role in protein synthesis. tsRNAs can be divided into tRNA-derived fragments (tRFs) ranging from 14-30 nt in length and tRNA halves (tiRNAs) ranging from 29-50 nt in length. They are involved in a variety of biological processes, including RNA silencing, transcriptional regulation, and epigenetic regulation, and play a crucial role in various diseases, including tumors, infection, inflammation, immunity, aging, metabolism, genetics, and neurodegeneration. tsRNAs have been reported to have diverse biological functions in malignant tumors, and their potential as specific biomarkers for clinical diagnosis and therapeutic targets is increasingly emerging. These functional tsRNAs also hold great potential as new biomarkers and therapeutic targets for cancer. Summary of the invention:

[0004] The present invention screened a highly expressed tsRNA molecule, named tRF-28-Q99P9P9NH50E, from sequencing data of liver cancer tissue. Its expression was verified in liver cancer tissue, and knocking down tRF-28-Q99P9P9NH50E was confirmed to inhibit liver cancer proliferation, invasion, and migration. Furthermore, tRF-28-Q99P9P9NH50E inhibitors were used as targets for RNA interference, and tumor therapeutic drugs or preparations that target the tRF-28-Q99P9P9NH50E gene were developed to reduce the expression level of the tRF-28-Q99P9P9NH50E gene in tumor cells.

[0005] The primary purpose of the present invention is to discover a tsRNA molecule related to liver cancer.

[0006] A tsRNA molecule tRF-28-Q99P9P9NH50E, whose cDNA sequence is GCTTCTGTAGTGTAGTGGTTATCACGTT, as shown in SEQ No. 1.

[0007] The second aspect of the present invention aims to provide the use of an agent for inhibiting the expression of tRF-28-Q99P9P9NH50E in the preparation of a preparation for treating liver cancer.

[0008] The reagent for inhibiting the expression of tRF-28-Q99P9P9NH50E includes: a tRF-28-Q99P9P9NH50E inhibitor.

[0009] Furthermore, the tRF-28-Q99P9P9NH50E inhibitor sequence is: AACUGUGAUAACCACUACACUACAGAAGC; as shown in SEQ No. 2.

[0010] The third aspect of the present invention aims to provide a preparation for treating liver cancer, which is an agent for inhibiting the expression of tRF-28-Q99P9P9NH50E, comprising: a tRF-28-Q99P9P9NH50E inhibitor; preferably: the sequence of the tRF-28-Q99P9P9NH50E inhibitor is: AACUGUGAUAACCACUACACUACAGAAGC.

[0011] The fourth aspect of the present invention aims to provide the use of an agent that inhibits the expression of tRF-28-Q99P9P9NH50E in the preparation of a preparation for enhancing the sensitivity of liver cancer tumor cell therapy.

[0012] The reagent for inhibiting tRF-28-Q99P9P9NH50E expression of the present invention can reduce the proliferation, invasion and migration of liver cancer cells.

[0013] The fifth aspect of the present invention aims to provide a reagent for detecting the tRF-28-Q99P9P9NH50E and its use in preparing a preparation for liver cancer diagnosis and / or prognosis.

[0014] Furthermore, the liver cancer diagnosis and / or prognosis preparation includes a PCR detection reagent.

[0015] Furthermore, the primer sequences of the PCR detection reagents are as follows:

[0016] F:5'-GCTTCTGTAGTGTAGTGGTTAT-3'

[0017] R:5'-GTCGTATCCAGTGCAGGGTCCGAGGT-3'.

[0018] The present invention was subsequently verified by expanding samples through real-time quantitative PCR, and prognostic analysis showed that liver cancer patients with high expression of tRF-28-Q99P9P9NH50E had a poor prognosis.

[0019] This study primarily confirmed the high expression of tRF-28-Q99P9P9NH50E in liver cancer tissues and cells through next-generation sequencing and qPCR. This tsRNA molecule has not been previously discovered in studies of liver cancer, other tumor types, or non-tumor conditions, making it highly innovative. Cell-based experiments further validated the mechanism of action of tRF-28-Q99P9P9NH50E in liver cancer cell lines, demonstrating that knockdown of tRF-28-Q99P9P9NH50E inhibited the proliferation, invasion, and migration of liver cancer cells.

[0020] The present invention verifies that tRF-28-Q99P9P9NH50E is upregulated in liver cancer tissues and cells, which is statistically significant, and the sequencing data matching experiment is verified. The experimental process is rigorous and the results are true and reliable.

[0021] The tRF-28-Q99P9P9NH50E inhibitor provided by the present invention can be used as a liver cancer targeted therapeutic reagent, providing a reliable product for improving the therapeutic efficacy of liver cancer.

[0022] During the verification process of the present invention, highly expressed tRF-28-Q99P9P9NH50E was first screened out in liver cancer tissues. The tRF-28-Q99P9P9NH50E inhibitor can effectively downregulate the expression of tRF-28-Q99P9P9NH50E in liver cancer cells. It was also verified in other cell lines that knocking down the expression level of tRF-28-Q99P9P9NH50E can inhibit the proliferation, invasion and migration of liver cancer cells.

[0023] This study screened differentially expressed tsRNAs using RNA-Seq data. Testing clinical tissue samples (n=50) revealed that tRF-28-Q99P9P9NH50E is highly expressed in liver cancer tissue. Knockdown of tRF-28-Q99P9P9NH50E inhibited liver cancer cell proliferation, invasion, and migration. This study provides a powerful molecular biology tool for tumor diagnosis and treatment, with profound clinical significance and promising prospects for widespread application.

[0024] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, without limiting the present invention. Description of the drawings:

[0025] Figure 1 The differential tsRNA expression between 5 pairs of HCC tissues and corresponding normal tissues was analyzed, and cluster heat map analysis of the differentially expressed tsRNAs was performed.

[0026] Figure 2 qPCR was used to detect differentially expressed tsRNAs, and the results showed that tRF-28-Q99P9P9NH50E was the most significantly upregulated tsRNA in liver cancer tissues.

[0027] Figure 3 Figure 2 shows the expression of tRF-28-Q99P9P9NH50E in HCC tissues and cells. (A) tRF-28-Q99P9P9NH50E is highly expressed in HCC tissues. (B) tRF-28-Q99P9P9NH50E is highly expressed in HCC cancer cell lines (SK-Hep-1, SMMC-7721, HepG2, Huh7, and Hep3B) relative to normal human hepatocytes (LO2). (C) Knockdown of tRF-28-Q99P9P9NH50E inhibits expression in Huh7 and Hep3B cells. (Statistical analysis between the two groups was performed using an independent-samples t-test; * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001.)

[0028] Figure 4 The tRF-28-Q99P9P9NH50E inhibitor significantly inhibits Hep3B cell proliferation and migration. (A) The tRF-28-Q99P9P9NH50E inhibitor significantly inhibits the proliferation of Huh7 and Hep3B cells; (B) The tRF-28-Q99P9P9NH50E inhibitor reduces the formation of Hep3B cell colonies; (C) The tRF-28-Q99P9P9NH50E inhibitor inhibits the invasion and migration of Hep3 cells. (Statistical analysis between the two groups was performed using an independent-samples t-test; * indicates p < 0.05, ** indicates p < 0.01). Specific implementation method:

[0029] The following specific embodiments are intended to further illustrate the present invention, but are not intended to limit the present invention.

[0030] Patient samples were collected: ① Liver cancer cases diagnosed by imaging and confirmed by pathology; ② All samples were preoperative and had not received chemoradiotherapy or neoadjuvant therapy; ③ Each patient's tissue specimen included the primary liver cancer lesion tissue and paired normal non-cancerous tissue at least 5 cm away from the primary lesion; ④ Clinical samples were collected to gradually complete clinical data, including the patient's name, gender, age, hospitalization number, pathological type, pathological stage, and treatment status. Consent was obtained for all clinical samples collected.

[0031] Cell types: Human normal hepatocytes (LO2) and human hepatoma cell lines (SK-Hep-1, SMMC-7721, HepG2, Huh7, and Hep3B) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cells were maintained in a suitable culture environment (5% CO2, 37°C) and cultured in high-glucose DMEM (supplemented with 10% FBS).

[0032] Example 1: RNA-Seq sequencing to screen differentially expressed tsRNAs

[0033] RNA-Seq sequencing was performed on liver cancer tissues to screen for differentially expressed tRNAs. This part of the experiment was completed by Guangzhou Ruibo Biotechnology Co., Ltd. The specific steps are as follows: First, the total RNA sample was pre-treated and then cDNA was synthesized. Green gPCR Master Mix and cDNA template were loaded into a well plate and amplified using an ABI7900 real-time fluorescence quantitative PCR instrument. TRNAs with significantly abnormal expression were screened based on a fold change ≥ 2 and a p-value < 0.05.

[0034] RNA-seq result analysis:

[0035] RNA sequencing was performed on total RNA obtained from 5 pairs of HCC and normal tissues. Figure 1Based on the differential expression levels of dysregulated tsRNAs (|fold change| ≥ 2 and p-value < 0.05), we selected five significantly upregulated tsRNAs for further validation by qPCR in 10 pairs of HCC tissues and corresponding normal tissues. The results showed that tRF-31-Q99P9P9NH57SD, tRF-28-Q99P9P9NH50E, tRF-26-VIJK7PF59ME, tRF-36-PSQP4PW3FJI0E7E and tRF-20-B4ZPEK45 were upregulated in HCC tissues, and tRF-28-Q99P9P9NH50E was the most significantly upregulated in HCC tissues ( Figure 2 ).

[0036] Example 2: qPCR detection of the expression of tRF-28-Q99P9P9NH50E inhibitor

[0037] A synthetic inhibitor (sequence AACUGUGAUAACCACUACACUACAGAAGC) was transfected into liver cancer cells using Lipo3000. The medium was changed every 6-8 hours. After 48 hours of continuous culture, the cells were harvested, lysed with Trizol, and frozen at -20°C for RNA extraction to detect tRF-28-Q99P9P9NH50E expression.

[0038] RNA extraction process:

[0039] (1) Place the lysed cells and tissues on ice at room temperature for 5 minutes to allow for complete lysis. Add 200 μL of chloroform to each tube of tissue or cell lysate, shake vigorously for 15 seconds, and place at low temperature for 5 minutes to allow the layers to separate.

[0040] (2) Centrifuge at 2-8°C, 12,000 rpm for 15 minutes. The sample separates into three layers: the organic phase at the bottom is red, the protein layer in the middle is white, and the aqueous phase at the top is colorless. The nucleic acid in the top layer is what we need.

[0041] (3) Pipette 450 μL of the upper layer liquid into a new enzyme-free tube, add 450 μL of isopropanol, gently invert the tube to mix, and let it stand at low temperature for 15 minutes.

[0042] (4) Centrifuge at 2-8°C, 12,000 rpm for 15 minutes. A white precipitate will appear at the bottom of the tube after centrifugation. Gently pour off the supernatant and carefully retain the precipitate at the bottom.

[0043] (5) Add 1 mL of 75% ethanol to each tube until the precipitate floats off the tube wall (75% ethanol is prepared with DEPC water). Centrifuge at 7500 rpm for 5 minutes at 2-8°C. Discard the supernatant. Repeat this step twice, centrifuging once and discarding the supernatant.

[0044] (6) Dissolve the white precipitate in nuclease-free water to obtain RNA. Promote dissolution: incubate at 50-60°C or in a refrigerator at 4°C overnight.

[0045] cDNA preparation process:

[0046] (1) Follow the instructions of the reverse transcription kit:

[0047]

[0048]

[0049] After mixing thoroughly, add the following ingredients:

[0050]

[0051] (2) Reaction procedure:

[0052] 25℃ 5 minutes

[0053] 42℃ 60 minutes

[0054] 70℃ 5 minutes

[0055] (3) The reaction is completed on a PCR instrument. After the reaction is complete and each tube has cooled to 12°C, the sample is removed for subsequent experiments or stored at -20°C for long-term storage.

[0056] QPCR experimental steps and reaction procedures

[0057] (1) Reaction system

[0058]

[0059] (2) The reaction procedure is as follows:

[0060]

[0061]

[0062] (3) Export the reaction results and calculate the Ct, ΔCt and 2 of the target gene and reference gene -ΔΔCt Calculation method:

[0063] The Ct value was calculated by ABI 7500Manager software; ΔCt1 = Ct of the gene to be tested in the experimental group - Ct of the reference gene in the experimental group; ΔCt2 = Ct of the gene to be tested in the control group - Ct of the reference gene in the control group; ΔΔCt = ΔCt1 - ΔCt2; 2 -ΔΔCt The results were calculated by the formula. Graph RAD prism7 was used to make a bar graph to analyze the expression of tRF-28-Q99P9P9NH50E in cells. -ΔΔCt The independent sample t test was used to analyze the expression of tRF-28-Q99P9P9NH50E in cells. -ΔΔCt value.

[0064] Expression of tRF-28-Q99P9P9NH50E in HCC cells and knockdown of tRF-28-Q99P9P9NH50E expression ( Figure 3 AC).

[0065] Example 3: Inhibitory effect of knockdown of tRF-28-Q99P9P9NH50E on liver cancer cells

[0066] To better detect the inhibitory effect of tRF-28-Q99P9P9NH50E knockdown on liver cancer cells, CCK-8, invasion and migration experiments were used to evaluate the effect of tRF-28-Q99P9P9NH50E knockdown on liver cancer cells.

[0067] (1) CCK-8 and colony formation assay: In the CCK-8 assay, 10 3 Cells were seeded into 96-well plates at a density of 100 cells / well. From day 0 to day 4, 10 mL of CCK-8 was added to each well. The cells were incubated in a 37°C, 5% CO2 incubator for 2 hours, then removed and the OD value was measured at a wavelength of 450 nm using a microplate reader. For the colony formation assay, 3000–5000 cells / well (depending on cell growth) were seeded into 6-well plates for each experimental group. The cells were cultured in a 37°C, 5% CO2 incubator for 14–18 days. Colonies were fixed with methanol and stained with crystal violet. The gel imager was used to image the colonies to determine the specific number of colonies.

[0068] (2) Cell invasion and migration assay: HCC cells were seeded in the upper chamber with serum-free DMEM, and the lower chamber was filled with culture medium containing 10% fetal bovine serum as an attractant. After 48 h, the cells were fixed with 4% PFA in Matrigel (Sigma-Aldrich, USA) and stained with 0.1% crystal violet (Beyotime, Shanghai, China). Cells were observed and photographed under a light microscope, and 10 fields of view were selected for counting to reflect cell mobility. Three independent experiments were performed.

[0069] The experimental results showed that knocking down tRF-28-Q99P9P9NH50E could significantly inhibit the proliferation, invasion and migration of liver cancer cells ( Figure 4 The results suggest that knocking down tRF-28-Q99P9P9NH50E has an inhibitory effect on liver cancer cells.

Claims

1. Use of an agent for inhibiting tRF-28-Q99P9P9NH50E expression in the preparation of a preparation for treating liver cancer, wherein the tRF-28-Q99P9P9NH50E has a cDNA sequence of GCTTCTGTAGTGTAGTGGTTATCACGTT; The reagent for inhibiting the expression of tRF-28-Q99P9P9NH50E includes: a tRF-28-Q99P9P9NH50E inhibitor, and the sequence of the tRF-28-Q99P9P9NH50E inhibitor is AACUGUGAUAACCACUACACUACAGAAGC.

2. Use of a reagent for detecting tRF-28-Q99P9P9NH50E in the preparation of a preparation for diagnosis and / or prognosis of liver cancer, wherein the cDNA sequence of the tRF-28-Q99P9P9NH50E is GCTTCTGTAGTGTAGTGGTTATCACGTT.

3. The use according to claim 2, characterized in that Reagents for detecting tRF-28-Q99P9P9NH50E include PCR detection reagents.

4. The use according to claim 3, characterized in that The primer sequences for the PCR detection reagents are as follows: F:5-GCTTCTGTAGTGTAGTGGTTAT-3 R:5:-GTCGTATCCAGTGCAGGGTCCGAGGT-3.

Images