Identification of a Wheat Powdery Mildew Resistance QTL, Its Linked KASP Marker, and Their Applications

Abstract

The present invention discloses the identification of a wheat powdery mildew resistance QTL, its linked KASP markers and their applications. The QTL is located on wheat chromosome 2A, and the KASP markers closely linked to it are Kasp_ 2AS_PMR , and these markers can be used for QPMR.saas - 2AS assistant selection. The sequences of the KASP primers used for amplifying the markers are detailed in the text. The method for screening wheat containing powdery mildew resistance genes is to use the genomic DNA of the wheat to be tested as a template, perform PCR amplification with the KASP primers in the sequence listing, and identify the genotypes of the markers Kasp_ 2AS_PMR closely linked to the QTL in the amplification products. The volume of the amplification reaction for powdery mildew resistance is 4 μl, and the reaction system is as follows: 0.048 μl Primer Mix, 2.0 μl Master Mix, 1.952 μl Template DNA (50 ng / μl). The ratio of Primer Mix is: 12% HEX primer, 12% FAM primer, 30% Common primer. The amplification is performed using a 384-well PCR instrument.

Description

Technical Field

[0001] The present invention relates to the identification of a wheat powdery mildew resistance QTL and its linked KASP markers. Background Art

[0002] Common wheat is one of the most important staple crops in the world. Wheat production is largely restricted by various biotic stresses. Therefore, breeding high-yield and stable-yield varieties under biotic stresses is an important goal of wheat breeding. Wheat powdery mildew is a fungal disease caused by Blumeria graminis f. sp. tritici. The incidence of powdery mildew is on the rise in the main wheat-growing areas of China, seriously threatening the safety of wheat production. Compared with other prevention and control measures, breeding resistant varieties is the most economical and effective method for controlling this disease.

[0003] Since the 1970s, more than 150 adult plant resistance QTLs to wheat powdery mildew have been mapped on the 21 chromosomes of wheat. Chae et al. first mapped two adult plant resistance QTLs to powdery mildew located on 2D and 6D in the wheat cultivar Diplomat using the haploid analysis method. Yang et al. used a recombinant inbred line population to map 4 adult plant resistance QTLs to powdery mildew, which were located on chromosomes 1B, 2B, 2D, 3A, 3B, 5A, 5B, 6A, 6B, 6D and 7D respectively. Kang et al. used genome-wide association analysis to map 14 adult plant resistance QTLs to powdery mildew, which were located on chromosomes 2A, 3A, 5A and 6A respectively. Although a large number of wheat powdery mildew resistance genes have been mapped, only a few genes have been cloned. Due to the fast mutation rate of the wheat powdery mildew pathogen, some genes such as Pm1, Pm3a, Pm3b, Pm3c, Pm5, Pm7 etc. have lost their resistance, and some genes are linked to unfavorable traits. Therefore, the genes truly applied in wheat breeding are very limited. Therefore, exploring new powdery mildew resistance genes (QTLs) and developing tightly linked markers provide support for breeding powdery mildew-resistant varieties.

[0004] KASP markers have been widely used to detect SNP loci in crops such as wheat, rice and maize. Without electrophoresis, high-throughput genotyping can be achieved. Summary of the Invention

[0005] The present invention relates to a powdery mildew resistance gene QTL and its linked molecular markers, which can be used for molecular marker-assisted selection of powdery mildew resistance in breeding.

[0006] The KASP markers tightly linked for screening powdery mildew resistance QTL provided by the present invention Kasp_2AS_PMR , and their sequences are as follows:

[0007] The sequence of primer A: GAAGGTGACCAAGTTCATGCTTTGAATGCTGTCGAGCTACTAT

[0008] Primer B sequence: GAAGGTCGGAGTCAACGGATTTTGAATGCTGTCGAGCTACTAC

[0009] Primer C sequence: TGTGAGGATGATTTTGGGGTTT

[0010] Note: GAAGGTGACCAAGTTCATGCT is the tag sequence FAM,

[0011] GAAGGTCGGAGTCAACGGATT is the tag sequence HEX;

[0012] SNP marker sequence: BobWhite_rep_c62964_873 : (at the 50th position)

[0013] ACTAGCATAATGTTAAAAAAGGGGGTAAAATTTAACAGATGTAGCCTTTCA Y GTAGTAGCTCGACAGCATTCAAGATCTTAAGCTAAGTATGGAAAGTGCAGG.

[0014] Principle of KASP: Three primers are required for amplification, two forward competitive primers (the 5'-ends of the primers have base sequences complementary to the fluorescent groups HEX and FAM, and the other sequences only differ at the SNPs and InDels at the 3'-ends) and one reverse common primer; the PCR reaction system contains a universal sequence modified with a fluorescent group and a quenching group (Master Mix is provided by LGC), so the forward primers can specifically bind to the DNA of the same genotype as theirs. The two forward primers can emit two different colors of light. If the site in the template strand is homozygous, a single, matching fluorescence will be emitted. If it is heterozygous, two fluorescences can be emitted simultaneously.

[0015] The KASP marker PCR amplification system, with each 4-µl reaction system as follows: 0.048 μl of Primer Mix, 2.0 μl of Master Mix, 1.952 μl of Template DNA (50 ng / μl). The Master Mix was purchased from LGC company. The ratio of Primer Mix is: 12% HEX primer, 12% FAM primer, 30% Common primer. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd. Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000TM Thermal Cycler), and the program was as follows: 94°C for 15 min; 94°C for 20 s, 65 - 57°C for 1 min (decreasing 0.8°C per cycle), for 10 cycles; 94°C for 20 s, 55°C for 60 s, for 32 cycles. The PCR amplification products were placed in an automatic focusing fluorescence multifunctional microplate reader (PHERAstarplus SNP, BMG LABTECH) to read the final fluorescence data, and then the data was imported into the Klustercaller v3.4 software (LGC, Hoddesdon, UK) for genotyping.

[0016] The method for PCR amplification of primer pairs (markers) for powdery mildew resistance with a 4-µl amplification reaction system is as follows: 0.048 μl of Primer Mix, 2.0 μl of Master Mix, 1.952 μl of Template DNA (50 ng / μl). The ratio of Primer Mix is: 12% HEX primer, 12% FAM primer, 30% Common primer. Amplification was performed using a 384-well PCR instrument, and the program was as follows: 94°C for 15 min; 94°C for 20 s, 65 - 57°C for 1 min, decreasing 0.8°C per cycle, for 10 cycles; 94°C for 20 s, 55°C for 60 s, for 32 cycles.

[0017] The method for detecting amplification products is to place the amplification products in an automatic focusing fluorescence multifunctional microplate reader to read the final fluorescence data, and then import the data into software for genotyping.

[0018] The application of the primer pairs (markers) in the preparation of a kit for assisting in screening wheat powdery mildew resistance QTL.

[0019] A kit for assisting in screening wheat powdery mildew resistance QTL, containing the primer pairs (markers).

[0020] The application of the kit in wheat breeding.

[0021] The above method and the above kit both fall within the protection scope of the present invention.

[0022] Beneficial effects: The present invention uses the genotype data of wheat SNP chips for QTL mapping and genome-wide association analysis, converts linked SNPs into KASP markers, and can be directly applied to marker-assisted selection breeding. The present invention constructs a recombinant inbred line (RIL) population including 252 families using Doumai and Shi 4185. The present invention performs QTL analysis on the powdery mildew resistance of this RIL population using the genetic map constructed by the 90K chip, and detects a QTL that stably exists under multiple environmental conditions, located on chromosome 2A, and the closely linked marker is BobWhite_rep_c62964_873 (105.1 Mb); it can explain 5.6 - 7.6% of the phenotypic variation, and is named QPMR.saas-2AS , based on its closely linked marker BobWhite_rep_c62964_873 The developed KASP marker Kasp_2AS_PMR can be used for marker-assisted breeding.

[0023] The present invention also protects a QTL of wheat powdery mildew resistance gene and its linked molecular marker. This QTL is named QPMR.saas-2AS , located on chromosome 2A, and its closely linked SNP marker is BobWhite_rep_c62964_873 (105.1 Mb), which can explain 5.6 - 7.6% of the phenotypic variation. Specifically, the molecular marker can be obtained by amplifying the genomic DNA of Doumai and Shi 4185 with the primer pair. The present invention provides a marker for the QTL of wheat powdery mildew resistance gene, which can be used for molecular marker-assisted screening of the gene.

[0024] The molecular marker can be applied to the assisted selection of wheat powdery mildew resistance genes in wheat breeding.

[0025] This molecular marker is accurate, efficient, convenient and stable for amplification, easy to operate, and quick to take effect. It can be used for marker-assisted selection to improve the identification efficiency.

[0026] This QTL is located on wheat chromosome 2A, and its closely linked KASP marker is Kasp_2AS_PMR , and this marker can be used for QPMR.saas-2AS assisted selection. The KASP primer sequences for amplifying the marker are shown in the text. The method for screening wheat varieties containing powdery mildew resistance genes is to use the genomic DNA of the wheat to be tested as a template, perform PCR amplification with the KASP primers in the sequence listing, and identify the genotypes of the amplification products that are closely linked to the QTL marker Kasp_2AS_PMR . Brief description of the drawings

[0027] Figure 1 KASP marker Kasp_2AS_PMR Genotyping results of 100 wheat varieties Detailed implementation manners

[0028] The following embodiments facilitate a better understanding of the present invention, but do not limit the present invention. The experimental methods in the following embodiments are all conventional methods unless otherwise specified. The test materials used in the following embodiments can be purchased from conventional biochemical reagent stores unless otherwise specified.

[0029] In the embodiment, discovery of a powdery mildew resistance gene QTL in the wheat Doumai / Shi 4185 RIL population and acquisition of its KASP marker:

[0030] I. Obtaining of phenotypes

[0031] The Doumai / Shi 4185 RIL population was planted in Dezhou, Shandong and Shijiazhuang, Hebei in the 2021 - 2022 and 2022 - 2023 growing seasons. A completely randomized block design was adopted with three replicates, single - row plots, 1 m in row length, 0.3 m in row width, and 30 seeds were evenly sown in each row. Field management was carried out according to local conventions. The RIL population was identified for adult - plant resistance using a mixed inoculum of the current prevalent powdery mildew races E09 and E20 in China. Its disease index, maximum disease severity (MDS), showed continuous variation in the field, which was a typical quantitative trait inheritance. Genomic DNA of young leaves from 252 families was extracted using the modified CTAB method (Murray et al., 1980). The DNA concentration was measured using a NanoDrop2000c spectrophotometer, and the DNA samples were adjusted to a standard concentration of 50 ng / μl. Then, the DNA quality was detected using 0.8% agarose gel, and the DNA with qualified quality was subjected to SNP genotyping. SNP analysis was performed using the Illumina 90K SNP chip.

[0032] II. Construction of linkage map

[0033] The 90K SNP chip contained a total of 80,547 markers, and 11,012 markers were different between the parents. After removing markers with heterozygosity between parents and a missing rate greater than 10%, redundant markers were removed using the IciMapping 4.1 bin function. Then, according to the genetic distance and chromosome position information between markers, groups were formed to construct linkage groups, and the total length of the genetic map was 2030.0 cM.

[0034] III. QTL analysis

[0035] The IciMapping 4.1 ICIM - ADD method was used for QTL analysis, and a LOD value of 2.5 was selected. One stable QTL was mapped on chromosome 2A and named QPMR.saas-2AS , which was tightly linked to BobWhite_rep_c62964_873 (105.1 Mb). Under different environmental conditions, it could explain 5.6 - 7.6% of the phenotypic variation. Its tightly linked marker BobWhite_ rep_c62964_873 Converted to Kasp_2AS_PMR , and the genotypes of 100 wheat varieties were detected.

[0036] IV. Utilization of primer pairs

[0037] The experimental materials were 100 wheat varieties, as shown in Table 1 for details.

[0038] 1. One hundred wheat varieties in the Huanghuai wheat region were planted at the experimental sites in Gaoyi, Hebei, Shijiazhuang, Hebei, and Beijing during the 2020 - 2021 growing season. A completely randomized block design was adopted with three replicates, single - row plots, 1 m in row length, 0.3 m in row width, and 30 seeds were evenly sown in each row. Field management was carried out according to local practices. The adult - plant resistance of the RIL population was identified using a mixed inoculum of the current prevalent powdery mildew races E09 and E20 in China, and the maximum disease severity (MDS) was recorded. Genomic DNA of young leaves from 252 families was extracted using the modified CTAB method.

[0039] 2. Use Kasp_2AS_PMR markers to detect all experimental materials. The results are shown in Table 1 and Figure 1 .

[0040] Figure 1 Genotype detection map of Kasp_2AS_PMR in 100 varieties; Figure 1 Genotyping results of 100 wheat varieties by Kasp_2AS_PMR (red is the Doumai genotype AA, blue is the Shi 4185 genotype GG, and pink represents detection failure)

[0041] Among the 100 wheat varieties, 21 varieties showed the Shi 4185 genotype GG (red), with a powdery mildew MDS of 13.6; 77 varieties showed the Doumai genotype AA (blue), with a powdery mildew MDS of 19.5; statistical tests showed that QPMR.saas-2AS the gene effects reached significant differences ( P < 0.05) (Table 2).

[0042] Table 1 Genotype detection results and powdery mildew resistance of 100 wheat varieties.

[0043] serial number Variety name genotype Powdery mildew MDS (%) 1 Lumai 14 AA 5 2 Zhongmai 895 GG 5 3 11CA40 AA 26.25 4 Aca 601 AA 31.25 5 Dorico AA 8.75 6 Mantol AA 6.25 7 PH82-2 AA 51.25 8 Ab AA 15 9 Aifeng No.3 GG 13.75 10 Dwarf Anti-58 GG 25 11 Gaoyou 503 AA 15 12 Gaocheng 8901 AA 13.75 13 Hengguan 33 GG 20 14 Huapei No.5 GG 7.5 15 Huaimai 20 AA 11.25 16 Huaimai 21 AA 8.75 17 Jimai 19 NN 7.5 18 Jimai 20 AA 28.75 19 Jimai 21 AA 26.25 20 Jimai 22 AA 15 21 Jinan 13 AA 38.75 22 Jining 16 AA 23.75 23 Hebei Normal University 02-1 AA 15 24 Jinhe 9123 GG 8.75 25 Jinmai 61 AA 28.75 26 Lankao24 GG 8.75 27 Lankao No.2 GG 5 28 Lankao 906 GG 5 29 Good Star 66 AA 20 30 Linmai No.2 AA 12.5 31 Linmai No.4 AA 13.75 32 Lumai 11 AA 18.75 33 Lumai 15 AA 8.75 34 Lumai 21 AA 22.5 35 Lumai 23 AA 6.25 36 Lumai No.5 AA 30 37 Lumai No.8 AA 18.75 38 Lumai No.9 AA 50 39 Luyuan 502 AA 20 40 Lomai 21 AA 43.75 41 Neixiang 188 AA 18.75 42 Shannong 20 AA 6.25 43 Shaanxi 229 AA 18.75 44 Shaanxi 253 GG 10 45 Shaanxi 354 AA 27.5 46 Shaanxi 512 AA 6.25 47 Shaanxi wheat 94 AA 12.5 48 Shaanxi Agricultural 78-59 AA 38.75 49 Shaanxi Agricultural 981 AA 32.5 50 Shanyou 225 AA 12.5 51 Stone 4185 GG 43.75 52 Shijiazhuang 15 GG 6.25 53 No. 8 Shijiazhuang GG 7.5 54 Shixin828 AA 37.5 55 Taishan No.1 AA 12.5 56 Anhui 23094 AA 10 57 Wanmai 29 AA 13.75 58 Wanmai 33 AA 10 59 Wanmai 38 AA 8.75 60 Wanmai 50 NN 8.75 61 Wanmai 52 AA 11.25 62 Wanmai 53 AA 10 63 Wennong 14 AA 26.25 64 Wennong No.5 AA 13.75 65 Northwest A&F 2000-7 AA 27.5 66 Northwest A&F University 291 AA 12.5 67 Northwest A&F 88 AA 10 68 Xiaoyan54 AA 13.75 69 Xiaoyan81 AA 5 70 Xinmai 9408 AA 18.75 71 Tobacco Farmer 15 AA 30 72 Tobacco Farmer 18 AA 13.75 73 Tobacco Farmer 19 AA 21.25 74 Yumai 13 AA 13.75 75 Yumai 21 AA 41.25 76 Yumai 34 AA 10 77 Yumai 35 AA 15 78 Yumai 47 AA 6.25 79 Yumai 50 AA 45 80 Yumai 57 GG 15 81 Yumai 63 AA 6.25 82 Zheng 9023 AA 48.75 83 Zhengyin No. 1 GG 25 84 892 AA 27.5 85 Zhongmai 871 GG 10 86 Zhongmai 875 AA 6.25 87 Zhongyu No.9 AA 66.25 88 Zhou 8425B AA 6.25 89 Zhou Mai 11 AA 8.75 90 Zhou Mai 12 AA 13.75 91 Zhou Mai 13 GG 12.5 92 Zhou Mai 18 GG 10 93 Zhou Mai 22 AA 5 94 Zhou Mai 23 AA 12.5 95 Zhou Mai 28 GG 8.75 96 Zhou Mai 30 AA 22.5 97 Zhou Mai 31 GG 22.5 98 Zhou Mai 32 GG 16.25 99 Zimai 12 AA 6.25 100 Zixuan No.2 AA 27.5

[0044] AA is the Doumai genotype; GG is the Shi 4185 genotype; "NN" represents missing genotype data.

[0045] Table 2 QPMR.saas-2AS Powdery mildew resistance effects of 100 natural populations

[0046]

[0047] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. It should be noted that for those of ordinary skill in the art, several improvements and modifications can be made without departing from the technical principle of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Application of a KASP primer set in preparing a kit for assisting in screening wheat powdery mildew resistance QTL, characterized in that: The KASP primer set includes primer A, primer B, and primer C, wherein the nucleotide sequence of primer A is: GAAGGTGACCAAGTTCATGCTTTGAATGCTGTCGAGCTACTAT; The nucleotide sequence of primer B is: GAAGGTCGGAGTCAACGGATTTTGAATGCTGTCGAGCTACTAC; The nucleotide sequence of primer C is: TGTGAGGATGATTTTGGGGTTT; Among them, GAAGGTGACCAAGTTCATGCT is the tag sequence FAM, GAAGGTCGGAGTCAACGGATT is the tag sequence HEX.

2. Use of the KASP primer set described in claim 1 in breeding for wheat powdery mildew resistance traits.

Images