A polypeptide 125, biomaterials containing polypeptide 125, and their applications

By designing peptide 125 and chimeric lysozyme, the problem of poor control effect against Gram-negative bacteria in existing technologies has been solved. The efficient preparation and broad-spectrum antibacterial activity of peptide 125 and chimeric lysozyme have been achieved, expanding their application prospects in biomedicine and food industry.

CN118420716BActive Publication Date: 2025-10-31QINGDAO AGRI UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410669617.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-28
Publication Date
2025-10-31
Estimated Expiration
2044-05-28

AI Technical Summary

Technical Problem

Existing antibiotics are not very effective in controlling drug-resistant bacteria, especially Gram-negative bacteria. Furthermore, phage lysozymes have difficulty penetrating the outer membrane to hydrolyze the peptidoglycan layer, which limits their application.

Method used

A polypeptide 125 and its related nucleic acid molecules and biomaterials were designed. By chimerically attaching polypeptide 125 to the C-terminus of phage lysozyme, the lysozyme was endowed with extracellular lysing activity against Gram-negative bacteria. Recombinant expression strains were constructed, and the efficient preparation of polypeptide 125 and chimeric lysozyme was achieved.

Benefits of technology

Polypeptide 125 and chimeric lysozyme exhibit broad-spectrum antibacterial activity, showing good efficacy against a variety of bacteria such as Escherichia coli, Salmonella, Pseudomonas aeruginosa, Staphylococcus aureus, and Klebsiella pneumoniae, thus broadening the application range of lysozyme and enhancing the research and application potential of antibacterial drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118420716B_ABST
    Figure CN118420716B_ABST
Patent Text Reader

Abstract

This invention relates to the field of genetic engineering technology, and discloses a polypeptide 125, biomaterials containing polypeptide 125, and their applications. The amino acid sequence of polypeptide 125 is shown in SEQ ID NO: 2, and the nucleic acid molecule encoding polypeptide 125 is shown in SEQ ID NO: 1. The sequence provided by this invention for encoding polypeptide 125 results in polypeptide 125 that is biologically stable, has good tolerance to physicochemical factors, a broad cleavage spectrum, high cleavage activity, and rapid antibacterial action. Furthermore, through a chimeric approach, it can enhance the antibacterial ability of various bacteriophage lysozymes, exhibiting universality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically, to a polypeptide 125, biomaterials containing polypeptide 125, and their applications. Background Technology

[0002] In recent years, the overuse and improper application of antibiotics have led to a drug resistance crisis, a phenomenon that seriously threatens public health security. Escherichia coli, as an opportunistic pathogen, includes both intestinal and extraintestinal pathogens and is an important bacterial pathogen in poultry farming. Currently, antibiotic research and development has stalled, making the research of safe and effective new antimicrobial agents urgently needed to address the control of drug-resistant bacteria.

[0003] Antimicrobial peptides are a class of small, bioactive polypeptides induced in vivo. They are diverse and amphiphilic. They directly disrupt cell membranes and lyse bacterial cells by substituting divalent phospholipid cations that stabilize cell membrane structures. Due to their wide availability, novel antimicrobial peptide molecules are constantly being discovered and reported. Currently, antimicrobial peptides have entered clinical applications in the medical field, and due to the widespread spread of drug-resistant bacteria, they are also gradually gaining attention in the aquaculture industry.

[0004] Bacteriophage lysozyme, as an alternative antibacterial therapy, has enormous clinical application potential. As a phage-encoded hydrolase, it targets the peptidoglycan layer of the bacterial cell wall and hydrolyzes specific glycosidic bonds, playing a crucial role in the release of progeny phages after phage replication. Since the outer membrane of Gram-positive bacteria is mainly composed of peptidoglycan, lysozyme possesses highly efficient lytic activity and has been widely used in the control of Gram-positive bacteria in medical, food, and other fields. However, due to the presence of an outer membrane in Gram-negative bacteria, lysozyme has difficulty penetrating the outer membrane to hydrolyze the peptidoglycan layer, thus limiting its application. By modifying and engineering the C-terminus or N-terminus of lysozyme, it can be made capable of penetrating the outer membrane, achieving extracellular lysis of Gram-negative bacteria. Therefore, researchers are dedicated to developing phage lysozymes capable of extracellular lysis of Gram-negative bacteria to expand their application scope. Summary of the Invention

[0005] In view of this, the present invention proposes a polypeptide 125, biomaterials containing polypeptide 125 and their applications, aiming to propose a polypeptide with antibacterial function, and at the same time propose a new bacteriophage lysin capable of extracellular lysis of Gram-negative bacteria.

[0006] The present invention proposes a polypeptide, wherein the polypeptide is polypeptide 125, and its amino acid sequence is shown in SEQ ID NO: 2.

[0007] The present invention also proposes a nucleic acid molecule encoding the said polypeptide, wherein the nucleic acid molecule is any of the following:

[0008] A1) The coding sequence is the DNA molecule shown in SEQ ID No. 1;

[0009] A2) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 1.

[0010] The present invention also proposes a biomaterial, wherein the biomaterial is any one of the following:

[0011] B1) An expression cassette containing the nucleic acid molecule;

[0012] B2) A recombinant vector containing the nucleic acid molecule or a recombinant vector containing the expression cassette described in B1);

[0013] B3) Recombinant microorganisms containing the nucleic acid molecule, or recombinant microorganisms containing the expression cassette of B1), or recombinant microorganisms containing the recombinant vector of B2);

[0014] B4) A cell line containing the nucleic acid molecule, or a cell line containing the expression cassette of B1), or a cell line containing the recombinant vector of B2).

[0015] The present invention also proposes an application of the said polypeptide or said nucleic acid molecule, characterized in that the application is any one of the following:

[0016] C1) Disruption of bacterial membrane potential;

[0017] C2) Preparation of products that disrupt bacterial membrane potential;

[0018] C3) Inhibits bacterial activity;

[0019] C4) Prepare drugs that inhibit bacterial activity.

[0020] Preferably, the bacteria include one or more of Escherichia coli, Salmonella, Pseudomonas aeruginosa, Staphylococcus aureus, and Klebsiella pneumoniae.

[0021] The present invention also proposes a composition comprising the polypeptide or the nucleic acid molecule, and a pharmaceutically acceptable carrier or excipient.

[0022] Preferably, the composition has at least one of the following functions:

[0023] D1) Antibacterial;

[0024] D2) Treatment and / or prevention and / or adjunctive treatment of diseases caused by bacterial infections;

[0025] D3) Disrupts bacterial membrane potential.

[0026] Preferably, the bacteria include one or more of Escherichia coli, Salmonella, Pseudomonas aeruginosa, Staphylococcus aureus, and Klebsiella pneumoniae.

[0027] The present invention also proposes a nucleic acid molecule encoding a chimeric lysozyme, wherein the nucleic acid molecule is obtained by linking the C-terminus of the bacteriophage lysozyme sequence to the nucleic acid molecule.

[0028] Preferably, the phage lysozyme sequence is 14008099, 79713931, 64469838, or 64469839.

[0029] The present invention also proposes a biomaterial, wherein the biomaterial is any one of the following:

[0030] E1) An expression cassette containing the nucleic acid molecule;

[0031] E2) A recombinant vector containing the nucleic acid molecule or a recombinant vector containing the expression cassette of E1;

[0032] E3) Recombinant microorganisms containing the nucleic acid molecule, or recombinant microorganisms containing the expression cassette of E1), or recombinant microorganisms containing the recombinant vector of E2);

[0033] E4) A cell line containing the nucleic acid molecule, or a cell line containing the expression cassette of E1), or a cell line containing the recombinant vector of E2).

[0034] The present invention also proposes a chimeric lysozyme, wherein the chimeric lysozyme is expressed by the gene sequence encoding the chimeric lysozyme or by the biological material.

[0035] The present invention also proposes a recombinant expression strain, characterized in that the recombinant expression strain expresses the chimeric lysozyme.

[0036] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0037] Through in-depth research and meticulous design, this invention successfully proposes a polypeptide and its related nucleic acid molecules, biomaterials, and applications, as well as a chimeric lysozyme and its related nucleic acid molecules, biomaterials, and recombinant expression strains. Compared with existing technologies, the beneficial effects of this invention are mainly reflected in the following aspects:

[0038] First, the polypeptide proposed in this invention possesses a unique amino acid sequence, enabling it to effectively lyse bacteria by disrupting their membrane potential. This polypeptide exhibits broad-spectrum antibacterial activity, demonstrating excellent antibacterial effects against a variety of bacteria, including *Escherichia coli*, *Salmonella*, *Pseudomonas aeruginosa*, *Staphylococcus aureus*, and *Klebsiella pneumoniae*. Therefore, the polypeptide of this invention has significant application value in the preparation of antibacterial drugs or the treatment of diseases caused by bacterial infections.

[0039] Secondly, the nucleic acid molecules encoding peptides proposed in this invention provide a stable and reliable gene source for peptide preparation and application. By cloning and expressing these nucleic acid molecules, peptides with antibacterial activity can be obtained efficiently, providing strong support for the research and development and production of antibacterial drugs.

[0040] Furthermore, this invention also proposes a nucleic acid molecule encoding a chimeric lysozyme and its related biomaterials, the chimeric lysozyme, and a recombinant expression strain. The chimeric lysozyme combines the sequence of a bacteriophage lysozyme and the sequence of the polypeptide of this invention, thereby acquiring extracellular lytic activity against Gram-negative bacteria and exhibiting stronger antibacterial activity and a broader antibacterial spectrum. Specifically, this invention successfully achieves the efficient preparation of the chimeric lysozyme, thus opening up new ideas and directions for the application of lysozyme. Under normal circumstances, lysozyme does not possess extracellular lytic activity against Gram-negative bacteria. However, in this invention, by chimericly incorporating polypeptide 125 into the lysozyme, extracellular lytic activity was successfully endowed into lysozyme that originally lacked it; and for a few lysozymes that already possessed extracellular lytic activity, their activity levels were significantly enhanced. This innovative technological breakthrough is expected to provide a broader prospect for the application of lysozyme in the fields of biomedicine and the food industry.

[0041] In summary, this invention provides new ideas and methods for the research and application of antibacterial drugs by innovatively proposing a series of technical solutions, including peptides, nucleic acid molecules, biomaterials, chimeric lysozymes, and recombinant expression strains. Attached Figure Description

[0042] Various other advantages and benefits will become apparent to those skilled in the art upon reading the following detailed description of preferred embodiments. The accompanying drawings are for illustrative purposes only and are not intended to limit the invention. Furthermore, the same reference numerals denote the same parts throughout the drawings. In the drawings:

[0043] Figure 1 The images show the high-performance liquid chromatography (HPLC) and mass spectrometry (MS) detection results of polypeptide 125 obtained in Example 1 of this invention, where A represents HPLC detection and B represents mass spectrometry detection.

[0044] Figure 2 This is a characteristic diagram of 19 amino acids of polypeptide 125 obtained in Example 1 of the present invention;

[0045] Figure 3 The graph shows the results of factors affecting the activity of peptide 125 obtained in Example 1 of the present invention. In the graph, A is the result of the determination of the minimum effective concentration, B is the result of the determination of the effect of pH on the cleavage activity of peptide 125, C is the result of the determination of the effect of temperature on the cleavage activity of peptide 125, and D is the result of the determination of the effect of serum on the cleavage activity of peptide 125.

[0046] Figure 4 The image shows the host profile determination results of polypeptide 125 obtained in Example 1 of this invention, where A is Escherichia coli, B is Salmonella, C is Pseudomonas aeruginosa, D is Staphylococcus aureus, and E is Klebsiella pneumoniae.

[0047] Figure 5 The graph shows the measurement results of bacterial membrane surface potential treated with polypeptide 125 obtained in Example 1 of the present invention. In the graph, A is the positive control, B is the negative control, C is the pCo l d-TF protein treatment group, and D is the polypeptide 125 treatment group.

[0048] Figure 6 The image shows the PCR verification results of the chimeric lysozyme obtained in Example 5 of this invention. Lane M represents the standard nucleic acid molecular weight, lane 1 is lys-B-125, lane 2 is S10-lys2-125, lane 3 is Swi2-lys1-125, and lane 4 is Swi2-lys2-125.

[0049] Figure 7 The image shows the SDS-PAGE verification results of the chimeric lysozyme obtained in Example 5 of this invention. Lane M is the standard protein molecule, lane 1 is BL21(DE3) bacterial culture, lane 2 is pCo l d-TF protein, lane 3 is Swi2-lys1-125 protein, lane 4 is Swi2-lys2-125 protein, lane 5 is S10-lys2-125 protein, and lane 6 is lys-B-125 protein.

[0050] Figure 8 The graph shows the results of the chimeric lysozyme activity assay obtained in Example 5 of the present invention, where A is E. coli JM110 and B is S. enterica 35;

[0051] Figure 9 The image shows the host spectrum determination results of Lys-B-125 obtained in Example 5 of the present invention, where A represents Escherichia coli, B represents Salmonella, and C represents Pseudomonas aeruginosa. Detailed Implementation

[0052] Exemplary embodiments of the present disclosure will now be described in more detail with reference to the accompanying drawings. While exemplary embodiments of the present disclosure are shown in the drawings, it should be understood that the present disclosure may be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present disclosure and to fully convey the scope of the disclosure to those skilled in the art. It should be noted that, unless otherwise specified, embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0053] Example 1: Synthesis and Characterization of Peptide 125

[0054] After chemical synthesis of polypeptide 125, the product was subjected to high-performance liquid chromatography and mass spectrometry to evaluate its purity. The results are as follows: Figure 1 As shown. The amino acid sequence of peptide 125 was analyzed using Protean software, and the results are as follows. Figure 2 As shown. From Figure 2 It can be observed that the amino acid sequence of peptide 125 exhibits hydrophobic and positively charged properties, and these sequence features endow peptide 125 with natural lytic activity against Gram-negative and Gram-positive bacteria.

[0055] The nucleotide sequence encoding peptide 125 is shown in SEQ ID NO: 1; the amino acid sequence of peptide 125 is shown in SEQ ID NO: 2.

[0056] SEQ ID NO: 1:

[0057] CGTTGGAAACGTTGGTGGCGTTGGAAAAAAAAACGTAAATGGTGGGTTGTTGCTGCT.

[0058] SEQ ID NO: 2:

[0059] RWKRWWRWKKKRKWWVVAA.

[0060] Example 2 Factors affecting the activity of peptide 125

[0061] 2.1 Determination of the minimum effective concentration of peptide 125

[0062] Take fresh E. coli JM110 bacterial culture that has proliferated to the logarithmic phase and dilute it to 10⁻⁶. 5 CFU / mL and 10 6 CFU / mL. Take 60 μL of diluted bacterial culture and add equal volumes of different concentrations of peptide 125 (70 ng / μL, 35 ng / μL, 17.5 ng / μL). Incubate at 37℃ for 30 min, and then use 40 μL of the incubation solution to count colonies by pouring. A control of equal concentration of pCo l d-TF protein was used. The experiment was repeated three times, and the minimum effective concentration was determined. The in vitro activity assay results are as follows: Figure 3 As shown in Figure A.

[0063] 2.2 Effect of pH on the cleavage activity of peptide 125

[0064] Take 60 μL of the minimum effective concentration of protein and adjust its pH to 4, 5, 6, 7, 8, 9, and 10, respectively, and treat at 37°C for 30 min. Then add an equal volume of the protein diluted to 10. 5 CFU / mL and 10 6 CFU / mL of E. coli JM110 bacterial suspension was mixed by pipetting and incubated at 37°C for 30 min. 40 μL of the incubation solution was then used for colony counting via pouring. An equal concentration of pCo l d-TF protein was used as a control. The experiment was repeated three times. In vitro activity assay results are shown below. Figure 3 As shown in B.

[0065] 2.3 Effect of temperature on the cleavage activity of peptide 125

[0066] Take 60 μL of the minimum effective concentration of protein and treat it at 4℃, 20℃, 37℃, 50℃, 60℃, and 70℃ for 30 min, respectively. Add an equal volume of the protein diluted to 10⁻⁶. 5 CFU / mL and 10 6 CFU / mL of E. coli JM110 bacterial suspension was mixed by pipetting and incubated at 37°C for 30 min. 40 μL of the incubation solution was then used for colony counting via pouring. An equal concentration of pCo l d-TF protein was used as a control. The experiment was repeated three times. In vitro activity assay results are shown below. Figure 3 As shown in C.

[0067] 2.4 Effect of serum on the cleavage activity of peptide 125

[0068] Take fresh E. coli JM110 bacterial suspension that has proliferated to the logarithmic phase, and dilute the suspension to 10 μL with physiological saline containing serum concentrations of 100%, 50%, 25%, 12.5%, 6.25%, and 3.125%. 4 CFU / mL and 10 5 CFU / mL. Take 60 μL of diluted bacterial culture, add an equal volume of polypeptide 125 (70 ng / μL), mix well by pipetting, and incubate at 37℃ for 30 min. Take 40 μL of incubation solution for colony counting using the pour method. An equal concentration of pCo l d-TF protein was used as a control. The experiment was repeated three times. The results of the in vitro activity assay are as follows: Figure 3 As shown in D.

[0069] Depend on Figure 3 It was found that a concentration of 8.75 ng / μL of peptide 125 could reduce bacterial titer by 2 log units. Peptide 125 showed good tolerance to physicochemical factors, exhibiting highly significant differences from the control group at pH 4-6 and 4-70℃, resulting in a 2 log unit decrease in bacterial titer. Even at a 3% serum concentration, it could still reduce bacterial titer by 1 log unit.

[0070] Example 3: Host profile determination of peptide 125

[0071] Eighteen strains of freshly proliferated Escherichia coli, five strains of Salmonella, five strains of Pseudomonas aeruginosa, five strains of Staphylococcus aureus, and five strains of Klebsiella pneumoniae, which had reached the logarithmic growth phase, were diluted to 10⁻⁶. 5 CFU / mL and 10 6 CFU / mL. Take 60 μL of diluted bacterial culture, add an equal volume of minimum effective concentration of peptide 125, mix well by pipetting, and incubate at 37℃ for 30 min. Take 40 μL of incubation solution for colony counting using the pour method. Set up an equal concentration of pCo l d-TF protein as a control, and repeat the experiment three times. Host profile determination results are as follows. Figure 4 As shown.

[0072] according to Figure 4 The polypeptide 125 exhibited antibacterial activity against 18 strains of Escherichia coli, 5 strains of Salmonella, 5 strains of Pseudomonas aeruginosa, 5 strains of Staphylococcus aureus, and 5 strains of Klebsiella pneumoniae.

[0073] Example 4: Measurement of membrane surface potential of bacteria treated with peptide 125

[0074] Take 500 μL of fresh E. coli JM110 bacterial culture proliferated to the logarithmic phase, centrifuge at 12000 rpm for 1 min, discard the supernatant, and resuspend the bacterial cells in 1 mL PBS buffer. Repeat 3 times. Then add 500 μL of peptide 125 at the minimum effective concentration and incubate at 37 °C for 30 min. Centrifuge again at 12000 rpm for 1 min, discard the supernatant, and resuspend the bacterial cells in 1 mL PBS buffer. Repeat 2 times. Then centrifuge at 12000 rpm for 1 min, discard the supernatant, and resuspend the bacterial cells in 1 mL HEPES buffer. Repeat 2 times. Add 100 μL of 5 mM DiBAC4(3) membrane potential fluorescent probe to resuspend the bacterial pellet and incubate at 37 °C for 30 min. Set Ex / Em = 490 / 525 nm, and monitor the fluorescence intensity using a high-speed sorting flow cytometer BD FACS Aria Ill to determine the membrane surface potential. An equal concentration of pCo l d-TF protein was used as the protein control group. Positive and negative control groups were also established. The positive control group bacterial culture was boiled for 30 minutes, while the negative control group bacterial culture received no treatment. The bacterial membrane surface potential measurement results are as follows: Figure 5 As shown.

[0075] according to Figure 5 The increased fluorescence intensity of bacteria after treatment with peptide 125 indicates that peptide 125 can cause depolarization of the bacterial cell membrane.

[0076] Example 5125 Construction of Lysozyme Chip

[0077] In the GenBank database, the phage lysozyme sequences (Gene ID: 14008099, Gene ID: 79713931, Gene ID: 64469838, Gene ID: 64469839) were modified and engineered. A nucleotide sequence encoding polypeptide 125 was added to the C-terminus of these sequences using PCR technology, thereby obtaining the gene sequence encoding chimeric lysozyme. The gene sequences of lysozyme lys-B-125, lysozyme S10-lys2-125, lysozyme Swii2-lys1-125, and lysozyme Swii2-lys2-125 were obtained, with sequence lengths of 546 bp, 546 bp, 522 bp, and 336 bp, respectively. These gene sequences were ligated into the pCold-TF vector using homologous recombination to construct a recombinant expression vector. The constructed vector was transformed into *E. coli* BL21(DE3) competent cells, plated on nutrient agar containing 0.1 mM ampicillin, and incubated at 37°C for 12 hours. Verification was performed using universal primers for the vector (PCR amplification diagram shown). Figure 6 As shown. Figure 6 In the diagram, lane M represents the standard nucleic acid molecular weight, lane 1 is lys-B-125, lane 2 is S10-lys2-125, lane 3 is Swi2-lys1-125, and lane 4 is Swi2-lys2-125. The successfully validated BL21(DE3) clone containing the recombinant expression vector is preserved, i.e., the recombinant expression strain.

[0078] The recombinant expression strain was added to 5 mL of LB broth containing 0.1 mM ampicillin and cultured overnight at 37°C with shaking at 220 rpm. The BL21(DE3) positive clone was then inoculated at a 1:50 dilution into 100 mL of LB broth (containing 0.1 mM ampicillin) and cultured at 37°C with shaking at 220 rpm until OD (out of control) was reached. 600 The absorbance at 600 nm reached 0.4-0.6. Isopropyl thio-β-D-galactoside (IPTG) was added to a final concentration of 0.1 mM, and the mixture was induced at 16 °C for 16 hours to induce the expression of chimeric lysozyme, thereby obtaining a bacterial culture containing chimeric lysozyme.

[0079] Example 6 analyzes and identifies the expression and antibacterial activity of the chimeric lysozyme prepared in Example 5.

[0080] 6.1 Ultrasonic purification and SDS-PAGE identification of chimeric lysozyme

[0081] The induced bacterial culture was sonicated as follows: First, the bacterial culture was transferred to a 50 mL centrifuge tube and centrifuged at 12000 rpm for 2 min, discarding the supernatant. The precipitate was resuspended in 40 mL Tris-HCl buffer, mixed, centrifuged again, and the supernatant was discarded. This washing process was repeated once. Finally, the bacterial precipitate was resuspended in 5 mL Tris-HCl buffer. The resuspended culture was transferred to a 15 mL centrifuge tube, placed on ice, and sonicated for 3 seconds followed by a 3-second interval until the solution was clear. The centrifuge tube was then centrifuged at 12000 rpm at 4 °C for 10 min. The supernatant was filtered through a 0.22 μm filter and aliquoted into 1.5 mL centrifuge tubes (1 mL per tube) and stored at -80 °C.

[0082] Take 30 μL of supernatant into a 1.5 mL centrifuge tube, add 7 μL of 5×SDS buffer, mix well, and boil for 10 min. Centrifuge at 12000 rpm for 5 min, and perform SDS-PAGE electrophoresis analysis, using pCo l d-TF protein and BL21(DE3) bacterial culture as controls. The electrophoresis results are as follows. Figure 7 As shown.

[0083] Figure 7 In the diagram, lane M represents the standard protein molecule, lane 1 represents BL21(DE3) bacterial culture, lane 2 represents pCo l d-TF protein, lane 3 represents Swi2-lys1-125 protein, lane 4 represents Swi2-lys2-125 protein, lane 5 represents S10-lys2-125 protein, and lane 6 represents lys-B-125 protein. Figure 7 It can be seen that the chimeric lysozyme prepared in Example 5 was expressed efficiently in Escherichia coli, and its molecular weight was consistent with the expected molecular weight.

[0084] 6.2 Determination of the antibacterial activity of modified lysozyme

[0085] Freshly propagated E. coli JM110 and S. enteritidis 35 bacterial cultures in the logarithmic growth phase were diluted to 10⁻⁶. 4 CFU / mL and 10 5 CFU / mL. Take 60 μL of diluted bacterial culture, add an equal volume of chimeric lysozyme (35 ng / μL), mix well by pipetting, and incubate at 37°C for 30 min. Take 40 μL of incubation solution and count bacteria by pouring method to determine the antibacterial activity of the modified lysozyme protein. Equal concentrations of Bp7e, Swii2-lys1, Swii2-lys2, S10-lys2, and pCo ld-TF proteins were used as controls. The experiment was repeated three times. The in vitro activity assay results are as follows: Figure 8 As shown.

[0086] according to Figure 8In Example 5, the various chimeric lysozymes prepared had improved antibacterial ability based on the original lysozymes. Among them, the lysozyme Bp7e, which had no extracellular lysis activity against Escherichia coli, gained extracellular lysis activity after modification.

[0087] 6.3 Determination of the cleavage profile of chimeric lysozyme Lys-B-125

[0088] Eighteen strains of freshly proliferated Escherichia coli, five strains of Salmonella, and five strains of Pseudomonas aeruginosa in the logarithmic growth phase were diluted to 10⁻⁶. 4 CFU / mL and 10 5 CFU / mL. Take 60 μL of diluted bacterial culture, add an equal volume of chimeric lysozyme protein at a concentration of 35 ng / μL, mix well by pipetting, incubate at 37℃ for 30 min, and take 40 μL of incubation solution for bacterial counting using the pour method. Measure the lysis spectrum of the modified lysozyme. Use an equal concentration of pCo l d-TF protein as a control. The experiment was repeated three times. The lysis spectrum results are shown below. Figure 9 As shown.

[0089] Depend on Figure 9 It can be seen that the lysozyme Lys-B-125 prepared in the embodiments of the present invention can lyse 50% (9 / 18) of Escherichia coli. Furthermore, it can lyse 20% (1 / 5) of Salmonella and 20% (1 / 5) of Pseudomonas aeruginosa, indicating that lysozyme Lys-B-125 can inhibit the proliferation of various Gram-negative bacteria. The lysis spectrum of the obtained Lys-B-125 obtained by chimerizing polypeptide 125 with lysozyme derived from Escherichia coli phage is shown in the original phage lysis spectrum. Figure 9 Compared to (represented by △ in A), it can not only lyse a wider range of E. coli, but also other Gram-negative bacteria, greatly expanding the lysin's lysis range.

[0090] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the specific implementation of the present invention. Any modifications or equivalent substitutions that do not depart from the spirit and scope of the present invention should be covered within the scope of protection of the claims of the present invention.

Claims

1. A polypeptide, characterized in that, The polypeptide is polypeptide 125, and its amino acid sequence is shown in SEQ ID NO:

2.

2. A nucleic acid molecule encoding the polypeptide of claim 1, characterized in that, The nucleic acid molecule is any one of the following: The coding sequence is the DNA molecule shown in SEQ ID No.

1.

3. A biomaterial, characterized in that, The biomaterial is any one of the following: B1) An expression cassette containing the nucleic acid molecule of claim 2; B2) A recombinant vector containing the nucleic acid molecule of claim 2, or a recombinant vector containing the expression cassette of claim B1; B3) A recombinant microorganism containing the nucleic acid molecule of claim 2, or a recombinant microorganism containing the expression cassette of B1), or a recombinant microorganism containing the recombinant vector of B2); B4) A cell line containing the nucleic acid molecule of claim 2, or a cell line containing the expression cassette of B1), or a cell line containing the recombinant vector of B2).

4. The application of the polypeptide of claim 1 or the nucleic acid molecule of claim 2, characterized in that, The application is for preparing a drug that inhibits bacterial activity, wherein the bacteria are selected from one or more of Escherichia coli, Salmonella, Pseudomonas aeruginosa, Staphylococcus aureus, and Klebsiella pneumoniae.

5. A composition, characterized in that, The composition comprises the polypeptide of claim 1 or the nucleic acid molecule of claim 2, and a pharmaceutically acceptable carrier or excipient.

6. A nucleic acid molecule encoding a chimeric lysozyme, characterized in that, The nucleic acid molecule of claim 2 is obtained by linking the 3' end of the phage lysozyme sequence; the phage lysozyme sequence is one of Gene ID: 14008099, Gene ID: 79713931, Gene ID: 64469838, or Gene ID: 64469839.

7. A biomaterial, characterized in that, The biomaterial is any one of the following: E1) An expression cassette containing the nucleic acid molecule of claim 6; E2) A recombinant vector containing the nucleic acid molecule of claim 6, or a recombinant vector containing the expression cassette of claim 6; E3) A recombinant microorganism containing the nucleic acid molecule of claim 6, or a recombinant microorganism containing the expression cassette of E1), or a recombinant microorganism containing the recombinant vector of E2); E4) A cell line containing the nucleic acid molecule of claim 6, or a cell line containing the expression cassette of claim 6, or a cell line containing the recombinant vector of claim 6.

8. A chimeric lysozyme, characterized in that, The chimeric lysozyme is expressed by the nucleic acid molecule encoding the chimeric lysozyme as described in claim 6 or the biological material as described in claim 7.

9. A recombinant expression strain, characterized in that, The recombinant expression strain expresses the chimeric lysozyme of claim 8.