A triple-stranded forming oligonucleotide sequence for inhibiting MDM2 and MDM4 gene amplification and its application

By designing a three-stranded oligonucleotide sequence that can pair with DNA double-stranded DNA to form a three-strand structure, inhibiting the amplification of MDM2 and MDM4 genes, the problem of toxic side effects and drug resistance of existing targeted MDM2 and MDM4 inhibitors is solved, effectively targeting and apoptosis of tumor cells, and is harmless to normal cells.

CN118421627BActive Publication Date: 2025-06-20SHANGHAI YAYI BIOMEDICAL TECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410531366.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-28
Publication Date
2025-06-20
Estimated Expiration
2044-04-28

AI Technical Summary

Technical Problem

Existing inhibitors targeting MDM2 and MDM4 have major toxic side effects and are prone to drug resistance, and their efficacy is not satisfactory.

Method used

A three-strand-forming oligonucleotide (TFO) sequence was designed, which can inhibit the amplification of MDM2 and MDM4 genes, and forms a three-strand structure by pairing with DNA double-stranded DNA, causing replication pressure to eventually lead to apoptosis of tumor cells.

Benefits of technology

This method reduces or avoids toxic side effects while improving targeting, significantly inhibits the amplified tumor cells of MDM2 and MDM4, has good therapeutic effects and is harmless to normal cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118421627B_ABST
    Figure CN118421627B_ABST
Patent Text Reader

Abstract

The present invention relates to a triplex-forming oligonucleotides (TFOs) sequence and its pharmaceutical applications, and particularly to a triplex-forming oligonucleotides sequence for inhibiting the amplification of MDM2 and MDM4 genes and its pharmaceutical applications. The triplex-forming oligonucleotides sequence provided by the present invention can form a triple-stranded structure locally in the amplified MDM2 / MDM4 genes of tumor cells, causing replication stress and ultimately leading to the apoptosis of tumor cells. The triplex-forming oligonucleotides sequence provided by the present invention and the drug prepared using this sequence target the amplified gene sequence of MDM2 / MDM4 in tumors rather than proteins, have good drug resistance, and have no effect on normal cells without MDM2 / MDM4 gene amplification, and have excellent safety. Therefore, it has a good therapeutic effect on tumors with MDM2 / MDM4 gene amplification.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and relates to an oligonucleotide sequence and its application, in particular to a triplex-forming oligonucleotide (TFO) sequence for inhibiting the amplification of MDM2 and MDM4 genes and its application. Background Art

[0002] P53 is a tumor suppressor gene that has been found to be most closely associated with human tumors to date. Wild-type p53 protein plays a role in timely repairing damage and inhibiting uncontrolled cell growth, and its inactivation plays an important role in tumor formation. MDM2 and MDM4 are the main negative regulators of p53, and they inhibit the function of p53 in different and complementary ways. MDM2 mainly regulates the stability of p53, and MDM4 regulates the activity of p53. Overexpression of MDM2 and MDM4 genes can induce spontaneous tumor formation under the control of their natural promoters or heterologous promoters. Amplification of MDM2 can be found in more than 1 / 3 of human sarcoma samples and a series of tumors outside sarcomas. It is widely present in various histological subtypes of soft tissue sarcomas, including osteosarcoma, liposarcoma, lipoma, leiomyosarcoma, rhabdomyosarcoma, malignant schwannoma, fibrosarcoma, perivascular epithelioma, and malignant fibrous histiocytoma. In addition, MDM2 is also amplified outside sarcomas, including malignant glioma, breast cancer, ovarian cancer, urothelial cancer, lung cancer, gastrointestinal tumors, etc. Amplification of MDM4 gene has been found in a variety of tumors. In retinoblastoma, the amplification ratio is as high as 65% (32 / 49); the rest have 10% amplification in ER+ breast cancer, 17% amplification in primary invasive breast cancer, 17% amplification in soft tissue sarcomas, about 10% amplification in malignant gliomas, and the rest have a certain proportion of amplification in metastatic melanoma, atypical liposarcoma, well-differentiated liposarcoma, and bladder cancer.

[0003] There are already several pharmaceutical companies on the market that have designed and produced small molecule protein drugs targeting MDM2. However, they are very prone to drug resistance, and the curative effects are often unsatisfactory. Moreover, MDM2 small molecule drugs have strong side effects. Preclinical studies have shown that small molecule drugs targeting MDM2 have gastrointestinal and lymphatic system toxicity. NCT02935907 is a clinical study on the MDM2 small molecule inhibitor APG-115 in advanced solid tumors. Dose-limiting toxicities (DLTs) occurred in the first cycle, including grade 2 thrombocytopenia at a dose of 200 mg, grade 3 thrombocytopenia at a dose of 300 mg, and one case of grade 3 fatigue at doses of 100 mg and 300 mg respectively. The most common grade 3 or 4 treatment-related adverse events (AEs) include: fatigue, nausea, vomiting, diarrhea, loss of appetite, dehydration, neutropenia, leukopenia, limb pain, and thrombocytopenia. In another study on APG-115 in Chinese patients with advanced soft tissue sarcoma (CTR20170975), two dose-limiting toxicity reactions (DLTs), thrombocytopenia and febrile neutropenia, were observed in a patient taking a dose of 200 mg. Common treatment-emergent adverse events (TEAEs) include: anemia, thrombocytopenia, vomiting, hypercholesterolemia, and leukopenia. Seven patients (54%) had serious adverse events (SAEs), of which 4 were treatment-related. Common grade 3 / 4 treatment-related adverse events (TRAEs) include anemia (38.5%), thrombocytopenia (38.5%), leukopenia (30.8%), and neutropenia (23.1%). In addition to antagonizing the function of p53, the MDM2 protein is also involved in normal hematopoiesis. Treatment with an MDM2 antagonist may lead to hematopoietic function defects in patients.

[0004] MDM4 is also one of the negative regulators of p53 and mainly plays a role in regulating the activity of the tumor suppressor gene p53. Currently, inhibitors targeting MDM4 mainly target the MDM4-P53 binding site and are divided into peptide inhibitors and small molecule inhibitors. At present, only some peptide inhibitors have entered clinical trial research, and their inhibitory effects on tumors are all related to enhancing P53 and cannot play the tumor suppressor effect of MDM4 independent of P53. In normal cells and tissues, an increase in P53 activity will produce toxic effects.

[0005] In the prior art, inhibitors targeting MDM2 and MDM4 both have relatively large toxic and side effects. Therefore, there is an urgent need to develop an inhibitor that can target both MDM2 and MDM4, reduce or avoid toxic and side effects while improving the targeting ability, so as to achieve a better cancer treatment effect. Summary of the Invention

[0006] To solve the above technical problems, the present invention provides a triplex-forming oligonucleotide (TFO) sequence for inhibiting the amplification of MDM2 and MDM4 genes and its application.

[0007] The present invention provides a triplex-forming oligonucleotide for inhibiting the amplification of MDM2 gene. The sequence length of the triplex-forming oligonucleotide is 22 bases, which binds to the position 68809256-68809277 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0008] The present invention also provides a triplex-forming oligonucleotide for inhibiting the amplification of MDM2 gene, and the sequence of the triplex-forming oligonucleotide is as shown in SEQ ID NO: 1.

[0009] The present invention also provides a triplex-forming oligonucleotide for inhibiting the amplification of MDM2 gene. The sequence length of the triplex-forming oligonucleotide is 23 bases, which binds to the position 68809258-68809280 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0010] The present invention also provides a triplex-forming oligonucleotide for inhibiting the amplification of MDM2 gene, and the sequence of the triplex-forming oligonucleotide is as shown in SEQ ID NO: 2.

[0011] The present invention also provides a triplex-forming oligonucleotide for inhibiting the amplification of MDM2 gene. The sequence length of the triplex-forming oligonucleotide is 22 bases, which binds to the position 68809289-68809310 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0012] The present invention also provides a triplex-forming oligonucleotide for inhibiting the amplification of MDM2 gene, and the sequence of the triplex-forming oligonucleotide is as shown in SEQ ID NO: 3.

[0013] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 68813575-68813597 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode.

[0014] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 4.

[0015] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 68813607-68813629 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode.

[0016] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 5.

[0017] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 68835820-68835842 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode.

[0018] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 6.

[0019] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 68835838-68835860 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode.

[0020] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 7.

[0021] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 68839310 - 68839332 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0022] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 8.

[0023] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 68839311 - 68839333 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0024] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 9.

[0025] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 68839314 - 68839336 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0026] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 10.

[0027] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene. The sequence length of the triple-strand forming oligonucleotide is 22 bases, which binds to the position 68839320-68839341 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode.

[0028] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene, and the sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 11.

[0029] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 68839321-68839343 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode.

[0030] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene, and the sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 12.

[0031] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 68839338-68839360 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode.

[0032] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene, and the sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 13.

[0033] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene. The sequence length of the triple-strand forming oligonucleotide is 22 bases, which binds to the position 68839346-68839367 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode.

[0034] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 14.

[0035] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification. The triple helix-forming oligonucleotide has a sequence length of 23 bases, binds to the position 68839364 - 68839386 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0036] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 15.

[0037] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification. The triple helix-forming oligonucleotide has a sequence length of 23 bases, binds to the position 68839369 - 68839391 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0038] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 16.

[0039] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification. The triple helix-forming oligonucleotide has a sequence length of 23 bases, binds to the position 68839393 - 68839415 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0040] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 17.

[0041] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 23 bases, which binds to the position 68839407-68839429 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0042] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 18.

[0043] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 23 bases, which binds to the position 68839418-68839440 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0044] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 19.

[0045] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 23 bases, which binds to the position 68839451-68839473 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0046] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 20.

[0047] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 23 bases, which binds to the position 68839480-68839502 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0048] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 21.

[0049] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 23 bases, which binds to the position 68839562-68839584 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0050] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 22.

[0051] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 22 bases, which binds to the position 68839595-68839616 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0052] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 23.

[0053] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 23 bases, which binds to the position 68839599-68839621 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0054] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 24.

[0055] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 23 bases, which binds to the position 68839600 - 68839622 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0056] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 25.

[0057] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 22 bases, which binds to the position 68839630 - 68839651 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0058] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 26.

[0059] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 21 bases, which binds to the position 68839632 - 68839652 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0060] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 27.

[0061] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 22 bases, which binds to the position 68839665 - 68839686 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0062] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 28.

[0063] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple helix-forming oligonucleotide is 23 bases, which binds to the position of human chromosome 12 at 68839674-68839696, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0064] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 29.

[0065] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple helix-forming oligonucleotide is 23 bases, which binds to the position of human chromosome 12 at 68839679-68839701, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0066] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 30.

[0067] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple helix-forming oligonucleotide is 23 bases, which binds to the position of human chromosome 12 at 68839694-68839716, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0068] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 31.

[0069] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 68839709-68839731 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0070] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene. The sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 32.

[0071] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 68839718-68839740 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0072] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene. The sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 33.

[0073] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene. The sequence length of the triple-strand forming oligonucleotide is 22 bases, which binds to the position 68839753-68839774 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0074] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene. The sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 34.

[0075] The present invention also provides a triple-strand forming oligonucleotide for inhibiting the amplification of the MDM2 gene. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 68839764-68839786 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0076] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 35.

[0077] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 23 bases, which binds to the position 68839793 - 68839815 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0078] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 36.

[0079] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 23 bases, which binds to the position 68839814 - 68839836 on human chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0080] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 37.

[0081] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM4 gene amplification. The sequence length of the triple-stranded forming oligonucleotide is 22 bases, which binds to the position 204525409 - 204525430 on human chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0082] The present invention also provides a triple-stranded forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple-stranded forming oligonucleotide is as shown in SEQ ID NO: 38.

[0083] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM4 gene amplification. The sequence length of the triple-strand forming oligonucleotide is 21 bases, which binds to the position 204525412-204525432 on human chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0084] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 39.

[0085] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM4 gene amplification. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 204525514-204525536 on human chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0086] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 40.

[0087] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM4 gene amplification. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 204525532-204525554 on human chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0088] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence of the triple-strand forming oligonucleotide is as shown in SEQ ID NO: 41.

[0089] The present invention also provides a triple-strand forming oligonucleotide for inhibiting MDM4 gene amplification. The sequence length of the triple-strand forming oligonucleotide is 23 bases, which binds to the position 204525535-204525557 on human chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode.

[0090] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 42.

[0091] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM4 gene amplification. The triple helix-forming oligonucleotide has a sequence length of 22 bases, binds to the position 204525551-204525572 on human chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0092] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 43.

[0093] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM4 gene amplification. The triple helix-forming oligonucleotide has a sequence length of 23 bases, binds to the position 204525561-204525583 on human chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0094] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 44.

[0095] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM4 gene amplification. The triple helix-forming oligonucleotide has a sequence length of 22 bases, binds to the position 204525576-204525597 on human chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0096] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification, and the sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 45.

[0097] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM4 gene amplification. The sequence length of the triple helix-forming oligonucleotide is 23 bases, which binds to the position 204525579-204525601 on human chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0098] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 46.

[0099] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM4 gene amplification. The sequence length of the triple helix-forming oligonucleotide is 23 bases, which binds to the position 204525589-204525611 on human chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0100] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 47.

[0101] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM4 gene amplification. The sequence length of the triple helix-forming oligonucleotide is 22 bases, which binds to the position 204525673-204525694 on human chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal mode of Watson-Crick pairing.

[0102] The present invention also provides a triple helix-forming oligonucleotide for inhibiting MDM2 gene amplification. The sequence of the triple helix-forming oligonucleotide is as shown in SEQ ID NO: 48.

[0103] The present invention also provides a pharmaceutical composition, which comprises the triple helix-forming oligonucleotide of the present invention and a pharmaceutically acceptable carrier.

[0104] The present invention also provides an application of the triple helix-forming oligonucleotide or the pharmaceutical composition in the preparation of a drug for inhibiting MDM2 or MDM4 gene amplification in cells.

[0105] The present invention also provides an application of the triple-strand forming oligonucleotide or the pharmaceutical composition in the preparation of a medicament for preventing or treating tumors.

[0106] The beneficial technical effects of the present invention are as follows: The present invention provides a new therapeutic drug for tumor patients with MDM2 / MDM4 amplification. A deoxyribonucleic acid specific sequence targeting the MDM2 / MDM4 gene is designed to form a triple-strand structure locally in the amplified MDM2 / MDM4 gene of tumor cells, causing replication stress and ultimately leading to apoptosis of tumor cells. In normal cells, the MDM2 / MDM4 gene is not amplified, and the formed triple-strand structure returns to normal under the action of DNA double-strand repair, so there is no damage to normal cells. The present invention targets the MDM2 / MDM4 amplified gene sequence of tumors rather than proteins, and has better anti-drug resistance compared with small molecule inhibitor drugs in the prior art; and targets tumor cells with MDM2 / MDM4 amplification, causing apoptosis of tumor cells containing MDM2 / MDM4 amplification, and has no effect on normal cells without MDM2 / MDM4 amplification, with excellent safety and good therapeutic effect on tumors with MDM2 / MDM4 gene amplification. In summary, the triple-strand forming oligonucleotide and its pharmaceutical composition provided by the present invention have good targeting, effectiveness and safety for treating or inhibiting tumor cells with MDM2 / MDM4 amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0107] Figure 1 It is a graph showing the inhibitory effect on cells when the triple-strand forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 targeting MDM2 are treated in the MDM2 high-copy cell line 93T449 for 48 hours;

[0108] Figure 2Inhibitory effect diagrams of triple-strand forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 targeting MDM2 on cells when treated for 48 h in the MDM2 high-copy cell line 94T778;

[0109] Figure 3 Inhibitory effect diagrams of triple-strand forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 targeting MDM2 on cells when treated for 48 h in the MDM2 high-copy cell line SJSA-1;

[0110] Figure 4 Inhibitory effect diagrams of triple-strand forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 targeting MDM2 on cells when treated for 48 h in the MDM2 low-copy cell line SW872;

[0111] Figure 5Inhibitory effect of triple-strand forming oligonucleotide fragments targeting MDM2, namely 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643, on cells when treated for 48 hours in the normal cardiomyocyte cell line H9C2;

[0112] Figure 6 Confocal images of fluorescent triple-strand forming oligonucleotide fragments after 12-hour treatment in the MDM2 high-copy cell line SJSA-1;

[0113] Figure 7 Confocal images of fluorescent triple-strand forming oligonucleotide fragments after 12-hour treatment in the MDM2 high-copy cell line 94T778;

[0114] Figure 8 Confocal images of fluorescent triple-strand forming oligonucleotide fragments after 12-hour treatment in the MDM2 high-copy cell line 93T449;

[0115] Figure 9 Inhibitory effect of triple-strand forming oligonucleotide fragments targeting MDM4, namely 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184, on cells when treated for 48 hours in the MDM4 high-copy cell line HT1080;

[0116] Figure 10 Inhibitory effect of triple-strand forming oligonucleotide fragments targeting MDM4, namely 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184, on cells when treated for 48 hours in the MDM4 high-copy cell line SK-Hep1;

[0117] Figure 11 Inhibitory effect of triple-strand forming oligonucleotide fragments targeting MDM4, namely 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184, on cells when treated for 48 hours in the MDM4 low-copy cell line HepG2;

[0118] Figure 12Inhibitory effects of triple helix-forming oligonucleotide fragments 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184 targeting MDM4 on cells when treated in the MDM4 low-copy cell line CP-H103 for 48 hours;

[0119] Figures 13 - 14 Photos of the treated mouse CDX model and tumor masses.

[0120] Figure 15 Tumor growth curves of triple helix-forming oligonucleotides targeting MDM2, doxorubicin, and the control group in nude mice;

[0121] Figure 16 Tumor growth curves of MDM2-Lip-TFOs, single TFOs, doxorubicin, and the control group targeting MDM2 in nude mice. Detailed implementation manners

[0122]

Example 1

[0123] The MDM2 gene is located in the region of human chromosome 12, at positions 68808172 - 68850686, with a length of 42,515 base pairs.

[0124] The design of triple helix-forming oligonucleotide sequences targeting MDM2 is as follows:

[0125] MDM2-1084: 22 bases in length, binds at positions 68809256 - 68809277 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode. The specific sequence is GAAGCTGGAATCTGTGAGGTGG (SEQ ID NO: 1).

[0126] MDM2-1087: 23 bases in length, binds at positions 68809258 - 68809280 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strand simultaneously maintains the normal Watson-Crick pairing mode. The specific sequence is TTCCGAAGCTGGAATCTGTGAGG (SEQ ID NO: 2).

[0127] MDM2-1117: It is 22 bases in length, binds to the position 68809289 - 68809310 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode. The specific sequence is GAGACAAAAATACTAACCAGGG (SEQ ID NO: 3).

[0128] MDM2-5404: It is 23 bases in length, binds to the position 68813575 - 68813597 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode. The specific sequence is TTGAAGTTATTAAAGTCTGTTGG (SEQ ID NO: 4).

[0129] MDM2-5436: It is 23 bases in length, binds to the position 68813607 - 68813629 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode. The specific sequence is AGACACTTATACTATGAAAGAGG (SEQ ID NO: 5).

[0130] MDM2-27649: It is 23 bases in length, binds to the position 68835820 - 68835842 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode. The specific sequence is TTGTTTTAGGATCTTGATGCTGG (SEQ ID NO: 6).

[0131] MDM2-27667: It is 23 bases in length, binds to the position 68835838 - 68835860 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode. The specific sequence is GCTGGTGTAAGTGAACATTCAGG (SEQ ID NO: 7).

[0132] MDM2 - 31139: It is 23 bases in length, binds to the position 68839310 - 68839332 on chromosome 12, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strands simultaneously maintain the normal Watson - Crick pairing mode. The specific sequence is TTGCAATGTGATGGAAGGGGGGG (SEQ ID NO: 8).

[0133] MDM2 - 31140: It is 23 bases in length, binds to the position 68839311 - 68839333 on chromosome 12, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strands simultaneously maintain the normal Watson - Crick pairing mode. The specific sequence is GTTGCAATGTGATGGAAGGGGGG (SEQ ID NO: 9).

[0134] MDM2 - 31143: It is 23 bases in length, binds to the position 68839314 - 68839336 on chromosome 12, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strands simultaneously maintain the normal Watson - Crick pairing mode. The specific sequence is TCTGTTGCAATGTGATGGAAGGG (SEQ ID NO: 10).

[0135] MDM2 - 31148: It is 22 bases in length, binds to the position 68839320 - 68839341 on chromosome 12, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strands simultaneously maintain the normal Watson - Crick pairing mode. The specific sequence is AACATCTGTTGCAATGTGATGG (SEQ ID NO: 11).

[0136] MDM2 - 31150: It is 23 bases in length, binds to the position 68839321 - 68839343 on chromosome 12, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strands simultaneously maintain the normal Watson - Crick pairing mode. The specific sequence is ATCACATTGCAACAGATGTTGGG (SEQ ID NO: 12).

[0137] MDM2-31167: It is 23 bases in length, binds to the position 68839338-68839360 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is GTTGGGCCCTTCGTGAGAATTGG (SEQ ID NO: 13).

[0138] MDM2-31174: It is 22 bases in length, binds to the position 68839346-68839367 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is AGGAAGCCAATTCTCACGAAGG (SEQ ID NO: 14).

[0139] MDM2-31193: It is 23 bases in length, binds to the position 68839364-68839386 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is TTATCTTTCCCTTTATCTTCAGG (SEQ ID NO: 15).

[0140] MDM2-31198: It is 23 bases in length, binds to the position 68839369-68839391 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is AGATAAAGGGAAAGATAAAGGGG (SEQ ID NO: 16).

[0141] MDM2-31225: It is 23 bases in length, binds to the position 68839393 - 68839415 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is AATCTCTGAGAAAGCCAAACTGG (SEQ ID NO: 17).

[0142] MDM2-31236: It is 23 bases in length, binds to the position 68839407 - 68839429 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is TTGTGTTGAGTTTTCCAGTTTGG (SEQ ID NO: 18).

[0143] MDM2-31247: It is 23 bases in length, binds to the position 68839418 - 68839440 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is AACTCAACACAAGCTGAAGAGGG (SEQ ID NO: 19).

[0144] MDM2-31280: It is 23 bases in length, binds to the position 68839451 - 68839473 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is ACTATAGTTTTTTTACAATCAGG (SEQ ID NO: 20).

[0145] MDM2-31309: It is 23 bases in length, binds to the position 68839480 - 68839502 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is TTCCAGAGAGTCATGTGTTGAGG (SEQ ID NO: 21).

[0146] MDM2 - 31391: It is 23 bases in length, binds to the position 68839562 - 68839584 on chromosome 12, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strand simultaneously maintains the normal Watson - Crick pairing mode. The specific sequence is ATAATGCTACTAGAAGTTGATGG (SEQ ID NO: 22).

[0147] MDM2 - 31423: It is 22 bases in length, binds to the position 68839595 - 68839616 on chromosome 12, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strand simultaneously maintains the normal Watson - Crick pairing mode. The specific sequence is AAACTCTTTCACATCTTCTTGG (SEQ ID NO: 23).

[0148] MDM2 - 31428: It is 23 bases in length, binds to the position 68839599 - 68839621 on chromosome 12, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strand simultaneously maintains the normal Watson - Crick pairing mode. The specific sequence is AAGATGTGAAAGAGTTTGAAAGG (SEQ ID NO: 24).

[0149] MDM2 - 31429: It is 23 bases in length, binds to the position 68839600 - 68839622 on chromosome 12, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strand simultaneously maintains the normal Watson - Crick pairing mode. The specific sequence is AGATGTGAAAGAGTTTGAAAGGG (SEQ ID NO: 25).

[0150] MDM2 - 31458: It is 22 bases in length, binds to the position 68839630 - 68839651 on chromosome 12, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strand simultaneously maintains the normal Watson - Crick pairing mode. The specific sequence is ACACTCTCTTCTTTGTCTTGGG (SEQ ID NO: 26).

[0151] MDM2-31459: It is 21 bases in length, binds to the position 68839632-68839652 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is AAGACAAAGAAGAGAGTGTGG (SEQ ID NO: 27).

[0152] MDM2-31496: It is 22 bases in length, binds to the position 68839665-68839686 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is AAGGTTCAATGGCATTAAGGGG (SEQ ID NO: 28).

[0153] MDM2-31503: It is 23 bases in length, binds to the position 68839674-68839696 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is ACAAATCACACAAGGTTCAATGG (SEQ ID NO: 29).

[0154] MDM2-31508: It is 23 bases in length, binds to the position 68839679-68839701 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is GAACCTTGTGTGATTTGTCAAGG (SEQ ID NO: 30).

[0155] MDM2-31523: 23 bases in length, binds to chromosome 12 at positions 68839694-68839716, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is TGTCAAGGTCGACCTAAAAATGG (SEQ ID NO: 31).

[0156] MDM2-31538: 23 bases in length, binds to chromosome 12 at positions 68839709-68839731, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence isAAAAATGGTTGCATTGTCCATGG (SEQ ID NO: 32).

[0157] MDM2-31547: 23 bases in length, binds to chromosome 12 at positions 68839718-68839740, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is TGCATTGTCCATGGCAAAACAGG (SEQ ID NO: 33).

[0158] MDM2-31581: 22 bases in length, binds to chromosome 12 at positions 68839753-68839774, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is TTCTTTGCACATGTAAAGCAGG (SEQ ID NO: 34).

[0159] MDM2-31593: 23 bases in length, binds to chromosome 12 at positions 68839764-68839786, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is GTGCAAAGAAGCTAAAGAAAAGG (SEQ ID NO: 35).

[0160] MDM2-31622: It has a length of 23 bases, binds to the position 68839793 - 68839815 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is GGTTGTCTACATACTGGGCAGGG (SEQ ID NO: 36).

[0161] MDM2-31643: It has a length of 23 bases, binds to the position 68839814 - 68839836 on chromosome 12, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is GTTAGCACAATCATTTGAATTGG (SEQ ID NO: 37).

[0162]

Example 2

[0163] S1. Under ventilation conditions, weigh 5.0 - 15.0 mg of dimethyloctadecylglycidyl ammonium chloride and 5.0 - 15.0 mg of cholesterol and add them to a container. Then take 200 - 300 μL of dioleoyl phosphatidylcholine solution and 50 - 150 μL of carboxymethyl chitosan hexadecyl quaternary ammonium salt solution into this container, and mix the components evenly to obtain a mixed solution; perform ultrasonic treatment on the mixed solution for 15 - 45 s, then take 4 - 8 mL of ultrapure water into this container and continue ultrasonic treatment until the total time is 4 - 8 min; finally, perform vacuum rotary evaporation treatment for 20 - 40 min to obtain liposome nanoparticles;

[0164] S2. Add a triple-strand forming oligonucleotide fragment targeting MDM2 to the liposome nanoparticles and act for 2 - 4 min;

[0165] S3. Weigh the liposome nanoparticles loaded with the triple-strand forming oligonucleotide fragment and store them refrigerated to obtain the highly efficient and safe drug for treating MDM2 overexpressing tumors.

[0166] Preferably, in the above method, the liposome nanoparticles can also use the commercial product Thermo Scientific Dharmacon FECT.

[0167] Preferably, the power of the ultrasound in step S1 is 27%, the ultrasound treatment is performed for 2 s per cycle with an interval of 1 s, and the treatment temperature is 25°C.

[0168] Preferably, the triple-strand forming oligonucleotide fragment targeting MDM2 in step S2 is designed by the following method:

[0169] M1. Design the triple-strand forming oligonucleotide fragment. On the one hand, select the promoter region of the gene, and on the other hand, select the inside of the gene, including exons and introns;

[0170] M2. Determine the target region and design parallel or anti-parallel fragments;

[0171] M3. The specific sequence is basically in accordance with the Watson-Crick pairing principle, and the middle part of the bases is adjusted according to the Hoogsteen pairing principle. Software such as snapgene, dnaman, and NovoPro is used to compare and calculate the pairing free energy; Primer Premier 5 software is used to remove hairpins and other secondary structures to prevent misbinding.

[0172] The triple-strand forming oligonucleotide fragment targeting MDM2 is designed.

[0173] Preferably, the triple-strand forming oligonucleotide fragment in step S2 is 16 to 35 bases.

[0174] Preferably, the temperature for cold storage in step S3 is 2 to 8°C.

[0175] Liposomes are carriers that can effectively deliver a variety of drugs to target cells. The combination of drugs with liposomes can significantly improve the pharmacokinetics of drugs, reduce drug toxicity and improve therapeutic effects. Therefore, liposome formulations have broad development prospects in the delivery of anti-tumor drugs. In the field of nanomedicine, active targeting is an important strategy to overcome low selectivity and systemic toxicity and improve therapeutic effects. A drug delivery device with controllable and targeting functions can ideally deliver a high dose of therapeutic agents specifically to diseased cells, reduce interference with healthy cells, thereby generating the expected pharmacokinetics and biodistribution, achieving higher therapeutic effects and fewer side effects. In the present invention, the triple-strand forming oligonucleotide immunoliposome targeting MDM2 is a promising strategy for targeted drug delivery to treat MDM2-overexpressing cancers. A kind of ionizable cationic liposome nanoparticle prepared in the present invention can optimize the encapsulation of the payload and the intracellular delivery of nucleic acids. They only need a small dose and few injections to produce a good immune stimulation effect.

[0176]

Example 3

[0177] The MDM4 gene is located in the region of human chromosome 1, at positions 204516406 - 204558120, with a length of 41,715 base pairs.

[0178] The triple - helix - forming oligonucleotide sequences targeting MDM4 are designed as follows:

[0179] MDM4 - 9004: It is 22 bases in length, binds to positions 204525409 - 204525430 on chromosome 1, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strand simultaneously maintains the normal Watson - Crick pairing mode. The specific sequence is TTTAGCATTCACACAAAGGCAA (SEQ ID NO: 38).

[0180] MDM4 - 9006: It is 21 bases in length, binds to positions 204525412 - 204525432 on chromosome 1, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strand simultaneously maintains the normal Watson - Crick pairing mode. The specific sequence is TATTTAGCATTCACACAAAGG (SEQ ID NO: 39).

[0181] MDM4 - 9109: It is 23 bases in length, binds to positions 204525514 - 204525536 on chromosome 1, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strand simultaneously maintains the normal Watson - Crick pairing mode. The specific sequence is GGTGGAAAATGATGTCATTTTGG (SEQ ID NO: 40).

[0182] MDM4 - 9127: It is 23 bases in length, binds to positions 204525532 - 204525554 on chromosome 1, pairs with double - stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double - strand simultaneously maintains the normal Watson - Crick pairing mode. The specific sequence is TGTTGAACACTGAGCAGAGGTGG (SEQ ID NO: 41).

[0183] MDM4-9130: It is 23 bases in length, binds to the position 204525535-204525557 on chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is AGATGTTGAACACTGAGCAGAGG (SEQ ID NO: 42).

[0184] MDM4-9145: It is 22 bases in length, binds to the position 204525551-204525572 on chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is AACATCTGACAGTGCTTGCAGG (SEQ ID NO: 43).

[0185] MDM4-9156: It is 23 bases in length, binds to the position 204525561-204525583 on chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is AGTGCTTGCAGGATCTCTCCTGG (SEQ ID NO: 44).

[0186] MDM4-9170: It is 22 bases in length, binds to the position 204525576-204525597 on chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is TCTCCTGGACAAATCAATCAGG (SEQ ID NO: 45).

[0187] MDM4-9174: It is 23 bases in length, binds to the position 204525579-204525601 on chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double strands simultaneously maintain the normal Watson-Crick pairing mode. The specific sequence is TTTACCTGATTGATTTGTCCAGG (SEQ ID NO: 46).

[0188] MDM4-9184: It has a length of 23 bases, binds to the position 204525589 - 204525611 on chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode. The specific sequence is TCAATCAGGTAAATCATTTTCGG (SEQ ID NO: 47).

[0189] MDM4-9268: It has a length of 22 bases, binds to the position 204525673 - 204525694 on chromosome 1, pairs with double-stranded DNA according to the Hoogsteen or reverse Hoogsteen pairing principle, and the DNA double-strand simultaneously maintains the normal Watson-Crick pairing mode. The specific sequence is GTAATCCCAGCACTTTGAGAAG (SEQ ID NO: 48).

[0190]

Example 4

[0191] S1. Under ventilation conditions, weigh 5.0 - 15.0 mg of dimethyloctadecylglycidyl ammonium chloride and 5.0 - 15.0 mg of cholesterol and add them to a container. Then take 200 - 300 μL of dioleoyl phosphatidylcholine solution and 50 - 150 μL of carboxymethyl chitosan hexadecyl quaternary ammonium salt solution into this container, mix all components evenly to obtain a mixed solution; perform ultrasonic treatment on the mixed solution for 15 - 45 s, then take 4 - 8 mL of ultrapure water into this container, and continue ultrasonic treatment until the total time is 4 - 8 min; finally, perform vacuum rotary evaporation treatment for 20 - 40 min to obtain liposome nanoparticles;

[0192] S2. Add a triple-strand forming oligonucleotide fragment targeting MDM4 to the liposome nanoparticles and act for 2 - 4 min;

[0193] S3. Weigh the liposome nanoparticles loaded with the triple-strand forming oligonucleotide fragment, store them refrigerated, and obtain the highly effective and safe drug for treating MDM4 overexpressing tumors.

[0194] Preferably, in the above method, the liposome nanoparticles can also use the commercial product Thermo Scientific Dharmacon FECT.

[0195] Preferably, the power of the ultrasound in step S1 is 27%, the ultrasound treatment is performed for 2 s per cycle with an interval of 1 s, and the treatment temperature is 25°C.

[0196] Preferably, the triple-strand forming oligonucleotide fragment targeting MDM4 in step S2 is designed by the following method:

[0197] M1. Design the triple-strand forming oligonucleotide fragment. On the one hand, select the promoter region of the gene, and on the other hand, select the inside of the gene, including exons and introns;

[0198] M2. Determine the target region and design parallel or anti-parallel fragments;

[0199] M3. The specific sequence is basically in accordance with the Watson-Crick pairing principle, and the middle part of the bases is adjusted according to the Hoogsteen pairing principle. Software such as snapgene, dnaman, and NovoPro is used to compare and calculate the pairing free energy; Primer Premier 5 software is used to remove hairpins and other secondary structures to prevent misbinding.

[0200] The triple-strand forming oligonucleotide fragment targeting MDM4 is designed.

[0201] Preferably, the triple-strand forming oligonucleotide fragment in step S2 is 16 - 35 bases.

[0202] Preferably, the temperature for cold storage in step S3 is 2 - 8°C.

[0203]

Example 5

[0204] Experimental method:

[0205] Cell line culture

[0206] (1) The MDM2 high-copy cell lines 93T449, 94T778, and SJSA-1 are cultured in RPMI1640 medium (Nunclon 6-well plate, 5×105 cells / 2 ml) containing 10% fetal bovine serum (FBS).

[0207] (2) The MDM2 low-copy cell line SW872 and the normal immortalized cardiomyocyte line H9C2 were cultured in DMEM medium (Nunclon 6-well plate, 5×10^5 cells / 2 ml) containing 10% fetal bovine serum (FBS).

[0208] (3) The cell lines were placed in an incubator with 5% CO2, saturated humidity, and 37°C for culture.

[0209] Transfection of cell lines

[0210] (4) 0.3 - 2×10^5 cells (93T449, 94T778, SJSA-1, SW872, H9C2) were seeded into 96-well plates 24 h before transfection, and the cell confluence was 80 - 90% at the time of transfection.

[0211] (5) The designed different triple-strand-forming oligonucleotide fragments targeting MDM2 were diluted separately, and at the same time, the transfection reagent liposome nanoparticles (Lip) were diluted.

[0212] (6) The transfection reagent liposome nanoparticles (Lip) and the triple-strand-forming oligonucleotide dilution were mixed and left standing at room temperature. Then the transfection complexes were added to the 96-well cell plates respectively, with 6 replicates in each group.

[0213] (7) The cell plates were placed in an incubator at 37°C and 5% CO2 for 12 - 48 h.

[0214] Measurement of cell viability by CCK-8 method

[0215] (8) 10 μl of CCK-8 solution was added to each well of the above-treated 96-well plates. After incubating the culture plates in the incubator for 2 hours, the absorbance at 450 nm was measured using a microplate reader.

[0216] (9) The cell proliferation viability was statistically evaluated according to the formula. The relevant data are shown in Table 1 below and Figures 1 - 5 .

[0217]

[0218] Table 1 Statistical results of cell proliferation viability

[0219] Analysis of experimental results

[0220] (1) Figure 1Inhibitory effect diagram of triple-strand forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 targeting MDM2 on cells when treated in the MDM2 high-copy cell line 93T449 for 48 h; It can be seen that compared with the toxicity of the transfection reagent liposome nanoparticles (Lip) itself, the triple-strand forming oligonucleotides targeting MDM2 can significantly inhibit the growth of cells in the MDM2 high-copy cell line 93T449, indicating that the triple-strand forming oligonucleotides targeting MDM2 have a strong inhibitory effect on MDM2 high-copy tumor cells;

[0221] (2) Figure 2 Inhibitory effect diagram of triple-strand forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 targeting MDM2 on cells when treated in the MDM2 high-copy cell line 94T778 for 48 h; It can be seen that compared with the toxicity of the transfection reagent liposome nanoparticles (Lip) itself, the triple-strand forming oligonucleotides targeting MDM2 can significantly inhibit the growth of cells in the MDM2 high-copy cell line 94T778, indicating that the triple-strand forming oligonucleotides targeting MDM2 have a strong inhibitory effect on MDM2 high-copy tumor cells;

[0222] (3) Figure 3Inhibition effect diagrams of triplex-forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 targeting MDM2 on cells after 48 hours of treatment in the MDM2 high-copy cell line SJSA-1; it can be seen that compared with the toxicity of the transfection reagent liposome nanoparticles (Lip) itself, the triplex-forming oligonucleotides targeting MDM2 can significantly inhibit the growth of cells in the MDM2 high-copy cell line SJSA-1, indicating that the triplex-forming oligonucleotides targeting MDM2 have a strong inhibitory effect on MDM2 high-copy tumor cells;

[0223] (4) Figure 4 Inhibition effect diagrams of triplex-forming oligonucleotide fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643 targeting MDM2 on cells after 48 hours of treatment in the MDM2 low-copy cell line SW872; it can be seen that compared with the toxicity of the transfection reagent liposome nanoparticles (Lip) itself, the inhibitory effect of the triplex-forming oligonucleotides targeting MDM2 on the growth of cells in the low-copy cell line SW872 is not obvious, indicating that the triplex-forming oligonucleotides targeting MDM2 have an insignificant inhibitory effect on MDM2 low-copy tumor cells;

[0224] (5) Figure 5Inhibitory effect diagrams of triple-strand forming oligonucleotides targeting MDM2 (fragments 1084, 1087, 1117, 5404, 5436, 27649, 27667, 31139, 31140, 31143, 31148, 31150, 31167, 31174, 31193, 31198, 31225, 31236, 31247, 31280, 31309, 31391, 31423, 31428, 31429, 31458, 31459, 31496, 31503, 31508, 31523, 31538, 31547, 31581, 31593, 31622, 31643) on cells when treated for 48 h in the normal cardiomyocyte cell line H9C2; it can be seen that compared with the toxicity of the transfection reagent liposomal nanoparticles (Lip) itself, the growth inhibitory effect of the triple-strand forming oligonucleotides targeting MDM2 on the normal cardiomyocyte cell line H9C2 is not obvious, indicating that the inhibitory effect of the triple-strand forming oligonucleotides targeting MDM2 on normal cells is not obvious;

[0225] (6) Figures 1 - 3 All are growth inhibitory effect diagrams of triple-strand forming oligonucleotides targeting MDM2 on tumor cell lines with high MDM2 amplification (93T449, 94T778, SJSA-1). It can be seen that the triple-strand forming oligonucleotide fragments targeting MDM2 have a strong inhibitory effect on tumor cells with high MDM2 amplification, and the anti-tumor effect is highly effective.

[0226] (7) Figure 4 Growth inhibitory effect diagram of triple-strand forming oligonucleotides targeting MDM2 on the MDM2 low-copy cell line SW872; it can be seen that the growth inhibitory effect of the triple-strand forming oligonucleotides targeting MDM2 on tumor cells with low MDM2 copy number is not obvious. Comparing Figures 1 - 3 and Figure 4 , it can be found that the triple-strand forming oligonucleotide fragments targeting MDM2 have a strong targeting effect on killing tumor cells with MDM2 amplification.

[0227] (8) Figure 5 Growth inhibitory effect diagram of triple-strand forming oligonucleotides targeting MDM2 on the normal cardiomyocyte cell line H9C2; it can be seen that the growth inhibitory effect of the triple-strand forming oligonucleotides targeting MDM2 on the normal cardiomyocyte cell line H9C2 is not obvious, Figures 1 - 3 and Figure 4 and Figure 5 , indicating that the triple-strand forming oligonucleotides targeting MDM2 only have a killing effect on tumor cells with high MDM2 amplification, have an insignificant killing effect on cells with low MDM2 copy number, and have almost no killing effect on normal cells, indicating that the triple-strand forming oligonucleotides targeting MDM2 have good safety;

[0228] Collect the cells after transfection by the above transfection method, and evaluate the early apoptosis of the cells by detecting the expression levels of cleaved-caspase3 and cleaved-PARP by Western Blot (WB).

[0229] Fix the cells 12 hours after transfection with the triple-stranded forming oligonucleotide fragment with fluorescent signal by the above transfection method, and take cell photos through a confocal microscope ( Figures 6 - 8 ). It can be seen that the triple-stranded forming oligonucleotide with fluorescent signal enters the tumor cell line with high amplification of MDM2.

[0230] Figure 6 It shows that the triple-stranded forming oligonucleotide with fluorescent signal enters the MDM2 gene amplified cell line SJSA-1;

[0231] Figure 7 It shows that the triple-stranded forming oligonucleotide with fluorescent signal enters the MDM2 gene amplified cell line 94T778;

[0232] Figure 8 It shows that the triple-stranded forming oligonucleotide with fluorescent signal enters the MDM2 gene amplified cell line 93T449;

Example 6

[0233] Experimental method:

[0234] Culture of cell lines

[0235] (1) The MDM4 high-copy cell lines HT1080 and SK-Hep1 were cultured in MEM medium (Nunclon 6-well plate, 5×105 cells / 2 ml) containing 10% fetal bovine serum (FBS). (2) The MDM4 low-copy cell line HepG2 was cultured in DMEM medium (Nunclon 6-well plate, 5×105 cells / 2 ml) containing 10% fetal bovine serum (FBS).

[0236] (3) The MDM4 low-copy cell line CP-H103 was cultured in DMEM-F12 medium (Nunclon 6-well plate, 5×10^5 cells / 2 ml) containing 10% fetal bovine serum (FBS).

[0237] (4) The cell line was placed in an incubator with 5% CO2, saturated humidity, and 37°C for culture.

[0238] Transfection of the cell line

[0239] (5) 0.3 - 2×10^5 cells (HT1080, SK-Hep1, HepG2, CP-H103) were seeded in 96-well plates 24 h before transfection, and the cell confluence was 80 - 90% at the time of transfection.

[0240] (6) The designed different triple-strand-forming oligonucleotide fragments targeting MDM4 were diluted respectively, and at the same time, the transfection reagent liposome nanoparticles (Lip) were diluted.

[0241] (7) The transfection reagent liposome nanoparticles (Lip) and the triple-strand-forming oligonucleotide dilution were mixed, left standing at room temperature, and the transfection complexes were added to the 96-well cell plates respectively, with 6 replicates in each group.

[0242] (8) The cell plates were placed in an incubator at 37°C and 5% CO2 for 12 - 48 h.

[0243] Measurement of cell viability by CCK-8 method

[0244] (9) 10 μl of CCK-8 solution was added to each well of the above-treated 96-well plates, and after incubating the culture plates in the incubator for 2 hours, the absorbance at 450 nm was measured with an enzyme-linked immunosorbent assay (ELISA) reader.

[0245] (10) The cell proliferation viability was statistically evaluated according to the formula. The relevant data are shown in Table 2 below and Figures 9 - 12 .

[0246]

[0247] Table 2 Statistics of cell proliferation viability

[0248] Analysis of experimental results

[0249] (1) Figure 9It is a graph showing the inhibitory effect of fragments 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184 targeting MDM4 on cells when treated for 48 h in the MDM4 high-copy cell line HT1080; it can be seen that compared with the toxicity of the transfection reagent liposomal nanoparticles (Lip) itself, the triple-strand-forming oligonucleotides targeting MDM4 can significantly inhibit the growth of cells in the MDM4 high-copy cell line HT1080, indicating that the triple-strand-forming oligonucleotides targeting MDM4 have a strong inhibitory effect on MDM4 high-copy tumor cells;

[0250] (2) Figure 10 It is a graph showing the inhibitory effect of fragments 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184 targeting MDM4 on cells when treated for 48 h in the MDM4 high-copy cell line SK-Hep1; it can be seen that compared with the toxicity of the transfection reagent liposomal nanoparticles (Lip) itself, the triple-strand-forming oligonucleotides targeting MDM4 can significantly inhibit the growth of cells in the MDM4 high-copy cell line SK-Hep1, indicating that the triple-strand-forming oligonucleotides targeting MDM4 have a strong inhibitory effect on MDM4 high-copy tumor cells;

[0251] (3) Figure 11 It is a graph showing the inhibitory effect of fragments 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184 targeting MDM4 on cells when treated for 48 h in the MDM4 low-copy cell line HepG2; it can be seen that compared with the toxicity of the transfection reagent liposomal nanoparticles (Lip) itself, the inhibitory effect of the triple-strand-forming oligonucleotides targeting MDM4 on the growth of cells in the low-copy cell line HepG2 is not obvious, indicating that the triple-strand-forming oligonucleotides targeting MDM4 have an insignificant inhibitory effect on MDM4 low-copy tumor cells; (4) Figure 12 It is a graph showing the inhibitory effect of fragments 9004, 9006, 9109, 9127, 9130, 9145, 9156, 9170, 9174, 9184 targeting MDM4 on cells when treated for 48 h in the MDM4 low-copy cell line CP-H103; it can be seen that compared with the toxicity of the transfection reagent liposomal nanoparticles (Lip) itself, the inhibitory effect of the triple-strand-forming oligonucleotides targeting MDM4 on the growth of cells in the low-copy cell line CP-H103 is not obvious, indicating that the triple-strand-forming oligonucleotides targeting MDM4 have an insignificant inhibitory effect on MDM4 low-copy tumor cells;

[0252] (5) Figures 9 - 10These are the growth inhibition graphs of tumor cell lines (HT1080, SK-Hep1) with high MDM4 amplification treated with triple helix-forming oligonucleotides targeting MDM4. It can be seen that the triple helix-forming oligonucleotide fragments targeting MDM4 have a strong inhibitory effect on tumor cells with high MDM4 amplification, and the anti-tumor effect is highly effective.

[0253] (6) Figures 11 - 12 These are the growth inhibition graphs of HepG2 and CP-H103 cell lines with low MDM4 copy numbers treated with triple helix-forming oligonucleotides targeting MDM4. It can be seen that the triple helix-forming oligonucleotides targeting MDM4 have an insignificant inhibitory effect on the growth of tumor cells with low MDM2 copy numbers. Comparing Figures 9 - 10 and Figures 11 - 12 , it can be found that the triple helix-forming oligonucleotide fragments targeting MDM4 have a strong targeting effect on killing tumor cells with MDM4 amplification.

[0254] After transfection by the above transfection method, cells were collected, and the early apoptosis of cells was evaluated by detecting the expression levels of cleaved-caspase3 and cleaved-PARP through Western Blot (WB).

[0255] After transfection with the triple helix-forming oligonucleotide fragment with fluorescent signal by the above transfection method for 12 h, cells were fixed, and cell photos were taken through a confocal microscope.

[0256]

Example 7

[0257] Therapeutic drugs: An injection of triple helix-forming oligonucleotides targeting MDM2 and an injection of doxorubicin. During the experiment, they were diluted to the corresponding concentrations with physiological saline.

[0258] Methods and results:

[0259] 1. Animals: Nude mice, 6 - 8 weeks old, all female.

[0260] 2. Generation of tumor model

[0261] 1) The human osteosarcoma SJSA-1 cells were purchased from the American Type Culture Collection (ATCC), and the cells were identified according to the instructions provided by ATCC. The cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum at 37°C under 5% carbon dioxide. Passage was performed every 2 days, and the cells were used within 15 passages.

[0262] 2) Tumor generation: 5×10^6 SJSA-1 cells were subcutaneously injected into the back of nude mice. When the tumor grew to at least about 100 mm3, the mice were randomly grouped and treatment was started, with the day of starting treatment being the first day.

[0263] 3) Treatment process

[0264] The triple helix-forming oligonucleotide targeting MDM2 was used at a dose of 20 mg / kg, the doxorubicin (DOX) injection was used at a dose of 2 mg / kg, and the control group was treated with normal saline. A total of 3 doses were administered within 7 days.

[0265] 4) The experimental result data are as shown in Table 3 below and Figure 15 as follows

[0266]

[0267] Table 3 Efficacy study of the injection of the triple helix-forming oligonucleotide targeting MDM2 in nude mice

[0268] 5) Results and discussion: As can be seen from Table 3 and Figure 15 it is known that the inhibitory effect on tumors of the triple helix-forming oligonucleotide targeting MDM2 treatment group is comparable to that of the doxorubicin group, and the tumor growth rate is significantly inhibited.

[0269]

Example 8

[0270]

Example 9

[0271] Methods and results:

[0272] 1. Animals: Nude mice, 6 - 8 weeks old, all female.

[0273] 2. Generation of tumor model

[0274] 1) Human osteosarcoma SJSA-1 (cells) were purchased from the American Type Culture Collection (ATCC), and the cells were identified according to the instructions provided by ATCC. The cells were cultured in RPMI1640 medium containing 10% fetal bovine serum at 37 °C under 5% carbon dioxide conditions. Subculture once every 2 days, and the cells were used within 15 passages.

[0275] 2) Tumor generation: Subcutaneously inject 5×10^6 SJSA-1 cells into the back of nude mice. When the tumor grows to at least about 100 mm 3, randomly group the mice and start treatment. The day of starting treatment is taken as the first day.

[0276] 3) Treatment process

[0277] The MDM2-Lip-TFOs targeting MDM2 were used at a dose of 2.5 mg / kg, the TFOs targeting MDM2 were used at a dose of 20 mg / kg, the doxorubicin (DOX) injection was used at a dose of 2 mg / kg, and the control group was given normal saline. A total of three doses were administered within 7 days.

[0278] 4) The experimental result data are as shown in Table 3 above and the appendix Figure 16 as shown

[0279] 5) Results and discussion: As Figure 16 can be seen, the MDM2-Lip-TFOs targeting MDM2 significantly inhibited tumor growth, with a better effect than the single TFOs treatment group targeting MDM2 and the doxorubicin group. The inhibitory effects of the single TFOs treatment group targeting MDM2 and the doxorubicin group on tumors were comparable. Compared with Example 7, the dosage of the triple-stranded forming oligonucleotide of MDM2-Lip-TFOs in this example was significantly reduced, and the utilization rate of the triple-stranded forming oligonucleotide was greatly improved. Figures 13 - 14 Shown are the photos of the CDX model of mice and the tumor mass after treatment. Mouse No. 1 received treatment with MDM2-Lip-TFOs, mouse No. 2 received treatment with a single TFOs injection, and mouse No. 3 was the control group. It can be seen that both the MDM2-Lip-TFOs injection targeting MDM2 and the single TFOs injection targeting MDM2 had a significant inhibitory effect on tumor growth, and the MDM2-Lip-TFOs injection targeting MDM2 had a stronger inhibitory effect on tumors.

[0280]

Example 10

[0281] Inject the highly effective and safe drugs for treating MDM2 high-copy tumors obtained in Examples 7 and 8 into advanced tumor patients with MDM2 high-copy and resistant to conventional chemotherapy and targeted therapy, and observe the curative effect and safety: 20-30 advanced tumor patients with MDM2 high-copy and resistant to chemotherapy and targeted therapy were clinically recruited; the highly effective and safe drugs for treating MDM2 high-copy tumors were injected into the above patients, and the tumor regression of the patients and the related toxic and side reactions such as hematology and heart were observed.

[0282] The preferred specific embodiments of the present invention have been described in detail above. It should be understood that those of ordinary skill in the art can make many modifications and variations according to the concept of the present invention without creative labor. Therefore, all technical solutions that can be obtained by those skilled in the art in the technical field of the present invention based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the protection scope determined by the claims.

Claims

1. Use of a pharmaceutical composition in the preparation of a drug for treating tumors, the pharmaceutical composition comprising a triplex-forming oligonucleotide for inhibiting MDM2 gene amplification and a pharmaceutically acceptable carrier, characterized in that: The nucleotide sequence of the triplex-forming oligonucleotide for inhibiting MDM2 gene amplification is shown in SEQ ID NO: 1, and the tumor is liposarcoma and osteosarcoma.

Citation Information

Patent Citations

  • Antagonists of the oncogenic activity of the protein MDM2, and use thereof in the treatment of cancers

    US20030060432A1

  • Coding polypurine hairpins for the treatment of cancer

    WO2012139628A1