Application of PGIP2 gene in regulating waterlogging tolerance of crops

Abstract

The present invention discloses PGIP2 The application of genes in regulating crop waterlogging tolerance is to use Agrobacterium-mediated genetic transformation to transform BnaPGIP2 The gene overexpression vector and CRISPR / Cas9 gene editing vector were transformed into the rapeseed genome to obtain BnaPGIP2 Gene overexpression and edited rapeseed varieties were used to test the waterlogging tolerance of overexpression and mutant materials. BnaPGIP2 Positive regulation of rapeseed's waterlogging tolerance, using BnaPGIP2 The gene can create rapeseed varieties with different waterlogging tolerance and stable inheritance. The invention provides important gene resources and germplasm resources for waterlogging tolerance breeding of crops, and has broad application prospects in molecular design breeding of crops.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and molecular breeding and relates to a PGIP2 Application of genes and their encoded proteins in regulating crop waterlogging tolerance. Background Art

[0002] Waterlogging is one of the main abiotic stresses on crops. Due to poor soil permeability and poor surface drainage, waterlogging can cause damage to plant growth and development or even be fatal. Waterlogging is often caused by extreme rainfall, soil hardening and poor field drainage. About 10% of the world's arable land is affected by waterlogging to varying degrees, resulting in 15% to 80% yield losses.

[0003] When the soil is waterlogged, O2 in the soil pore space is replaced by water, and the activities of microorganisms and plant roots further consume the remaining O2, causing the soil O2 content to drop rapidly. This change after waterlogging forces plants to quickly enter anoxic conditions. Plant roots are most directly exposed to soil moisture, and the root cell wall becomes the first barrier to waterlogging stress. The cell wall plays a vital role in maintaining cell proliferation, integrity, and intercellular signaling. Stable root intercellular and intracellular structures help maintain root tolerance to waterlogging stress. However, long-term waterlogging stress can lead to changes in the ultrastructure of the root cell wall. Under waterlogging conditions, sub-ambient hypoxia can promote the synthesis of ethylene. The accumulation of ethylene in the root system surrounded by water can induce programmed cell death in the cortical tissue, thereby promoting the remodeling of the root structure and function. Therefore, it is particularly important to study the stress change mechanism of plant root cell walls.

[0004] Structural polysaccharides, cellulose, hemicellulose, and pectin are the main components of the cell wall. Comparative transcriptome analysis revealed that cell wall-related genes were induced by waterlogging stress in different species. During cell wall degradation under biotic stress, changes in the cell wall are caused by polysaccharide composition and are completed by regulating the cross-linking between cellulose, lignin, and pectin polymers. It has been reported that various types of enzymes, including polygalacturonases (PGs), pectin lyases, and pectin methylesterases, are involved in the pectin degradation process. PGs secreted by plant pathogenic fungi, bacteria, nematodes, and insects can degrade the polygalacturonic acid chains in plant cell walls, while plants produce polygalacturonase inhibitory proteins (PGIPs) to inhibit the activity of PGs produced by pathogens and pests. PGIPs are an important component of plant defense mechanisms and play an important role in biotic stress, but their functions in abiotic stress, especially waterlogging, are still unclear. Summary of the invention

[0005] The object of the present invention is to provide PGIP2The application of genes in breeding crops with different waterlogging tolerance.

[0006] The above purpose is achieved through the following technical solutions:

[0007] The rapeseed involved in the present invention BnaPGIP2 Gene, encoding polygalacturonase inhibitory protein, has 2 copies on chromosome A10 and 3 copies on chromosome C09 of rapeseed, which are BnaA10.PGIP2a (BnaA10g24080D), BnaA10.PGIP2b (BnaA10g24090D), BnaC09.PGIP2a (BnaC09g48680D), BnaC09.PGIP2b (BnaC09g48700D), BnaC09.PGIP2c (BnaC09g48930D). Among them, BnaA10.PGIP2b The encoded protein sequence is shown in SEQ ID NO: 1, which contains 332 amino acids. BnaA10.PGIP2b The nucleotide sequence is shown in SEQ ID NO: 2, and the CDS sequence length is 999 bp; BnaC09.PGIP2b The encoded protein sequence is shown in SEQ ID NO:3, and the nucleotide sequence is shown in SEQ ID NO:4.

[0008] The applicant will BnaPGIP2 The gene was transferred into an overexpression vector driven by a 35S constitutive promoter, and then the gene was transferred into the rapeseed genome through Agrobacterium-mediated genetic transformation to achieve overexpression, thus obtaining the gene BnaPGIP2 At the same time, CRISPR / Cas9 gene editing technology was used to obtain genes BnaPGIP2 Materials with missing functionality.

[0009] Next, the waterlogging tolerance of the overexpression and mutant materials was determined. The results showed that under normal conditions, the physiological and growth indicators of the mutant and overexpression strains were similar to those of the wild type. However, under waterlogging conditions, the proline and MDA contents of the mutant were higher than those of the wild type, while the proline content of the overexpression strain was lower than that of the wild type. The leaf water content of the mutant was lower than that of the wild type, while the leaf water content of the overexpression strain was higher than that of the wild type. At the same time, the stem fresh weight and root fresh weight of the mutant showed a downward trend, while the stem fresh weight and root fresh weight of the overexpression strain increased.

[0010] The results show that ,BnaPGIP2 Positively regulate rapeseed's waterlogging tolerance.

[0011] The beneficial effects of the present invention are:

[0012] The present invention first discovered PGIP2The gene has the function of regulating the waterlogging tolerance of crops, and provides important gene resources and germplasm resources for crop waterlogging tolerance breeding. The present invention also provides a method for creating new rapeseed varieties with different waterlogging tolerance and stable inheritance, which has broad application prospects in rapeseed molecular design breeding. Among them, the rapeseed varieties with low waterlogging tolerance created by the present invention can be used as experimental crops for rapeseed waterlogging resistance and gene function research.

[0013] The expression vector described in the present invention refers to any vector known in the prior art that can be expressed in plants. For example, expression vectors suitable for the present invention include but are not limited to pCAMBIA1300S-1, PKSE401, and the like. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 :rape BnaPGIP2 Identification of mutant materials. Black boxes are BnaA10.PGIP2b and BnaC09.PGIP2b The gray part is the exon, and the gray part is the intron and 3'-UTR region; CR-1, CR-2, CR-3 and CR-4 represent mutants of different mutation types. In the mutant schematic, the dotted line in the DNA sequence recognized by sgRNA represents the base deletion, the number in the dotted line represents the number of base deletions, and the bold letters represent the inserted bases and their types.

[0015] Figure 2 :rape BnaPGIP2 Identification of overexpressed materials. A and B are BnaA10.PGIP2b and BnaC09.PGIP2b Gene expression was detected by qRT-PCR. Values ​​are mean ± standard deviation (n=3). ** indicates BnaPGIP2 The expression levels of genes in overexpression materials and wild-type receptor materials were different from those in Student's t Under inspection P <0.01.

[0016] Figure 3 :rape BnaPGIP2 Detection of physiological indices related to waterlogging tolerance of mutants and overexpression lines. A and B are the root proline content of 2-leaf seedlings of mutants and overexpression lines under control (CK) conditions and 7 days of waterlogging treatment, respectively; C and D are the root malondialdehyde (MDA) content of 2-leaf seedlings of mutants and overexpression lines under control (CK) conditions and 7 days of waterlogging treatment, respectively; E and F are the leaf water content of 2-leaf seedlings of mutants and overexpression lines under control (CK) conditions and 7 days of waterlogging treatment, respectively. Values ​​are mean ± SD (n = 6), * indicates Student's t Under inspection P <0.05, ** indicates P <0.01.

[0017] Figure 4 :rape BnaPGIP2 Phenotypic identification of waterlogging tolerance in mutants and overexpression lines. A and B are the fresh weight of stems and roots of mutants under control (CK) conditions and 7 days of waterlogging treatment, respectively; C and D are the fresh weight of stems and roots of overexpression lines under control (CK) conditions and 7 days of waterlogging treatment, respectively. In the same chart, different letters indicate significant differences, and the same letters indicate insignificant differences, n=6, one-way ANOVA P <0.05. DETAILED DESCRIPTION

[0018] For ease of understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. If not specifically indicated, the technical means used in the embodiments are conventional technical means well known to those skilled in the art. If not specifically indicated, the reagents used in the embodiments are commercially available.

[0019] Example 1 BnaPGIP2 Gene overexpression and gene editing vector creation

[0020] Root samples of santana and 23651, two-leaf rapeseed inbred lines, were collected before waterlogging, 12h and 72h after waterlogging treatment, and total RNA was extracted and RNA-seq was performed. Based on the RNA-seq results, the expression levels of genes under different waterlogging treatment times were compared and the modules of differentially expressed genes were divided, and it was identified that the cell wall polysaccharide metabolism pathway in the root system was involved in the waterlogging response. PGIP2 The gene encodes a polygalacturonase inhibitory protein, which is reported to inhibit polygalacturonase activity to slow down pectin degradation and thus cell wall damage. PGIP2 There are 2 copies on chromosome A10 and 3 copies on chromosome C09, which are BnaA10.PGIP2a (BnaA10g24080D), BnaA10.PGIP2b (BnaA10g24090D), BnaC09.PGIP2a (BnaC09g48680D), BnaC09.PGIP2b (BnaC09g48700D), BnaC09.PGIP2c (BnaC09g48930D).

[0021] 1.1 Creation of overexpression vector

[0022] Using the vector pCAMBIA1300S-1 with a constitutive expression promoter, we created BnaA10.PGIP2b (BnaA10g24090D) and BnaC09.PGIP2b(BnaC09g48700D) overexpression recombinant vector. The specific experimental steps are as follows:

[0023] The root RNA samples of Santana were collected 72 hours after waterlogging. EasyScript ® One-Step gDNA Removal and cDNA Synthesis SuperMix was used for reverse transcription according to the instructions. The cDNA obtained by reverse transcription was used for cloning BnaA10.PGIP2b and BnaC09.PGIP2b The full-length CDS sequence. BnaA10.PGIP2b and BnaC09.PGIP2b The full-length CDS sequences of the two primers were highly similar, and the cloning primer pairs were PGIP2-F-BamHI (5'-CGCGGATCCATGGATAAGACAACGACACTG-3') and PGIP2-R-PstI (5'-AACTGCAGTTATTTGTCGTCGTCGTCCTTGTAGTCCATCTTGCAACTATCAAGAGGTG-3'), of which the 5' end of the PGIP2-F-BamHI primer had a BamHI restriction site, and the 5' end of the PGIP2-R-PstI primer had a PstI restriction site and a flag tag. PCR amplification was performed using the Qingke I-5™ 2×High-Fidelity Master Mix.

[0024] The PCR amplification system is as follows:

[0025] I-5™ 2×High-Fidelity Master Mix 25 μL

[0026] PGIP2-F-BamHI (10 μmoL / L)2.5 μL

[0027] PGIP2-R-PstI (10 μmoL / L)2.5 μL

[0028] cDNA1 μg

[0029] Add ddH2O to make up the total volume to 50 μL

[0030] The PCR amplification procedure is as follows:

[0031] Pre-denaturation at 98°C for 1 min; denaturation at 98°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 20 s, 30 cycles; complete extension at 72°C for 5 min after the cycle; PCR products were temporarily stored at 4°C.

[0032] The PCR products were detected by agarose gel electrophoresis andBnaPGIP2 The target gene band was extracted from the gel and recovered using Tiangen's ordinary agarose gel DNA recovery kit. BnaPGIP2 The fragment and pCAMBIA1300S-1 plasmid were double-digested with Thermo Fisher rapid restriction endonucleases BamHI and PstI, respectively.

[0033] The double enzyme digestion system is as follows:

[0034] 10×FD buffer 5 μL

[0035] BamHI1 μL

[0036] PstI1 μL

[0037] PCR product / plasmid 20 μL

[0038] ddH2O2 3 μL

[0039] The enzyme digestion reaction was carried out at 37°C for 1 hour, and the digestion product was recovered using Tiangen DNA purification kit and connected to the vector pCAMBIA1300S-1.

[0040] The connection system is as follows:

[0041] 6.5 μL of PCR product after enzyme digestion recovery

[0042] 2 μL of plasmid after enzyme digestion

[0043] T4 DNA ligase (Thermo Fisher Scientific) 0.5 μL

[0044] 10×T4 ligase buffer: 1 μL

[0045] The ligation system was reacted at 4°C overnight, and the ligation product was transformed into Escherichia coli DH5α by heat shock method.

[0046] The conversion method is as follows:

[0047] Pipette 5µL of the ligation product and 50µL of DH5α E. coli competent cells in an ice-water bath, mix them by pipetting, and place them in an ice-water bath for 30 minutes, then heat shock them in a 42℃ water bath for 90 seconds, and place them on ice for 3 minutes; add 400µL of liquid LB medium without antibiotics, and activate them in a 37℃ shaker for 45~60 minutes; apply the activated bacterial solution to solid LB medium with hygromycin resistance, and culture them at 37℃ for 12~16 hours. Select positive clones and culture them in liquid LB with hygromycin resistance, and culture them in a 37℃ shaker for 12~16 hours. Extract plasmids from the bacterial solution and identify the plasmids by enzyme digestion. Select 10 positive clones for sequencing and screening. BnaPGIP2The CDS sequence of the recombinant plasmid (i.e., overexpression vector) was successfully connected to the vector. The single clone with the correct sequencing was transformed into Agrobacterium competent GV3101 by the click method, and then used for Agrobacterium-mediated genetic transformation of rapeseed.

[0048] 1.2 Creation of gene editing vectors

[0049] Using the CRISPR-Cas9 system (PKSE-401 vector) from the College of Life Sciences of China Agricultural University to create rapeseed BnaPGIP2 The specific experimental steps are as follows:

[0050] The editing targets of the gene were screened by the online website CRISPR-P (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR), and the targets with high scores on the exons were selected for the construction of dual-target editing vectors. The editing targets sgRNA1 (sequence: 5'-CTGTTCGAGGGTCCCACG-3', score: 0.6942) and sgRNA2 (sequence: 5'-ATCTGACCGGAGATCTGAC-3', score: 0.6841) were both located in the first exon region of the gene. Primers were designed according to the target sequence and PCR amplification was performed: four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100 times as a template. DT1-PGIP-BsF and DT2-PGIP-BsR were normal primer concentrations; DT1-PGIP-F0 and DT2-PGIP-R0 were diluted 20 times.

[0051] Primer sequences:

[0052] DT1-PGIP-BsF: ATATATGGTCTCGATTGTCTGTTCGAGGGTCCCACGGTT

[0053] DT1-PGIP-F0:TGTCTGTTTCGAGGGTCCCACGGTTTTAGAGCTAGAAATAGC

[0054] DT2-PGIP-R0:AACGTCAGATCTCCGGTCAGATCAATCTCTTAGTCGACTCTAC

[0055] DT2-PGIP-BsR:ATTATTGGTCTCGAAACGTCAGATCTCCGGTCAGATCAA

[0056] Amplification system:

[0057] I-5™ 2×High-Fidelity Master Mix 25 μL

[0058] DT1-PGIP-BsF (10 μmol / L)2 μL

[0059] DT2-PGIP-BsR (10 μmol / L)2 μL

[0060] DT1-PGIP-F0 (0.5 μmol / L)2 μL

[0061] DT2-PGIP-R0 (0.5 μmol / L) 2 μL

[0062] pCBC-DT1T2 plasmid 3 μL

[0063] ddH2O14 μL

[0064] PCR amplification procedure:

[0065] Pre-denaturation at 98°C for 1 min; denaturation at 98°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 20 s, 30 cycles; total extension at 72°C for 5 min after the cycle; PCR products were temporarily stored at 4°C.

[0066] The PCR products were detected by agarose gel electrophoresis and BnaPGIP2 The target gene band was extracted from the gel and recovered using Tiangen's ordinary agarose gel DNA recovery kit.

[0067] Purify the recovered PCR products and establish the following restriction enzyme digestion-ligation system:

[0068] PCR product 2 μL

[0069] pKSE401 plasmid 2 μL

[0070] 10×T4Buffer 1.5 μL

[0071] 10×BSA1.5 μL

[0072] BsaI (NEB) 1 μL

[0073] T4Ligase (NEB) 1 μL

[0074] ddH2O6 μL

[0075] Reaction conditions: 37°C for 5 h, 50°C for 5 min, and 80°C for 10 min.

[0076] Pipette 5µL of restriction-ligation product and 50µL of DH5α E. coli competent cells in an ice-water bath, mix by pipetting, and place in an ice-water bath for 30 minutes, then heat shock in a 42°C water bath for 90 seconds, and then immediately place in an ice-water bath for 3 minutes; add 400µL of antibiotic-free liquid LB medium and activate in a 37°C shaker for 45-60 minutes; aspirate the activated bacterial solution and spread it on Kana-resistant solid LB medium, and culture at 37°C for 12-16 hours. Select positive clones and culture them in Kana-resistant liquid LB, and culture them at 37°C in a shaker for 12-16 hours. Extract plasmids from the bacterial solution, and use U626-IDF primers and U629-IDR primers for colony PCR identification. Select 3 positive clones for sequencing, and use U626-IDF and U629-IDF primers to sequence the two targets respectively. The vector with the correct sequencing is BnaPGIP2 The CRISPR / Cas9 recombinant plasmid (i.e., gene editing vector) was sequenced correctly and its recombinant plasmid was transformed into Agrobacterium competent GV3101 by click method, and then used for Agrobacterium-mediated genetic transformation of rapeseed.

[0077] Colony PCR and sequencing primers:

[0078] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC

[0079] U629-IDF:TTAATCCAAACTACTGCAGCCTGAC

[0080] U629-IDR: AGCCCTCTTTCTTTCGATCCATCAAC

[0081] Example 2 Creation and identification of rapeseed overexpression materials and mutants

[0082] 2.1 Genetic transformation of rapeseed

[0083] The constructed gene editing vector and overexpression vector were used for genetic transformation of rapeseed using Agrobacterium-mediated genetic transformation. The receptor used for rapeseed transformation in the present invention is Brassica napus Westar. The operation process is detailed in the reference: An efficient Agrobacterium-mediated transformation method using hypocotylas explants for Brassica napus The details are as follows:

[0084] 1) Seed disinfection and sowing: First, soak mature and plump Brassica napus seeds Westar in 75% alcohol for 1 minute, disinfect with 0.15% mercuric chloride solution for 12 minutes, and wash with sterile ddH2O for 5 to 6 times; sow the sterilized seeds in M0 culture medium and culture in the dark at 22℃ in a culture room for 6 to 7 days.

[0085] 2) Agrobacterium activation: Pick the target Agrobacterium, inoculate it into 50mL of liquid LB, culture at 28℃ and 180r / min until OD600 = 0.5~0.8 (about 12~14h), centrifuge at 4000r / min for 8min, discard the supernatant and collect the bacteria, suspend them in suspension DM (containing acetosyringone, the final concentration is 0.05mM), culture at 28℃ and 200r / min for 1h, then pour into a culture dish for later use.

[0086] 3) Infection and co-cultivation: Use sterile forceps and a scalpel to cut the hypocotyls of the seedlings, each with a length of 0.8-1.0 cm; place the cut explants in a dish containing bacterial solution and immerse them for 15 minutes; dry the infected explants with sterile filter paper, transfer them to M1 medium and culture them in the dark at 22°C for 36-48 hours, until a cloud of bacterial colonies appears around the explants.

[0087] 4) Selective culture for callus induction: The hypocotyl explants after co-culture are transferred to the M2 medium for callus induction, which contains timentin (TMT) to inhibit the growth of Agrobacterium and selection antibiotics (hygromycin or kanamycin resistance), and cultured under light for 21 days.

[0088] 5) Differentiation and bud regeneration: Transfer the explants that are growing normally and have swollen ends to differentiation medium M3 for light culture, and subculture every 2 to 3 weeks until green buds appear.

[0089] 6) Bud extension and rooting: The differentiated green buds are transferred to M4 medium for rooting. The rooted seedlings are then moved to small flower pots for seedling hardening. After hardening is completed, they are transplanted to the field to observe the phenotype.

[0090] Culture medium formula:

[0091] M0: 2.2 g / L MS dry powder + 12 g / L Basic agar (agar powder), pH adjusted to 5.8-6.0, (MS dry powder, Sigma, M5519).

[0092] Dilution medium (DM): 4.4 g / L MS dry powder + 30 g / L sucrose + 100 μmol / L AS.

[0093] M1: 4.4 g / L MS dry powder + 30 g / L sucrose + 18 g / L mannitol + 1 mg / L 2,4-D + 0.3 mg / L KT + 100 μmol / L AS + 6 g / L agarose.

[0094] M2: M1 medium + 30 STS + 300mg / L TMT + 25mg / L Hyg.

[0095] M3: 4.4g / L MS dry powder + 10g / L glucose + 0.25g / L xylose + 0.6g / L MES + 2.0mg / L ZT + 0.1mg / L IAA + 200mg / L TMT + 25mg / L Hyg.

[0096] M4: 4.4g / L MS dry powder + 10g / L sucrose + 10g / L Basic agar + 100mg / L TMT.

[0097] STS: Prepare 0.1 mol / L sodium thiosulfate (Na2S2O3) and silver nitrate (AgNO3) respectively, and then mix Na2S2O3 and AgNO3 in a volume ratio of 4:1. Prepare 100 ml of STS solution by adding 20 ml of AgNO3 solution to 80 ml of Na2S2O3 solution. Prepare before use, filter and store in a brown bottle. Except for 2,4-D and KT, which can be added before sterilization, other substances should be added after sterilization.

[0098] 2.2 DNA extraction from transgenic seedlings

[0099] A simple method was used to extract leaf DNA, which was adapted from Plant Functional Genomics. The specific steps are as follows: When the seedlings have more than four leaves, take a small piece of leaf tissue (0.5~1cm 2 ); add steel balls and 500μL of Extraction buffer to the sample, grind the sample for 3 minutes, centrifuge the sample at 12000r / min for 10 minutes; aspirate 400μL of supernatant into a 1.5mL centrifuge tube, add 500μL of isopropanol to precipitate, place in a -20℃ refrigerator for 30 minutes, and centrifuge at 12000r / min for 5 minutes; pour out the ethanol, add 1mL of 75% ethanol to wash for 10 minutes; pour out the 75% ethanol and dry it; add 100μL of ddH2O to the dried sample to dissolve it, and it can be used as a template for PCR reaction after about 1 hour.

[0100] Extraction buffer recipe (1L): 12.1 g Tris, 28.1 g NaCl and 18.6 g Na2EDTA.

[0101] 2.3 Identification of mutant materials

[0102] 1) DNA positive identification of Cas9 encoding gene in gene-edited rapeseed materials

[0103] In the CRISPR / Cas9 gene editing system, the Cas9 protein cuts the double-stranded DNA of the target site, and the double-stranded breaks can be repaired by the cell repair mechanism using non-homologous end joining or homology-directed repair mechanism, ultimately achieving the purpose of modifying the genomic DNA. Therefore, the primers Cas9-F (5'-AGACCGTGAAGGTTGTGGAC-3') and Cas9-R (5'-TAGTGATCTGCCGTGTCTC-G-3') were first used to identify the insertion of the Cas9 encoding gene in the rapeseed genome.

[0104] 2) Identification of target gene editing in gene editing materials

[0105] For Cas9-positive lines, the editing target sites were sequenced to identify the editing type of the plants. BnaA10.PGIP2 The editing target was specifically amplified and sequenced using C-PGIP-A10F / R (C-PGIP-A10F: 5'-GACACTGCTTTTGTTCTTCTTCT-3', C-PGIP-R: 5'- CAGCTGAGCCTGAGGCTC-3'), and the BnaC09.PGIP2 editing target was specifically amplified and sequenced using C-PGIP-C09F / R (C-PGIP-C09F: 5'-GACACTGCTTTTGTTCTTCTCCA-3', C-PGIP-R: 5'-CAGCTGAGCCTGAGGCTC-3'). The PCR product was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing, and the sequencing results were compared to determine the editing results. BnaA10.PGIP2b and BnaC09.PGIP2b Single and double mutants of the gene ( Figure 1 ).

[0106] 2.4 Identification of overexpression material

[0107] 1) Positive identification of DNA levels of overexpressed material

[0108] The transformed plants were tested for insertion of exogenous gene fragments by PCR. The backbone vector of the genetic transformation vector used in this experiment was pCAMBIA1300S-1. The vector-specific universal primer P1 (5'-CCAGGCTTTACACTTTATGC-3') and the gene-specific upstream primer PGIP2-F-BamHI (5'-CGCGGATCCATGGATAAGACAACGACACTG-3') were designed on the backbone vector to perform PCR and detect transgenic seedlings at the DNA level.

[0109] The PCR amplification system is as follows:

[0110] 2×Taq Master Mix (Novozyme) 5 μL

[0111] PGIP2-F-BamHI (10 μmoL / L) 0.5 μL

[0112] P1 (10 μmoL / L) 0.5 μL

[0113] DNA 1 μg

[0114] Add ddH2O to make up the total volume to 10 μL

[0115] The PCR amplification procedure is as follows:

[0116] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 1 min, 35 cycles; after the cycle, complete extension at 72°C for 5 min; PCR products were temporarily stored at 4°C.

[0117] 2) Expression analysis of overexpressed materials

[0118] Extract root RNA samples of overexpression materials with positive DNA levels using the full-length gold EasyScript ®One-Step gDNA Removal and cDNA Synthesis SuperMix was used for reverse transcription according to the method recommended in the manual. The reverse transcribed cDNA was used as a template for qRT-PCR analysis to further detect the fold increase in gene expression levels. Gene expression analysis used quantitative primers PGIP2-QF / R (PGIP2-QF: 5'-TGTCCCTTGATCTCAGCAGG-3', PGIP2-QR: 5'-GGAGAGCTGGTTGTGTGATAGG-3') to detect gene expression abundance, and BnaACTIN7 was used as a normalized internal reference gene (BnACTIN7-F: 5'-CGCGCCTAGCAGCATGAA-3', BnACTIN7-R: 5'-GTTGGAAAGTGCTGAGAGATGCA-3'). The samples were reacted with Perfect Start™ Green qPCR Super Mix according to the instructions, and qRT-PCR was performed on the CFX Connect™ real-time System (Bio-Rad Laboratories, USA). Three technical replicates were set for each sample, and the expression level of the samples was analyzed using 2 -△△Ct Finally, we can obtain BnaA10.PGIP2b The overexpression lines with significantly increased transcription levels were OE-A10-4, OE-A10-7, OE-A10-8, and BnaC09.PGIP2b The overexpression strains with significantly increased transcription levels were OE-C09-2, OE-C09-3, and OE-C09-4 ( Figure 2 ).

[0119] Example 3 Identification of waterlogging tolerance of rapeseed overexpression materials and mutants

[0120] The seeds that grow evenly and plump are sterilized with 75% ethanol for 1 min, and then washed twice with distilled water. The cleaned seeds are germinated on moist filter paper at 24°C until the radicle length grows to about 2-5 mm. The germinated seeds are transplanted to a greenhouse (light:dark, 16:8h) for growth. When the seedlings grow to the 2-3 leaf stage (about 3 weeks after germination), they are flooded to a height of 0.5 cm above the soil surface, and the flooding time lasts for 7 days.

[0121] On the 7th day of waterlogging, the fresh weight of the aboveground stem and root of each plant was weighed. The fresh stem sample was sterilized at 105°C for 30 minutes, the temperature was adjusted to about 60°C and dried to constant weight, and then the stem weight was measured. The leaf water content was calculated using the stem weight and fresh weight data, and the leaf water content = (stem fresh weight - stem weight) / stem fresh weight. The determination of Proline and MDA refers to "Principles and Techniques of Plant Physiology and Biochemistry Experiments (2nd Edition)".

[0122] The proline determination steps are as follows: select 5 representative individual plants, treat rapeseed with waterlogging for 7 days at the 2-leaf stage, and take fresh leaf samples. Put about 0.1g of leaf tissue into 5ml of sulfosalicylic acid (3% w / v) solution and incubate at 100℃ for 30min to extract proline from the leaves. Next, transfer 2ml of proline extract, 2ml of glacial acetic acid, and 2ml of acidic ninhydrin to a clean 10ml centrifuge tube. Then incubate the mixture at 100℃ for another 30min. After cooling, add 4ml of toluene to the solution to promote the transfer of pigments to the toluene layer. The absorbance value of the toluene layer pigment was measured at a wavelength of 520nm using a spectrophotometer (UH5300, HITACHI, Japan).

[0123] The steps for determining MDA are as follows: select 5 representative individual plants, treat the rapeseed with water for 7 days at the 2-leaf stage, and then take fresh leaf samples. Add 5 ml of trichloroacetic acid solution (5% w / v) to a pre-cooled mortar to grind about 0.1 g of leaf tissue. Centrifuge the resulting homogenate at 4°C for 10 minutes. Take 2 mL of the supernatant and mix it with 2 mL of thiobarbituric acid (0.67% w / v) and incubate at 100°C for 30 minutes. After centrifugation for 10 minutes, use a spectrophotometer (UH5300, HITACHI, Japan) to measure the absorbance of the reaction solution at wavelengths of 450 nm, 532 nm, and 600 nm. The MDA concentration is calculated as follows: C MDA =6.45*(A532-A600)-0.56*A450.

[0124] Physiological indicators related to waterlogging damage such as Figure 3The specific results are as follows. Under normal conditions, the proline, MAD and leaf water content levels of mutants and overexpression lines were similar to those of the wild type. After 7 days of waterlogging, the proline content of all mutants (CR-1, CR-2, CR-3 and CR-4) was higher than that of the wild type, while the proline content of all overexpression lines was lower than that of the wild type; the MDA content of all mutants was higher than that of the wild type, while the MDA content of the overexpression lines was similar to that of the wild type after 7 days of waterlogging; the leaf water content of all mutants was lower than that of the wild type, among which the double mutants (CR-2, CR-3 and CR-4) were significantly different from the wild type, while the leaf water content of all overexpression lines was higher than that of the wild type, among which the water content of OE-A10-8 and OE-C09-4 was significantly higher than that of the wild type.

[0125] Growth indicators related to waterlogging such as Figure 4 The specific results are as follows. In the absence of waterlogging treatment, the stem fresh weight and root fresh weight of the mutants and overexpression lines were similar to those of the control; after 7 days of waterlogging treatment, the stem fresh weight and root fresh weight of the mutants showed a downward trend, among which the root fresh weight of the double mutants (CR-3 and CR-4) decreased significantly. On the other hand, after 7 days of waterlogging treatment, the stem fresh weight and root fresh weight of the overexpression lines increased overall compared with the wild type, among which the stem fresh weight of OE-A10-7 and OE-A10-8 increased significantly compared with the wild type, and the root fresh weight of OE-A10-8 and OE-C09-4 increased significantly compared with the wild type.

[0126] Appendix: Description of Sequence Listing

[0127] SEQ ID NO: 1: BnaA10.PGIP2b The encoded amino acid sequence has a sequence length of 332.

[0128] SEQ ID NO: 2: Brassica napus Darmor reference genome BnaA10.PGIP2b The nucleotide sequence has a sequence length of 999bp.

[0129] SEQ ID NO: 3: BnaC09.PGIP2b The encoded amino acid sequence has a sequence length of 332.

[0130] SEQ ID NO: 4: Brassica napus Darmor reference genome BnaC09.PGIP2b The nucleotide sequence has a sequence length of 999bp.

Claims

1. PGIP2 Application of a gene or a protein encoded by the gene in regulating rapeseed waterlogging tolerance, the PGIP2 The nucleotide sequence of the gene is shown in SEQ ID NO:2 or SEQ ID NO:

4.

2. The use according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.1 or SEQ ID NO.

3.

3. A method for improving rapeseed's waterlogging tolerance, characterized in that: Using Agrobacterium-mediated genetic transformation, PGIP2 The gene overexpression vector was transformed into the rapeseed genome to obtain PGIP2 A rapeseed variety with gene overexpression, wherein the PGIP2 The nucleotide sequence of the gene is shown in SEQ ID NO:2 or SEQ ID NO:

4.

4. A method for reducing waterlogging tolerance of experimental crops, characterized in that: The experimental crop is selected from rapeseed, and the targeted PGIP2 The CRISPR / Cas9 gene editing vector of the gene was transformed into the rapeseed genome to obtain PGIP2 A rapeseed variety with a gene function deficiency, wherein the PGIP2 The nucleotide sequence of the gene is shown in SEQ ID NO: 2 or SEQ ID NO: 4.

Images