A method for estimating the age of the pupal stage of the black fly based on troponin T

Abstract

The present invention relates to a method for inferring the age of a black fly during its pupal stage based on troponin T, comprising the following steps: (1) constructing a correlation model between the relative transcriptional expression of a troponin T gene of a known fly pupa sample and the pupal development time; (2) determining the relative transcriptional expression of a troponin T gene of a fly pupa to be detected, and calculating the pupal development time according to the correlation model obtained in step (1). The present invention uses the troponin T gene for the first time to molecularly infer the age of a black fly during its pupal stage, and finds that when the troponin T gene is used in combination with an internal reference gene for molecular inference of a black fly during its pupal stage, the accuracy is higher. The method can accurately determine the developmental process of one or more black fly pupae, reduce the error caused by traditional morphological microscope observation, provide a new detection method for inferring the pupal age of a necrophilic important insect, the black fly, and provide an important reference for forensic determination of the time of death of a corpse.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, and in particular to a method for inferring the age of a black fly in its pupal stage based on troponin T. Background Art

[0002] The black fly is a necrophilous insect of great forensic significance. Its development process includes four stages: egg, larvae, pupa and adult. Adults prefer to lay eggs on decaying animal carcasses, including human corpses. After the eggs hatch, their larvae feed on the corpses and grow rapidly. As the degree of decay of the corpse changes, the development speed of the black fly will also change accordingly. Therefore, in forensic practice, the time of death can be inferred by observing the development process of the eggs, larvae or pupae of the black fly, which is crucial to solving cases. This biological indicator provides another way to assess the time of death in addition to pathology and anatomy.

[0003] Fly pupae are one of the most common insect evidences found at death scenes. The pupal stage accounts for more than 50% of the entire developmental cycle of flies and can even last for several weeks at low temperatures. For fly larvae, they undergo a predictable morphological change process during development, and subsequent changes in indicators such as spiracles, body length, and weight can be used to indicate development time. Compared with larvae, it is more difficult to infer the age of pupae because after the barrel-shaped fly pupa is formed, the body length no longer changes. The pupal shell will only change color in the first few hours, after which the pupal age cannot be inferred from the external morphology of the pupal shell. Therefore, establishing a reliable pupal age inference method is of great significance to forensic practice.

[0004] Existing studies have provided a scientific basis for inferring the age of pupae by peeling off the pupal shell and directly observing the morphological changes of the tissues inside the pupal shell. However, at present, there is no research data on the morphological changes inside the pupae of this species. In addition, due to the inevitable subjective judgment bias of morphological methods, the application of morphological change indicators inside the pupal shell of flies in judicial practice is hindered and the application value is reduced. Therefore, it is necessary to find a method that can accurately infer the development time of the pupal stage of the black fly. Summary of the invention

[0005] In order to solve the above technical problems, the present invention conducts high-throughput screening and confirms for the first time that the combination of troponin T and ribosomal protein S20 genes can be used to infer the pupal development of the black fly, and further optimizes the detection primers to obtain a set of primer pairs with higher detection accuracy, providing a new method for forensic detection.

[0006] The first object of the present invention is to provide a method for inferring the age of the pupal stage of the black fly, comprising the following steps:

[0007] S1. Taking the larvae of the black fly, and detecting the expression levels of the troponin T gene and the internal reference gene therein at certain time intervals after pupation, obtaining the relative expression level of the troponin T gene relative to the internal reference gene, and establishing a relationship model between time and the relative expression level;

[0008] S2. Take the pupae of the black fly to be tested, and obtain the relative expression of the troponin T gene in the pupae of the black fly to be tested relative to the internal reference gene according to the method of S1, substitute the relative expression into the relationship model described in S1, and calculate the pupal age of the black fly to be tested.

[0009] Furthermore, in step S1, the first detection time is within 0 to 3 hours after the black fly pupates.

[0010] Further, in step S1, the detection interval is 1-3 days.

[0011] Furthermore, the calculation formula for the relative expression amount of the troponin T gene relative to the internal reference gene is: the relative expression amount of the troponin T gene relative to the internal reference gene=the expression amount of the troponin T gene / the expression amount of the internal reference gene.

[0012] Furthermore, the expression levels of the troponin T gene and the internal reference gene can be obtained by any feasible quantitative method, such as fluorescent quantitative PCR.

[0013] Furthermore, the internal reference gene can be selected from any one of the ribosomal protein S20 gene, the ribosomal protein S18 gene, and the ribosomal protein L32 gene, and the most preferred one is the ribosomal protein S20 gene.

[0014] Furthermore, the nucleotide sequence of the troponin T gene is shown in SEQ ID NO.1, and the nucleotide sequence of the ribosomal protein S20 gene is shown in SEQ ID NO.2.

[0015] Furthermore, the steps for detecting the gene expression level include peeling off the head of the black fly pupa shell, extracting total RNA from the head, removing DNA interference, reverse transcribing and synthesizing cDNA, and using primers to amplify the troponin T gene and the internal reference gene.

[0016] Furthermore, the primers for amplifying the troponin T gene include SEQ ID NO. 3-4 (most preferred) or SEQ ID NO. 7-8.

[0017] Furthermore, when the internal reference gene is the ribosomal protein S20 gene, the primers for amplifying the internal reference gene include SEQ ID NO.5-6.

[0018] The second object of the present invention is to provide an inference model for the age of the pupae of the plantar black fly, wherein the inference model comprises a relationship curve between the relative expression level of the troponin T gene relative to the ribosomal protein S20 gene in the plantar black fly pupae and the time corresponding to the detected expression level.

[0019] Furthermore, the time corresponding to the detected expression level is based on 0 to 3 hours of pupation of the black fly as the starting time.

[0020] The third object of the present invention is to provide a primer combination for inferring the age of the pupal stage of the black fly, the nucleotide sequence of the primer combination is shown in SEQ ID NO.3-6.

[0021] The fourth object of the present invention is to provide a kit for inferring the age of the pupal stage of the black fly, wherein the kit is used for (quantitatively) detecting (the expression amount of) the troponin T gene and the ribosomal protein S20 gene.

[0022] Furthermore, the kit contains primers for detecting troponin T gene and ribosomal protein S20 gene, and the primers include the above primer combination.

[0023] The fifth object of the present invention is to provide the use of the inference model, primer combination or kit in inferring the age of the pupal stage of the black fly, such as preparing detection products, detection instruments, detection equipment, etc.

[0024] By means of the above scheme, the present invention has at least the following advantages:

[0025] 1. The present invention obtains a group of differentially expressed genes closely related to the pupal age of the plantar black fly through high-throughput screening, and further screens internal reference genes. An association model is constructed based on the differentially expressed genes and the internal reference genes, thereby providing a method for accurately inferring the pupal age of the plantar black fly. The method only requires a small amount of fly pupa samples to accurately determine the pupal development time, which is more representative than the morphological method.

[0026] 2. The determination method of the present invention can avoid the judgment errors of morphological methods, and has the characteristics of quantifiable data, accurate results, and strong practicality. It is more suitable for application in court scenarios, especially when insect evidence is the only valid evidence at the crime scene.

[0027] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a description of the preferred embodiments of the present invention in conjunction with detailed drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to make the contents of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings.

[0029] Figure 1 This is a curve diagram showing the relative relationship between the relative transcription expression level of the troponin T gene in the pupae of the black fly and the development time of the pupae. DETAILED DESCRIPTION

[0030] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0031] The principle and data analysis method of quantitative PCR (Real-time PCR reaction) in the present invention have been disclosed by JH Chefe (JH Chefe, KE Lehmann, IRBushchmann, T. Unger, H.

[0032] Funke-Kaiser, Quantitative real-time RT-PCR data analysis: current concepts and the novel "gene expression's CT difference" formula, Journal of molecular medicine 2006 (84): 901-910), which can be used as a reference by those skilled in the art.

[0033] The present invention aims at the problem that the prior art lacks the morphological change index in the pupal shell and cannot accurately infer the development process of the pupal stage of the black fly. The present invention discloses a scientific and accurate judgment method for the first time, adopts the design of primers and the operation method to obtain the correlation model, and then infers the development process of the pupal stage of the black fly of the same species, and the result is accurate. Except for the primers, the substances involved in the present invention are all conventional substances in the field, and the specific operation methods are all conventional methods in the field.

[0034] A method for accurately estimating the age of the black fly in the pupal stage comprises the following preferred steps:

[0035] (1) Construct a correlation model between the relative transcriptional expression level of the troponin T gene in known fly pupa samples and the pupal development time;

[0036] (2) Determine the relative expression level of the troponin T gene of the fly pupa to be tested, and calculate the pupal development time based on the association model obtained in step (1).

[0037] In the present invention, the species of the black fly in step (1) and step (2) are the same, and the pupal stage duration of each species is determined.

[0038] In the present invention, step (1) specifically includes the following steps: taking pupae of the black fly, the first time taking is the pupae within 0 to 3 hours of pupation; then taking pupae every 48 hours until they emerge as adults; then peeling off the pupal shell, taking the head to extract the total RNA, treating it with DNase, and preparing cDNA by reverse transcription; using the ribosomal protein S20 gene and the troponin T gene as templates, respectively, to amplify by the Real-time PCR method; the relative transcription expression of the troponin T gene is the troponin T gene expression amount / ribosomal protein S20 gene expression amount. Then, a curve equation of the relative transcription expression amount of troponin T and the pupal development time is established as a correlation model.

[0039] In the above technical scheme, in step (1), the starting point of the pupal development time is 0 to 3 hours after pupation, and the end point is the emergence into adults. The black fly pupae are raised in a light incubator (temperature: 24-26°C, humidity: 70-80%, light cycle: 10-14:10-14L:D) from pupation to emergence into adults; the time interval between adjacent pupal development stages is 48 hours; for example, in step (1), the first sampling is within 0 to 3 hours after pupation, and this pupal development time is recorded as D0, and thereafter, the sampling is performed once every 48 hours, which are recorded as D2, D4, D6, D8, D10... in sequence.

[0040] In the above technical scheme, when taking the black fly pupae of different pupal development time in step (1), more than 5 fly pupae are selected as a group each time, and the sampling is repeated for three groups to avoid errors caused by individual differences.

[0041] In the above technical solution, the method for accurately estimating the age of the black fly in the pupal stage is applicable to black fly species in all regions.

[0042] In the preferred technical solution, when establishing a correlation model between the relative transcriptional expression level of the troponin T gene in fly pupae and the pupal development time, a polynomial trend curve is obtained with the pupal development time as the horizontal coordinate and the relative transcriptional expression level of the troponin T gene as the vertical coordinate.

[0043] In the present invention, the extraction of total RNA, the DNase treatment and the reverse transcription and cDNA synthesis were carried out according to the Molecular Cloning Laboratory Guide (3rd Edition).

[0044] The samples (Psoralea punctata pupae) are stored in a -80°C ultra-low temperature refrigerator to avoid RNA degradation, and the storage time should not exceed 30 days.

[0045] In the present invention, the sequences of the troponin T gene and ribosomal protein S20 gene are as follows:

[0046] TnT:

[0047] GGGGGGAGTCGAACCGCAGCATTCGCTCCAACGACGTCAGCTGCTCG

[0048] GACAACAGTAGAGAGTTTAATTTGTTTCTTTTCCCGAAGTTTTTTTAAT

[0049] CCCTAACCATAACCATGTCCGACGATGGAGTACACCAGTTCCGAAGAG

[0050] GAGGAGGAGGTTGTCGAGGAGGTCAGAGAGAAAAAACCACCTCAGA

[0051] CACCAGCCGAAGGTGAGGGCGATCCAGAGTTCATCAAGCGCCAGGAC

[0052] CAAAAGCGCTCCGACCTCGATGATCAATTGAAGGAATACATCAGCGAA

[0053] TGGCGCAAACAGAGAGCCAAGGAGGAGGATGAGTTGAAGAAACTCA

[0054] AGGAGAAACAGGGCCAAGCGCAAGGTCACCCGTGCCGAAGAGGAGC

[0055] AAAAGATGGCTCAGCGCAAGAAGGAAGAGGAAGAGCGCCGCGTTCG

[0056] CGAGGTTGAAGAAAAGAAACAACGCGAAATCGAAGAGAAGCGCCAG

[0057] CGTCTCGAGGAAGCCGAAAAGAAACGCCAAGCCATGCTCCAAGCCAT

[0058] GAAGGACAAGGACAAGAAGGGCCCCAACTTCACCATTGCCAAGAAG

[0059] GAAACAGGCGTGTTGGGTCTCTCCTCCGCCGCCATGGAGCGTAACAA

[0060] GACTAAGGAACAACTCGAAGAAGAGAAGAAGATCTCGCTGTCGTTCC

[0061] GCATTAAGCCTCTTGCCATTGAAGGTTTCAGCGAGCAGAAAATTGCGCG

[0062] AAAAGGCCCAGGAATTGTGGGAACTCATCGTCAAATTGGAAACTGAA

[0063] AAGTATGACTTGGAAGAAAGGCAGAAACGTCAGGACTACGATTTGAA

[0064] AGAATTGAAGGAAAGACAGAAACAACAGCTCAGGCACAAAGCCTTG

[0065] AAGAAGGGTCTCGACCCCGAAGCTTTGACTGGCAAATACCCGCCCAA

[0066] GATCCAAGTCGCCTCCAAGTACGAAAGACGTGTAGACACCGCTCTTA

[0067] CGACGACAAGAAGAAACTCTTCGAAGGTGGCTGGGAAGAACTCGGC

[0068] AAGGAAGTCATTGAAAAGAACTGGAACGAAAGAAGGACCAGTATTC

[0069] CGGCCGTCAAAAATCCAAATTGCCCAAGTGGTTCGGCGAAAGACCCG

[0070] GCAAGAAGGCTGGCGAGCCCGAACACCCGACGGCGAGAAGATGC

[0071] CAAGGCTGATGACGAAATCGCCGAGGATGAAGATGAAGTCGAGGAGGG

[0072] AGGTCGTTGAAGAGAGGATGAGGAGGCCGAAGAGGAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0073] GGAGAGAGAGAAGAGAGGAGGAGGAAGGAAGGAATAATTAATTTA

[0074] ACTACATTTAATAAAAATAAAACAACAAATAATAAATATAGTTATTATTA

[0075] GCTTATTCAACCGCTATCGATTACAGCCACAAACCACTCTAAAGATATT

[0076] TTTTTAAACAAATTTTGAATATCCAAGAAAGAAGAAGAACCAC

[0077] CAAAACATTTCTCCAAATAACATGATAACAAATATCGTATGAAAACA

[0078] ACCAAACAGCATCTTTTTCATGATCATGAGACTATGTAAGGCTTTTCCA

[0079] ATCGCTCTCTCTCTCTCACTCACTCTATAAAATCCAGAACGGAAATCT

[0080] ACCTACTTTTTAGAATCATTTTAACTCACTCTCTTTCTCTCTCTCTCAAT

[0081] CTCTCGTTTCGTATTAGAAAAGAAAAGAAAATTATGTAAACTATTTTTAATTTTTAATAAAATTTTTACTA CGAACACTTG(SEQ ID NO.1)

[0082] RPS20:

[0083] GGGGGCATTTCGTTTTTAACAATTGGCAAGAACTCTGGTTCAGCGCTG

[0084] CTCAAAACGAAGAGATTTGAATACCTCGACCAGATTTCTTTAAAAAAT

[0085] GGCTGCTACAGGCAAAGATATTGAAAGCCCCAAGGTGCTGATTCTTC

[0086] TTCAGTCCATCGCATCCGTATCACTTTGACTTCCAGGAATGTACGTTCC

[0087] TTGGAAAACGTGTGCCGTGATTTGATCAATGGCGCCAAGAACCAAAAT

[0088] TTGCGTGTTAAGGGTCCAGTACGCATGCCAACCAAAGTTTTGCGCATC

[0089] ACCACCCGTAAAACACCTTGTGGTGAAGGTTCAAAGACCTGGGATCG

[0090] TTTCCAGATGAGGATTCACAAGCGCATCATTGATTTGCACTCTCCCTCT

[0091] GAAATCGTCAAGAAAATCACCTCCATCAACATTGAACCTGGCGTAGAA

[0092] GTTGAAGTCACCATTGCCAACTAAACATATACATCATGTTGTATGTATAATGGTGGATTATTGCAATAAATGCAATTTTGATAT(SEQ ID NO.2)

[0093] Example 1 Establishment of an age model for inferring the pupal stage of the black fly

[0094] (1) Materials and Equipment

[0095] The pupae of Hydrotaea chalcogaster Wiedemann, 1924 were bred by Suzhou University; the incubator was a light incubator produced by Shanghai Yiheng Scientific Instrument Co., Ltd.; the gene amplifier was Biosafer9703; the real-time fluorescence quantitative PCR instrument was 96.

[0096] Sample: Take more than 42 fly pupae every 48 hours for model construction.

[0097] (2) Sample collection

[0098] The conventional method was used to raise the black fly until the feeding stage, and the pre-pupae of the larvae was observed every 4 hours. Two hours after the black fly pupated, 14 fly pupae were collected and the heads were taken after the pupal shells were peeled off as a group. Three groups of biological replicates were set, and this pupal development stage was recorded as D0. The pupae were raised under the conditions of temperature 25°C, humidity 75%, and light cycle 12:12L:D until they emerged as adults. 42 fly pupae were taken every 48 hours, and the pupal development stages were recorded as D2, D4, D6, D8, and D10, respectively.

[0099] (3) Determination of target genes

[0100] We used the second-generation Illumina and third-generation PacBio sequencing technologies to study the transcriptional expression profiles of the black fly from the pupal stage to the adult stage at different developmental time points for the first time. The time series patterns were identified and clustered by bioinformatics analysis. According to the MEM.SHIP value and combined with GO and KEGG functional enrichment, the four most representative molecular markers were selected, namely actin 88F, troponin T, anaphase promoting complex subunit 5, and ubiquitin conjugating enzyme E2. The changes in the transcription levels of these four molecular markers were verified by fluorescence quantitative PCR. The study found that with the development of the pupal stage of the black fly, the transcription level of the troponin T gene gradually increased, and the association model with the development time of the pupal stage was the best. It is speculated that this gene plays an important role in the metamorphosis and development of the black fly. Therefore, it is feasible to infer the development process of the pupal stage of the black fly by measuring the relative expression of the troponin T gene and apply it to the inference of forensic death time.

[0101] In terms of the screening of internal reference genes, we screened three ribosomal protein genes, namely ribosomal protein S20, ribosomal protein S18, and ribosomal protein L32, by combining the transcriptional expression profile data at different developmental time points from the pupal stage to the adult stage. The ribosomal protein gene S20 was determined to be the optimal internal reference gene by fluorescent quantitative PCR.

[0102] (4) Quantitative PCR analysis

[0103] The following primers were synthesized according to conventional methods:

[0104] TnT-F1: 5'-CAGCGCAAGAAGGAAGAGGA-3' (SEQ ID NO.3)

[0105] TnT-A1:5'-TGGCTTGGCGTTTCTTTTCG-3'(SEQ ID NO.4)

[0106] RPS20-F1:5'-TCTTCAGTCCATCGCATCCG-3'(SEQ ID NO.5)

[0107] RPS20-A1: 5'-GGTGGTGATGCGCAAAACTT-3' (SEQ ID NO. 6).

[0108] Total RNA extraction, DNase treatment and reverse transcription cDNA synthesis from fly pupae heads: Total RNA extraction, DNase treatment and reverse transcription cDNA synthesis were performed according to the Molecular Cloning Guide (3rd edition).

[0109] Real-time fluorescence quantitative PCR detection: using fluorescent dye SYBR GreenI 96 instrument.

[0110] Real-time PCR reaction system: 2×SYBR Ex Taq (2×) 10μl; ROX Reference Dye (50×) 0.4μl; upstream primer (10μmol / L) 0.4μl; downstream primer (10μmol / L) 0.4μl; cDNA 2.0μl; dH2O 6.8μl; total system 20μl. Reaction conditions are as follows: 95℃1min; 95℃5s, 55℃10s, 72℃10s, 45 cycles. Three independent replicates were performed for all samples.

[0111] (5) Statistics

[0112] According to the method published by JHSchefe, a standard curve was prepared based on the measured Ct value. The standard curve equation of troponin T gene (TnT) was: y = -2.9128x + 22.958, R 2 =0.9949; the standard curve equation of ribosomal protein S20 gene (RPS20) is y=-3.152x+26.191, R 2 =0.9999. According to the Ct value of each sample, the corresponding log value was calculated after averaging the three groups, and then the log value was calculated according to 2- △△CT The corresponding expression is as follows:

[0113] Table 1 Relationship between the development time of fly pupae and the relative transcriptional expression of troponin T gene

[0114]

[0115] The data in Table 1 were statistically plotted. Figure 1 The relative relationship curve of the relative transcription expression of the troponin T gene in the above-mentioned black fly pupa and the development time of the pupa stage is shown. It can be seen that the relative transcription expression of the troponin T gene conforms to the polynomial trend curve model, and the equation is: y = 0.0049x 3 -0.0367x 2 +0.0624x+0.0013,R 2 =0.9991.

[0116] Example 2 Application and verification of the inference of the development process of the pupa stage of fly pupae

[0117] (1) The pupae of Hydrotaea chalcogaster were bred at Soochow University (Wiedemann, 1924). During routine rearing, pupae were randomly selected to infer the developmental process of the pupal stage.

[0118] A fly pupa whose pupal development process needs to be accurately inferred was randomly selected for quantitative PCR detection. The same method as in Example 1 was used to measure the mean Ct of the troponin T gene to be 13.8333 and the mean Ct of the ribosomal protein S20 gene to be 15.2567. According to the standard curve equations of the two genes, the corresponding log values ​​were 3.1326 and 3.4690, respectively. According to 2- △△CT The corresponding troponin T gene expression level was 1357.0945, the ribosomal protein S20 gene expression level was 2944.5191, and the relative expression level of the troponin T gene in the fly pupa was 0.4609. Figure 1 It can be seen that the pupal stage of the fly pupa is between the 6th and 8th day. According to the formula y = 0.0049x 3 -0.0367x 2 +0.0624x+0.0013, we get x≈7.47, so we can judge that the development time of the fly pupa in this sample is 7.47 days.

[0119] (2) Verification of test results:

[0120] The fly pupae of the same batch in the above step (1) were further protected until they emerged as adults. It was observed that the fly pupae emerged as adults after 3 days. According to the known development time from the pupal stage to the emergence of the black fly, it is 10 days in total, which proves that the detection method of the present invention is accurate. At the same time, the detection method is more accurate than the traditional method, and the number of days is accurate to decimal places.

[0121] (3) Repeatability verification of the method for accurately estimating the age of the black fly pupae

[0122] According to the method of step (1), 50 fly pupae are randomly tested again with different time intervals. Figure 1 The pupal ages obtained are consistent with the actual pupal development process.

[0123] Example 3 Inference of the developmental process of the pupal stage after primer replacement

[0124] TnT-F2: 5'-GCGAAAAGGCCCAGGAATTG-3' (SEQ ID NO.7)

[0125] TnT-A2:5'-TTCCTTGCCGAGTTCTTCCC-3'(SEQ ID NO.8)

[0126] RPS20-F1:5-TCTTCAGTCCATCGCATCCG-3'(SEQ ID NO.5)

[0127] RPS20-A1:5-GGTGGTGATGCGCAAAACTT-3'(SEQ ID NO.6)

[0128] The primers in step (4) of Example 1 were replaced with the above primers to obtain the standard curve equation of the troponin T gene: y = -3.3325x + 25.567, R 2 =0.9268, the correlation model equation between the relative transcriptional expression of troponin T gene and the pupal development time is: y = 0.1911x 3 -1.8692x 2 +5.7872x-3.8924, R 2 =0.928. The remaining steps are the same as step (1) of Example 2, and the pupal age is calculated by introducing the correlation model, and x≈6.59 is obtained.

[0129] It can be seen that although the detection accuracy of the method constructed after replacing the primers is slightly worse than that of the method constructed by the primers used in Example 1, it can still be used to infer the age of the pupal stage of the black fly, proving that the detection method of the present invention can be successfully applied to forensic inference.

[0130] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A method for estimating the age of a black fly in the pupal stage, characterized in that: The following steps are involved: S1. Take the larvae of the black fly, and after pupation, detect the expression levels of the troponin T gene and the internal reference gene at certain time intervals to obtain the relative expression level of the troponin T gene relative to the internal reference gene, and establish a relationship model between time and the relative expression level; wherein the internal reference gene is the ribosomal protein S20 gene, and the detection of the expression level of the troponin T gene includes an amplification step, and the primers used for amplification are SEQ ID NO.3-4; S2. Take the pupae of the black fly to be tested, and obtain the relative expression of the troponin T gene in the pupae of the black fly to be tested relative to the internal reference gene according to the method of S1, substitute the relative expression into the relationship model described in S1, and calculate the pupal age of the black fly to be tested.

2. The method according to claim 1, characterized in that In step S1, the first detection time is within 0 to 3 hours after the black fly pupates.

3. A model for estimating the age of the pupal stage of the black fly, characterized in that: The inference model comprises a relationship curve between the relative expression of the troponin T gene relative to the ribosomal protein S20 gene in the pupae of the black fly and the time corresponding to the detected expression; wherein the primer for detecting the expression of the troponin T gene is SEQ ID NO.3-4.

4. The inference model according to claim 3, characterized in that The time corresponding to the detected expression level is based on 0 to 3 hours after the black fly pupates as the starting time.

5. A primer combination for inferring the age of the pupal stage of the black fly, characterized in that: The nucleotide sequence of the primer combination is shown in SEQ ID NO.3-6.

6. A kit for estimating the age of a black fly in the pupal stage, characterized in that: The kit is used to detect the troponin T gene and the ribosomal protein S20 gene. The kit contains primers for detecting the troponin T gene and the ribosomal protein S20 gene. The primers for detecting the troponin T gene are SEQ ID NOs.3-4, and the primers for detecting the ribosomal protein S20 gene are SEQ ID NOs.5-6.

7. Use of the inference model according to claim 3 or 4, the primer combination according to claim 5 or the kit according to claim 6 in inferring the age of the pupal stage of the black fly.

Images