A Staphylococcus aureus strain with odor reduction function and its application

Abstract

The invention discloses a Staphylococcus strain with odor reduction function and its application, belonging to the field of bioengineering technology. Through microbial screening and identification methods, a Staphylococcus sp. MB-Z4 with good growth status, nationally recognized as a food additive, and good degradation ability for the main odor components 4-methylphenol (p-Cresol) and pyrazine produced by fermentation is obtained in the traditional fermentation process of bamboo shoots.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a staphylococcus strain with odor reduction function and application thereof. Background Art

[0002] Fresh bamboo shoots have a short shelf life and a relatively simple taste. In order to facilitate consumers to eat and carry, most bamboo shoots are processed by pickling. Different pickling processes also give bamboo shoot pickles different flavors and tastes, greatly enriching the types of pickled foods. With the continuous establishment and expansion of bamboo shoot processing companies, the processing methods of bamboo shoot products have gradually increased. However, manufacturers have gradually discovered that fresh bamboo shoot products often produce unpleasant odor substances during the fermentation process, and are often accompanied by adverse sensory characteristics such as astringent taste, making it difficult for most consumers to adapt and accept them. This is not the case in the processing of other bamboo products. In addition, there is no definite cause and control method for the generation of fermentation odor. The uncertainty factors of odor generation are relatively large. Many manufacturers cannot control the generation of fermentation odor of bamboo shoots, resulting in the inability of fermented bamboo shoot products to flow into the market normally, resulting in a large waste of raw materials and a sharp increase in operating costs.

[0003] Therefore, the problem of odor in the fermentation of bamboo shoots has become a bottleneck in the processing process, which greatly restricts the further development of the bamboo shoot processing industry. Therefore, if the odor substances produced in the processing of bamboo shoots can be reduced and eventually eliminated, the application scope of bamboo shoots in the market will be expanded, the digestion speed will be accelerated, and the bamboo shoot backlog and waste problems of bamboo shoot farmers will be solved. Summary of the invention

[0004] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0005] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0006] Therefore, the purpose of the present invention is to screen endogenous microbial strains from fermented bamboo shoots, overcome the shortcomings of the prior art, and provide a Staphylococcus strain with odor reduction function, characterized in that: the Staphylococcus strain is Staphylococcus sp. MB-Z4, which is deposited in the China Center for Type Culture Collection, with a deposit number of CCTCC NO: M2024451 and a deposit date of March 18, 2024.

[0007] A preferred embodiment of the Staphylococcus aureus strain of the present invention, wherein: the Staphylococcus aureus strain can grow with 4-methylphenol as the sole carbon source.

[0008] A preferred embodiment of the Staphylococcus aureus strain of the present invention, wherein: the Staphylococcus aureus strain can grow with pyrazine as the sole carbon source.

[0009] Another object of the present invention is to overcome the deficiencies in the prior art and provide an application of a Staphylococcus aureus strain.

[0010] As a preferred embodiment of the application of the present invention, the Staphylococcus aureus strain can be used in the field of food fermentation or for reducing the odor of processed food.

[0011] Beneficial effects of the present invention:

[0012] The invention obtains a Staphylococcus sp. MB-Z4 in good growth state, which is nationally recognized as being usable for food addition and has good degradation ability for 4-methylphenol (p-Cresol) and pyrazine, the main odor components produced by fermentation, in the traditional fermentation process of bamboo shoots through methods such as microbial screening and identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0014] Figure 1 The colony morphology of the strain of the present invention on LB medium.

[0015] Figure 2 This is the result of Gram staining of the strain of the present invention.

[0016] Figure 3 This is the result of Gram staining of a mixture of the strain of the present invention and Escherichia coli.

[0017] Figure 4 This is the phylogenetic tree of the MB-Z4 strain of the present invention.

[0018] Figure 5 This is a test for the ability of the strain of the present invention to degrade odorous substances. DETAILED DESCRIPTION

[0019] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0020] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0021] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0022] In an embodiment of the present invention, a Staphylococcus strain with an odor reduction function is provided, which is Staphylococcus sp. MB-Z4, which has been deposited in the China Center for Type Culture Collection (CCTCC for short, address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Postal Code 430072) on March 18, 2024, and its preservation number is CCTCC NO: M2024451.

[0023] Unless otherwise specified, the raw materials used in the examples of the present invention are all commercially available.

[0024] Example 1

[0025] This embodiment is the separation of strains, comprising the following steps:

[0026] 1.0 g of the traditional fermented bamboo shoots sample was placed in a mortar, 10 mL of sterile water was added and fully ground, insoluble matter was filtered out using sterile gauze, and then centrifuged at low temperature and low speed for 3 to 5 minutes, and 1 mL of the supernatant was taken into a new sterile EP tube to obtain the fermented bamboo shoot treatment liquid;

[0027] Then the fermentation broth was diluted 10 to 10 7 Times, select 10 5 , 10 6 and 10 7 Take 100 μL of each of the three dilution gradients of fermentation broth and spread it on a regular LB solid plate;

[0028] Invert the coated plate and culture it in a 37°C constant temperature incubator for 24 to 36 hours until a single colony of appropriate shape and size grows;

[0029] Pick a number of single colonies with normal growth morphology and place them in LB liquid culture medium, shake and expand them for 24 hours to obtain bacterial liquid.

[0030] Prepare ordinary inorganic salt basal culture medium, divide 1.5mL of inorganic salt culture medium into multiple sterilized 2mL EP tubes, add 1% 4-methylphenol and pyrazine as the only carbon source respectively, among which 4-methylphenol is insoluble in inorganic salt culture medium, so it can be seen in the form of oil droplets spread on the inorganic salt liquid culture medium.

[0031] The different strains to be tested stored in LB liquid culture medium were centrifuged at 12000 rpm for 2 min, the supernatant was removed and the bacteria were retained, the bacteria were washed twice with sterile saline, and then resuspended with 1 mL of sterile saline to avoid the influence of the culture medium on the test results.

[0032] Each strain to be tested was inoculated into two sole carbon source selection media containing 4-methylphenol and pyrazine, and sterile water was inoculated as a negative control group. Each EP tube was strictly sealed with an airtight plastic film to prevent air leakage. The EP tube was placed in a 37°C constant temperature shaker for 48 to 72 hours and the OD was measured. 600 The value was used to detect the growth of bacteria in each tube and observe the presence of oil droplets in the upper layer of the 4-methylphenol selection medium. The strains that can grow in both 4-methylphenol and pyrazine were selected.

[0033] The oil droplets in the negative control group did not disappear, and some oil droplets still existed in the culture tubes corresponding to the inoculation of different strains, and the OD 600 If the value is less than 0.03, it can be considered that the strain cannot use 4-methylphenol as the sole carbon source for growth or the utilization rate is extremely low. Similarly, for strains cultured in pyrazine, if the OD 600 When the value is less than 0.03, it is considered that the strain cannot grow with pyrazine as the sole carbon source or the utilization rate is extremely low.

[0034] Finally, the strain MB-Z4 was screened out, which can not only efficiently utilize 4-methylphenol but also maintain excellent growth state in pyrazine.

[0035] Example 2

[0036] This example is the identification of strains, comprising the following steps:

[0037] 1. Colony morphology

[0038] The morphological characteristics of strain MB-Z4 were as follows: Figures 1 to 3 As shown, it can be seen that the strain presents a smooth surface, golden, white or lemon-colored opaque round protrusions with a diameter of 2-3 mm on LB solid culture medium, regular edges, positive Gram staining, and spherical bacteria, either alone, in pairs or in irregular piles.

[0039] 2. 16S rDNA sequence amplification and analysis

[0040] The genomic DNA was extracted using a bacterial genomic DNA extraction kit as a template for the PCR reaction. The 16S rDNA sequence of the strain was amplified using the universal bacterial primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-TACGGCTACCTTGTTACGACTT-3').

[0041] Reaction system: 2x PhantaMaster Mix 25μL, DNA template 1μL, forward primer 2μL, reverse primer 2μL and distilled water to 20μL. PCR reaction program: 95℃ for 3min, 95℃ denaturation for 15s, 55℃ annealing for 15s, 72℃ extension for 50s, 30 cycles, and finally 72℃ for 10min.

[0042] The PCR products were excised and purified before sequencing.

[0043] The sequencing results are as follows:

[0044] 5'

[0045] -GGCGTGTCTATACATGCAAGTCGAGCGAACGGATAAGGAGCTTGCTCCTTTGAAGTTAGCGGGGGACGGGTGAGTAACACGTGGGTAACCTACCTATAAGACTGGGATAACTTCGGGAAACCGGAGCTAATACCGGATAACATTTAGAACCGCATGGGTCTAAATTGAAAGATGGCTTTGCTATCACTTATTGATGGACCCGCGCCGTATTAGCTAGTTGGTAAGGTAACGGCTTACCAAGGCGACGATACGTAGCCGACCTGAGAAGGGGATCGGCCACCCTGGAACTGAAACACGGTCCCCACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGGGGAAAGCCTGACGGAGCAACGCCGCGGGAGGGATGAAGGGTTTCGGCTCGTAAAACTCTGGTATTAGGGAAAAACAAATGGGTAAGTAACTGTGCACATCTTGACGGGACCTAATCACAAAAACACGCCTAACTACGTGCCACCAGCCGCGGTAATACGTAGGTGGGAAGCGTTATCCGCAATTATTGTGGGTAAAGCGCGCGTAGGCGGGTTCTTATGTCTGATGTGAAAGACCACGGCTCAACCGCGTAGGGTCATTGTGAACTGTGAAACTTGAGAGCGCAAGAGAGAAGAGTGATTCCATGTGTAGCGGGGAGATGTGCAGAGATATGTAGGAACACCAGAGTGGAAAGCGACTCTCTGTGCTGTGACTGAGACTGAGGTGCGAGAGAGCGTGGATCGAACAGGAGTATGATACCCCTGGTGAGTCCACGCCGCCATACGATGAGTGCT-3’

[0046] The 16S rDNA sequencing results of the strain were aligned with the BLASTn sequence on the NCBI website. The results showed that the similarity between the tested strain and the 16S rDNA sequence of Staphylococcus xylosus Mg 16-1 (LN554884.1) was 97.18% (sequence number: OR946361).

[0047] The appropriate strain 16S rDNA sequence was selected and the phylogenetic tree was constructed using MEGA 7.0 software and the Neighbor-Joining (NJ) method. Figure 4 shown.

[0048] 3. Physiological and biochemical experiments and sole carbon source utilization experiments

[0049] In order to finally identify the species of the strain to be tested, a series of physiological and biochemical experiments were carried out on the strain with reference to the Bergey's Manual of Systematic Bacteriology, including catalase experiment, VP experiment, urease hydrolysis experiment, β-galactosidase hydrolysis experiment, β-glucosidase hydrolysis experiment, optimal pH determination experiment, optimal growth temperature determination, and NaCl tolerance experiment in LB. The experimental results are shown in Table 1.

[0050] In the sole carbon source utilization experiment, the selected carbon sources include: glucose, D-xylose, D-fructose, mannose, sucrose, mannitol, melibiose, trehalose, arginine and raffinose. The results of the sole carbon source utilization experiment are shown in Table 2.

[0051] In Tables 1 and 2, "+" represents a positive test result, and conversely, "-" represents a negative test result.

[0052] Table 1 Results of physiological and biochemical experiments on strains

[0053]

[0054] Table 2 Results of the experiment on the sole carbon source of the strain

[0055]

[0056] Combined with the results of physiological and biochemical experiments and molecular identification, it was determined that the odor-degrading strain MB-Z4 screened out in this experiment was Staphylococcus sp. MB-Z4.

[0057] Example 3

[0058] This example is an experiment on the degradation of odorous substances by strains.

[0059] Since 4-methylphenol is present in the form of water-insoluble oil droplets on the surface of the liquid in an aqueous medium, the degradation ability of the strain for 4-methylphenol and pyrazine is determined by measuring the growth state of the strain and the presence of 4-methylphenol, which specifically includes the following steps:

[0060] The MB-Z4 strain, which was washed twice with physiological saline and resuspended, was inoculated into BSM inorganic salt liquid culture medium containing 1% 4-methylphenol and 1% pyrazine at a 2% inoculation rate. After strictly sealing, it was cultured in a 37°C constant temperature shaker at 180 rpm for 72 h. At the same time, a group to which only an equal amount of physiological saline was added was used as a negative control group. After culturing for 72 h, the presence of oil droplets was observed.

[0061] The experimental process and results are as follows Figure 5 shown.

[0062] Among them, (a) shows the culture status of MB-Z4 inoculated in 4-methylphenol as the only carbon source medium at 0 h;

[0063] (b) is the blank 4-methylphenol only carbon source medium, 0h culture condition;

[0064] (c) MB-Z4 was inoculated in pyrazine as the only carbon source medium, 0h culture condition;

[0065] (d) is blank pyrazine-only carbon source medium, 0h culture condition;

[0066] (e) MB-Z4 was inoculated into 4-methylphenol as the only carbon source medium and cultured for 72 h;

[0067] (f) is the blank 4-methylphenol only carbon source medium, 72h culture condition;

[0068] (g) MB-Z4 was inoculated in pyrazine as the only carbon source medium and cultured for 72 h;

[0069] (h) is the blank pyrazine-only carbon source medium, 72h culture condition.

[0070] It can be seen that after 72 hours of culture, the oil droplets in the negative control group still exist, but the oil droplets in the group inoculated with MB-Z4 disappear, and the culture medium is turbid. 600 The value was 0.36, indicating that the strain was able to grow with 4-methylphenol as the sole carbon source; in the medium inoculated with pyrazine, the negative control group was not turbid, and the medium inoculated with the strain had bacterial growth, and the OD 600 The value was 0.61, indicating that the strain was able to grow with pyrazine as the sole carbon source.

[0071] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the present invention.

Claims

1. A Staphylococcus aureus strain with odor-reducing properties ( Staphylococcus sp.), characterized in that: The staphylococcus strain is MB-Z4, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M2024451 and a deposit date of March 18, 2024.

2. The Staphylococcus aureus strain according to claim 1, characterized in that: The Staphylococcus strain is capable of growing with 4-methylphenol as the sole carbon source.

3. The Staphylococcus aureus strain according to claim 1, characterized in that: The Staphylococcus strain is capable of growing on pyrazine as the sole carbon source.

Images