A method for delaying aging of human mesenchymal stem cells and its application

Abstract

The present invention discloses a method for delaying the aging of human mesenchymal stem cells. The method delays the aging of human mesenchymal stem cells by overexpressing the SLFN11 gene in human mesenchymal stem cells. The human mesenchymal stem cell aging model includes a replicative hMSC aging model and a DNA damage-induced hMSC aging model. The overexpression of the SLFN11 gene is achieved by infecting human mesenchymal stem cells with a lentivirus. In addition, the present invention also provides an application of a modified human mesenchymal stem cell in the preparation of a drug for treating ulcerative colitis. The present invention adopts a replicative hMSC aging model and a DNA damage-induced hMSC aging model, and uses a lentivirus infection technology to overexpress SLFN11 in these two aging cell models, which can significantly reduce the aging phenotype of the replicative hMSC aging model and the hMSC aging model caused by DNA damage induced by camptothecin. The cells are inoculated subcutaneously in nude mice, without chromosomal abnormalities and tumorigenicity, and transplanted into an ulcerative colitis mouse model, without immune exclusion reaction, and have better therapeutic effects than normal hMSCs.

Description

Technical Field

[0001] The present invention belongs to the field of stem cells and regenerative medicine, and specifically relates to a method and application of delaying aging of human mesenchymal stem cells by using Schlafen (SLFN) family gene member 11. Background Art

[0002] Mesenchymal stem cells (MSC) have excellent functional characteristics such as multidirectional differentiation ability, immune regulation, and promotion of tissue regeneration and repair, as well as advantages such as low immunogenicity and non-tumorigenicity. They are the most promising cell resources in the field of stem cells and regenerative medicine. In 1995, Lazarus et al. first reported the clinical trial of MSC. Especially after the International Society for Cell Therapy recommended the homogeneity standard of MSC in 2006, MSC clinical trials have sprung up around the world. More than 1,500 MSC clinical trial projects have been registered in the US Clinical Trial Registry for the treatment of various diseases, which can be said to have opened a new era of stem cell therapy. However, compared with a large number of clinical trial projects, the number of MSC products approved for marketing by regulatory agencies is relatively small. The reason is that the inconsistent, unstable and potential risks of MSC products hinder their clinical application. This is largely attributed to the heterogeneity and functional loss of MSC populations prepared by in vitro expansion due to cell senescence. As we all know, MSCs from different sources need to be used in clinical practice with the help of in vitro expansion technology to obtain the cell number or cell biomass that meets the clinical treatment dose. However, it is difficult for in vitro cell expansion to avoid the influence of the cell's own genetic and physiological factors and external environmental factors. Recent studies have shown that the gene expression profile of newly isolated primary MSCs undergoes tremendous changes after expansion and culture. Primary MSCs have multiple functions such as extracellular structural organization, collagen biosynthesis and vascular development. The expanded MSCs lose the inherent functions of MSCs due to the "proliferation-differentiation-aging" process. Moreover, the occurrence of aging not only causes the progressive loss of excellent biological characteristics of MSCs, such as self-renewal, proliferation ability, differentiation potential, immune regulation, migration and homing ability. Senescent cells also affect surrounding healthy cells by secreting senescence-related secretory phenotypes, inducing cell reprogramming, causing healthy cells to age, and forming a vicious cycle. What should be paid more attention to is that the infusion of senescent MSCs into patients not only has no therapeutic effect, but may even cause risks such as immune rejection and canceration of healthy cells. Therefore, the problem of cell senescence during long-term expansion of MSCs in vitro is the Achilles' heel that affects their clinical application, and is also a common key technical bottleneck that urgently needs to be broken through in the frontier of stem cell and regenerative medicine.

[0003] From the perspective of the causes of cell senescence during long-term in vitro expansion of MSC, there are at least two aspects involved. First, long-term in vitro expansion of MSC faces the Hayflick limit, also known as replicative senescence, due to the increase in cell age; second, environmental factors and oxidative stress during the long-term in vitro expansion of MSC lead to DNA damage and imbalance of the intracellular environment homeostasis. As genetic damage accumulates, cell senescence eventually occurs (Guo X, Wang J, Zou W, et al. Exploring microenvironmentstrategies to delay mesenchymal stem cell senescence. Stem Cells Dev 2022;31: 38-52.). So, how to solve this bottleneck problem so that in vitro expanded stem cells do not age or age less, and maintain stem cell function and inherent biological characteristics. The means adopted by the existing technology are:

[0004] First, focus on the in vitro culture environment of MSCs. By simulating the in vivo stem cell microenvironment, the environmental conditions of the in vitro cell growth niche can be effectively improved, including culture medium composition, temperature, oxygen content, three-dimensional culture, etc., to achieve bionic empowerment, which can effectively reduce cell aging caused by environmental stress (Costa LA, Eiro N, Fraile M, et al. Functional heterogeneity of mesenchymal stem cells from natural niches to culture conditions: implications for further clinical uses. Cell Mol Life Sci 2021;78: 447-67.; Guo X, Wang J, Zou W, et al. Exploring microenvironment strategies to delay mesenchymal stem cell senescence. Stem Cells Dev 2022;31: 38-52.;Lee SS , Vu TT, Weiss AS, et al. Stress-induced senescence in mesenchymal stem cells: Triggers, hallmarks, and current rejuvenation approaches. Eur J Cell Biol 2023,102: 151331.).

[0005] The second is the strategy of directly targeting senescent cells, timely eliminating senescent cells or delaying cell senescence, reducing the paracrine side effects of senescent cells on normal cells, creating a good growth environment for cell expansion, and achieving the goal of obtaining young daughter cells, including timely capture and elimination of senescent cells by specific labeling of senescent cells and microfluidic technology (Chen Z, Jiang K, Zou Z, et al. High-throughput and label-free isolation of senescentmurine mesenchymal stem cells. Biomicrofluidics 2020, 14, 034106.), targeted elimination of senescent cells by natural compounds (Wong PF, Dharmani M, Ramasamy TS. Senotherapeutics formesenchymal stem cell senescence and rejuvenation. Drug Discov Today 2023,28:103424.) or delaying cell senescence (Yuan H, Xu Y, Luo Y, et al. Ganoderic acid Dprevents oxidative stress-induced senescence by targeting 14-3-3ε to activateCaM / CaMKII / NRF2 signaling pathway in mesenchymal stem cells. Aging Cell 2022;21: e13686.;Yu C, Yuan H, Xu Y, et al. Hyaluronan delays human amnioticepithelial stem cell senescence by regulating CD44 isoform switch to activate AKT / mTOR signals. Biomed Pharmacother 2024,170:116100)and targeted clearance by immune cells (XIAO Jianhui, LUO Yi, ZHONG Jianjiang, YU Changyin. A method and application for resisting aging of human mesenchymal stem cells and enhancing their stemness characteristics. Patent number: ZL 2020108465981; XIAO Jianhui, LUO Yi, ZHONG Jianjiang, YU Changyi.METHOD FOR RESISTING AGING AND ENHANCING STEMCHARACTERS OF HUMAN MESENCHYMAL STEM CELLS. Patent number: EP3957718). .

[0006] The third is to transform cells through molecular genetic manipulation to make them highly express telomerase or other anti-aging related genes (Piper SL, Wang M, Yamamoto A, et al. Inducible immortality in hTERT-human mesenchymal stem cells. J Orthop Res. 2012;30(12):1879-85.; Bodnar AG,Ouellette M, Frolkis M, et al. Extension of life-span by introduction oftelomerase into normal human cells. Science. 1998; 279(5349):349-352.; He Y,Ji Q, Wu Z, et al. 4E-BP1 counteracts human mesenchymal stem cell senescencevia maintaining mitochondrial homeostasis. Protein Cell 2023, 14: 202-216.)

[0007] Schlafen (SLFN) family genes are only found in mammals and encode proteins with high sequence homology. However, each SLFN has functional differences and differential expression in different tissues and species, and is widely expressed in cancer and normal cells. SLFN family members are involved in various cell biological processes in specific tissues, including DNA replication, proliferation, induction of immune response and inhibition of viral replication, as well as enhancing the sensitivity of DNA-targeted anticancer drugs ( Mavrommatis E, Fish EN, Platanias LC. The schlafen family of proteins and their regulation by interferons. J Interferon Cytokine Res. 2013;33(4):206-10.; Jo U, Pommier Y.Structural, molecular, and functional insights into Schlafen proteins. ExpMol Med. 2022;54(6):730-738.). The human SLFN family consists of five genes (SLFN5, 11, 12, 13 and 14) clustered on chromosome 17. Among them, SLFN11 was discovered by bioinformatics analysis of the cancer cell database. It has two main domains, the N-terminal nuclease domain and the C-terminal helicase domain (Murai J, Thomas A, Miettinen M, et al. Schlafen 11 (SLFN11), a restriction factor for replicative stress inducedby DNA-targeting anti-cancer therapies. Pharmacol Ther. 2019; 201: 94-102).SLFN11 has been shown to be important for drug sensitivity in a variety of cancer cell lines (Murai Y, Jo U, Murai J, et al. SLFN11 inactivation induces proteotoxic stress and sensitizes cancer cells toubiquitin activating enzyme inhibitor TAK-243. Cancer Res. 2021; 81(11):3067-3078.; Zhou C, Liu C, Liu W, et al. SLFN11 inhibits hepatocellular carcinoma tumorigenesis and metastasis by targeting RPS4X via mTOR pathway. Theranostics. 2020;10(10):4627-4643.; Metzner FJ, Wenzl SJ, Kugler M, et al. Mechanistic understanding of human SLFN11. Nat Commun. 2022; 13(1): 5464.). It is a platinum derivative and a topoisomerase. SLFN11 is a determinant of the efficacy of first-line anticancer drugs that target DNA damage, such as TOP)1 inhibitors, TOP2 inhibitors, and alkylating agents. In addition, SLFN11 is used as a biomarker for cancer diagnosis and treatment (Hamada S, Kano S, Murai J, et al. Schlafen family member 11 indicates favorable prognosis of patients with head and neck cancer following platinum-based chemoradiotherapy. Front Oncol. 2023; 12: 978875.; Coleman N, Zhang B,Byers LA, et al. The role of Schlafen 11 (SLFN11) as a predictive biomarkerfor targeting the DNA damage response. Br J Cancer. 2021; 124(5): 857-859.).However, there have been no reports on the function of SLFN11 in delaying cell aging or anti-aging. Summary of the invention

[0008] In order to solve the above problems, the purpose of the present invention is to provide a method and application of delaying the aging of human mesenchymal stem cells using Schlafen (SLFN) family gene member 11, which can safely and effectively resist the aging of human mesenchymal stem cells and maintain their stem cell pluripotency. In order to establish a cell line with stable genetic and biological characteristics, the inventors previously carried out long-term subculture of human MSC (hMSC) derived from different donor amniotic membranes, and planned to construct an immortalized hMSC cell line. A "non-aging" hMSC (named NA-hMSC) was isolated from a donor amniotic membrane. It was continuously expanded for more than 30 generations without showing an aging phenotype and its stemness characteristics were stable. Through whole-genome transcriptome comparison analysis and RT-qPCR verification with hMSC derived from other donor amniotic membranes, several differential genes were mined from NA-hMSC. After removing the reported cell aging-related genes, SLFN11 was found to be a potential candidate gene for hMSC immortality. It was highly expressed in NA-hMSC, and not expressed or extremely low expressed in hMSC derived from other donor amniotic membranes. By using lentiviral transfection technology to construct hMSC strains with knockout and overexpression of related genes, the NA-hMSC cell line with knockout of the SLFN11 gene quickly showed aging phenotypes, including up-regulated expression of the aging marker p16 and increased number of β-galactosidase-positive cells. After complementing the SLFN11 gene or overexpressing the SLFN11 gene in other hMSCs, the cell aging phenotypes included a sharp decrease in the expression level of the aging marker p16 and the number of β-galactosidase-positive cells, confirming that SLFN11 is a key gene for maintaining the rejuvenation of NA-hMSCs and a candidate gene for delaying the aging of human mesenchymal stem cells.

[0009] The purpose of the present invention is achieved through the following technical solutions:

[0010] A method for delaying the aging of human mesenchymal stem cells, overexpressing the SLFN11 gene in human mesenchymal stem cells, and delaying the aging of human mesenchymal stem cells by overexpressing the SLFN11 gene. The SLFN11 gene of the present invention is discovered by comparing the whole genome of the 30th generation NA-hMSC and the 4th generation hMSC.

[0011] Furthermore, the above-mentioned human mesenchymal stem cell senescence includes replicative cell senescence and DNA damage-induced cell senescence.

[0012] Furthermore, the above method for delaying the aging of human mesenchymal stem cells specifically comprises the following steps:

[0013] S1. Establishment of human mesenchymal stem cell aging model;

[0014] S2. The human mesenchymal stem cell aging model was infected with lentivirus to overexpress SLFN11 in the human mesenchymal stem cell aging model.

[0015] Furthermore, the human mesenchymal stem cell aging model includes a replicative hMSC aging model and a DNA damage-induced hMSC aging model.

[0016] Furthermore, the replicative hMSC aging model is obtained by continuously expanding hMSCs in vitro to the 16th generation; the DNA damage-induced hMSC aging model is obtained by treating hMSCs with camptothecin (CPT, 2 μM) for 2 hours to induce DNA damage and cause aging.

[0017] In addition, the present invention also provides a modified human mesenchymal stem cell, which is obtained by overexpressing the SLFN11 gene in the human mesenchymal stem cell using the above method.

[0018] Furthermore, the overexpression of the SLFN11 gene is achieved by infecting human mesenchymal stem cells with a lentivirus.

[0019] Preferably, the lentivirus is an overexpression virus HBLV-h-SLFN11-3xflag-ZsGreen-PURO.

[0020] In addition, the present invention also provides a use of modified human mesenchymal stem cells in the preparation of a drug for treating ulcerative colitis.

[0021] In addition, the present invention also provides a drug combination, comprising the modified human mesenchymal stem cells described above.

[0022] The present invention compares the 30th generation (P30) NA-hMSC and the 4th generation (P4) hMSC derived from human amniotic membrane through the whole genome, and finds that the SLFN11 gene is highly expressed in P30 NA-hMSC, while it is not expressed or very lowly expressed in P4 hMSC; after the SLFN11 gene in the 27th generation NA-hMSC is knocked out through gene knockout technology, the generation of β-galactosidase, a senescence marker, and the expression of p16, a senescence-related marker, of NA-hMSC can be significantly increased, and the stem cells quickly show an aging phenotype. It is found that the SLFN11 gene is a key gene to maintain the youthfulness of NA-hMSC at the P30 generation.

[0023] The present invention adopts a replicative hMSC aging model and a DNA damage-induced hMSC aging model, and uses lentiviral infection technology to overexpress SLFN11 in these two aging cell models, which can significantly reduce the aging phenotype of the replicative hMSC aging model and the camptothecin (CPT)-induced DNA damage-induced hMSC aging model, that is, reduce DNA damage, reduce the expression of aging-related factors such as p16 and p21, reduce the proportion of β-galactosidase-positive cells, and increase the expression levels of cyclin-dependent kinases CDK1 and CDK2, reverse cell cycle arrest, increase the proportion of EdU-positive cells, improve the proliferation ability of the aging hMSC model, and promote the expression of stem transcription factors such as Nanog, Sox2, and Oct4 to maintain hMSC pluripotency. The SLFN11 gene can promote the expression of Bcl-2 anti-apoptotic protein, reduce the expression of pro-apoptotic enzymes and proteins such as Caspase-3 and Bax, improve the anti-apoptotic ability of hMSC, and reduce cell apoptosis. The hMSCs overexpressing the SLFN11 gene constructed by lentiviral infection had normal chromosomal karyotype and were inoculated subcutaneously into nude mice without chromosomal abnormalities or tumorigenicity. The cells were also transplanted into a mouse model of ulcerative colitis without immune exclusion reactions and had better therapeutic effects than normal hMSCs.

[0024] In summary, the method of the present invention can safely and effectively resist the aging of human mesenchymal stem cells (hMSCs) and maintain their stem cell pluripotency. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Figure 2 is a typical phenotypic characteristic diagram of human mesenchymal stem cells (hMSC). In the figure, (A) is a cell morphology characteristic diagram; (B) is a flow cytometry detection of surface molecular markers; (C) is an immunocytochemical staining to detect vimentin and keratin CK19.

[0026] Figure 2 This is a comparison chart of stem cell biological characteristics such as cell morphology, proliferation ability and stemness factors of P4 generation hMSC and P30 generation NA-hMSC.

[0027] Figure 3 This is a comparison chart of the effects of hMSC overexpression of SLFN11 gene and NA-hMSC knockout of SLFN11 gene on SLFN11 protein expression.

[0028] Figure 4 The figure shows the comparison of SLFN11 gene knockout accelerating NA-hMSC aging. In the figure, (A) is the quantitative analysis of p21 protein expression by Western blot; (B) is β-galactosidase staining.

[0029] Figure 5The figure shows a comparison of the effects of overexpression of the SLFN11 gene on long-term in vitro expansion and replicative cell senescence of hMSCs. In the figure, (A) is immunofluorescence staining to detect the DNA damage marker γH2AX; (B) is Western blot quantitative analysis of the DNA damage marker γH2AX; (C) is β-galactosidase staining; (D) is Western blot quantitative analysis of the expression of p16 and p21; (E) is Western blot quantitative analysis of the expression of cyclin-dependent kinases CDK1 and CDK2.

[0030] Figure 6 This is a comparison chart of how overexpression of the SLFN11 gene improves the proliferation ability, multipotency, and anti-apoptosis ability of hMSCs expanded in vitro for a long time. In the figure, (A) is EdU detection of cell proliferation ability; (B) is Western blot quantitative analysis of the expression level of stemness transcription factors; (C) is Western blot quantitative analysis of the expression of apoptosis-related proteins.

[0031] Figure 7 The figure compares the effects of overexpression of SLFN11 gene on camptothecin-induced hMSC senescence; in the figure, (A) is immunofluorescence staining to detect DNA damage marker γH2AX; (B) is Western blot quantitative analysis of DNA damage marker γH2AX; (C) is β-galactosidase staining; (D) is Western blot quantitative analysis of stemness transcription factors.

[0032] Figure 8 The figure shows the effect of overexpression of SLFN11 gene on the cell cycle of hMSC senescence induced by camptothecin. In the figure, (A) is the flow cytometry detection of cell cycle; (B) is the Western blot quantitative analysis of the expression of p16 and p21; (C) is the Western blot quantitative analysis of the expression of cyclin-dependent kinases CDK1 and CDK2.

[0033] Fig. 9 The safety comparison chart of hMSCs overexpressing the SLFN11 gene; in the figure, (A) is the tumorigenicity test; (B) is the chromosome karyotype analysis.

[0034] Fig.10 This is a comparative chart of the efficacy evaluation of hMSC transplantation overexpressing the SLFN11 gene in the treatment of ulcerative colitis in mice; in the figure, (A) shows the change in the length of the mouse colon; (B) is the H&E staining pathological analysis of the colon tissue; (C) is the ELISA detection of the expression of inflammatory factors. DETAILED DESCRIPTION

[0035] The following is an explanation of the implementation of the present invention by specific specific embodiments. People familiar with the technology can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] Example 1: Isolation, culture and identification of human mesenchymal stem cells (hMSC)

[0037] The instruments and PBS buffer (phosphate buffered saline) needed for amniotic membrane extraction were sterilized under high pressure. The placenta after cesarean section was moved to a sterile square dish. The blood stains on the surface of the placenta were rinsed with PBS buffer containing 1% PS. The amniotic membrane tissue on the upper layer of the placenta was peeled off with scissors and tweezers and placed in a wide-mouth bottle filled with PBS buffer.

[0038] In the clean environment of the clean bench, the amniotic tissue was cut into pieces (about 2-5cm2), transferred to a 50 mL centrifuge tube, 0.2% EDTA-2Na-0.5% trypsin was added, and the sealing film was sealed. The mixture was shaken and digested for 90 minutes at 37±5℃ constant temperature shaker, filtered with a 300-mesh filter, and the filtrate was removed. The filtered amniotic membrane was washed 3 times and transferred to a 50 mL centrifuge tube, 0.5 mg / mL type II collagenase-0.05 mg / mL DNaseI digestion solution was added at a ratio of 1:1 to the volume of the amniotic membrane, and the mixture was digested for about 40-60 minutes at a constant temperature shaker at 37±5℃ until the amniotic tissue was flocculent. The mixture was filtered through a 300-mesh filter into a 50 mL centrifuge tube, centrifuged at 250×g for 10 minutes, the supernatant was discarded, the precipitate was resuspended by blowing in an appropriate amount of complete culture medium, and inoculated into a T75 culture flask at 37℃, 5% CO2 incubator, and the adherent cells were primary hMSCs.

[0039] After primary hMSCs were purified and cultured, the second generation (P2) hMSCs showed typical fibroblastic growth and grew in a whirlpool shape with a distinct three-dimensional appearance (e.g. Figure 1 (as shown in Figure A).

[0040] Flow cytometry results showed (eg Figure 1 As shown in Figure B, it highly expresses MSC surface molecules CD105 (78.8%), CD73 (99.9%), CD90 (99.5%), CD44 (99.2%) and CD29 (98.9%), and negatively expresses hematopoietic stem cell markers CD34+11b+19+45+HLA-DR (0.1%). Immunocytochemical staining results showed (as shown in Figure Figure 1As shown in Figure C, hMSCs highly express vimentin, a surface marker of MSCs, and do not express keratin CK19, a marker of epithelial cells. The isolated hMSCs have typical MSC characteristics and are of high purity.

[0041] By comparing the stem cell biological characteristics of P4 (4th generation) hMSC and P30 (30th generation) NA-hMSC, it was observed that the cell morphology of P30 generation NA-hMSC was similar to that of young P4 generation hMSC, showing fibroblastic and spiral growth (e.g. Figure 2 The number of EdU-positive cells in the P4 generation hMSCs was slightly higher than that in the P4 generation hMSCs, and the proliferation ability was very good (e.g. Figure 2 middle immunofluorescence image); Figure 2 The protein immunoblot on the left shows that when P4 hMSCs were passaged to P10, the expression levels of stemness factors such as Oct4 and Sox2 were sharply downregulated, while the expression levels of stemness factors such as Oct4 and Sox2 in P30 NA-hMSCs were not lower than those in P4 hMSCs, and were significantly stronger than those in P10 hMSCs. Therefore, P30 NA-hMSCs still maintain the biological characteristics of stem cells such as morphological characteristics, proliferation ability and pluripotency of young hMSCs.

[0042] Example 2: Construction of hMSCs stably overexpressing / knockout SLFN11 by recombinant lentiviral infection

[0043] The SLFN11 overexpression / knockout lentivirus was constructed by Shanghai Hanheng Biotechnology Co., Ltd. The cloning vector was pHBLV, and the nucleotide sequence of the SLFN11 gene was shown in SEQ ID NO.1.

[0044] SEQ ID NO. 1:

[0045] atggag gcaaatcagt gccccctggt tgtggaacca tcttacccag acctggtcatcaatgtagga gaagtgactc ttggagaaga aaacagaaaa aagctgcaga aaattcagag agaccaagagaaggagagag ttatgcgggc tgcatgtgct ttattaaact caggaggagg agtgattcga atggccaagaaggttgagca tcccgtggag atgggactgg atttagaaca gtctttgaga gagcttattc agtcttcagatctgcaggct ttctttgaga ccaagcaaca aggaaggtgt ttttacattt ttgttaaatc ttggagcagtggccctttcc ctgaagatcg ctctgtcaag ccccgccttt gcagcctcag ttcttcatta taccgtagatctgagacctc tgtgcgttcc atggactcaa gagaggcatt ctgtttcctg aagaccaaaa ggagccaaaaatcttgga gaggacctt ttcacaaaat tcacaagggt gtataccaag agctccctaa ctcggatcctgctgacccaa actcggatcc tgctgaccta attttccaaa aagactatct tgaatatggt gaaatcctgccttttcctga gtctcagtta gtagttta aacagttctc tacaaaacac ttccaagaat atgtaaaaaggacaattcca gaatacgtcc ctgcatttgc aaaacactgga ggaggctatc tttttattgg agtggatgataagagtaggg aagtcctggg atgtgcaaaa gaaaatgttg accctgactc tttgagaagg aaaatagaacaagccatata caactacct tgtgttcatt tttgccaacc ccaacgcccg aataccttca cactcaaaattgtgaatgtg ttaaaaaggggagagctcta tggctatgct tgcatgatca gagtaaatcc cttctgctgtgcagtgttct cagaagctcc caatcatgg atagtggagg acaagtacgt ctgcagcctg acaccgaaatggtagg catgatgaca gacagatc cagatcttgatgatgattgct gagtcattgct agtgggcctc cccttagcag accagtgtac tccagaaag gcctggaaca taaaaaggaactccagcaac ttttattc agtcccacca ggatatttgc gatatactcc agagtcactc tggagggacctgatctctcatcaga gcacagagga ctagaggagt tataaggattcaata cataggatttgcaattgcaat agaagttggg ctgtggacct gaacttgcag gagaagccag gagtcatctg tgatgctctgctgatagcac agacagcac ccccattctc tacaccattc tcagggagca agatgcag ggccaggactactgcactcg caccgcctt actcagctccgaagc ggaaggtgtgtgtcagggcc aaggtcctct gcctgagtcc tgagagcagc gcagaggcct tggaggctgc agtgtccgatggattacc ctgcgtccta tagccttgca ggcacctgagc acatggaagc cctgctgcag cggcttcttagtgagt gtgaccagct cggctgtgag gtttaaatc tgctcacagcccagcagtat gagatattct ccagaagcct ccgcagac agagagttt tgtccacgg cttacctggctcagggaaga ccatcatggc catgaagagatcatggagaaga tcaggaatgt gtttcactgt gaggcacacagaattctcta cgtttgtgaa aaccagcctc tgaggaactt tatcagtgat agaaatatct gccgagcagagacccggaaa actttcctaa gagaaactt tgaacacatt caacacatcg tcattgacga agctcagaatttccgtactg aagatggggga ctggtatggg aaggcaaaaa gcatcactcg gagagcaaag ggtggcccaggaattctctg gatctttctg gattactttc agaccagcca cttggattgc agtggcctcc ctcctctctcagaccaatat ccaagagaag agctcacag aatagttcgc aatgcagatc caatagccaa gtacttacaaaaagaaatgc aagtaattag aagtaatcct tcatttaaca tccccactgg gtgcctcgag gtatttcctgaagccgaatg gtcccagggt gttcagggaa ccttacgaat taagaaatac ttgactgtgg agcaataatgacctgtgtg gcagacacgt gcaggcgctt ctttgatagg ggctattctc caaaggatgt tgctgtgcttgtcagcaccg caaaagaagt ggagcactat aagtatgagc tcttgaaagc aatgaggaag aaaagggtggtgcagctcag tgatgcatgt gatatgttgg gtgatcacat tgtgttggac agttcggc gattctcaggcctggaaagg ttgggatcca tccaaggaca gctgacccag ctatcttacc caatgttctgatctgtctgg cttccagggc aaaacaacac ctgtatattt ttccgtgggg tggccattag。

[0046] P3 (3rd generation) hMSCs and P30 (30th generation) NA-hMSCs were inoculated in 6-well plates, and the virus stock solution was added for treatment according to the 1 / 2 volume infection method. P3 generation hMSCs were divided into negative control group (Control, without virus solution), empty negative control group (Mock-vehicle, Figure 3 In the left figure, it is abbreviated as vehicle, with empty virus HBLV-ZsGreen-PURO added) and SLFN11 overexpression group (h-SLFN11, with overexpression virus HBLV-h-SLFN11-3xflag-ZsGreen-PURO added); P30 NA-hMSCs are divided into negative control group (Control, without virus solution), empty negative control group (Mock-vehicle, Figure 3 In the right figure, it is abbreviated as vehicle, adding empty virus HBLV-ZsGreen-PURO) and SLFN11 knockout group (sh-SLFN11, adding knockout virus HBLV-h-SLFN11- shRNA-mcherry-PURO), and each group was replaced with fresh complete culture medium after 24 hours. Western blot was used to detect the transfection effect, and the results are shown in Figure 3 As shown (P3 generation hMSC detection diagram is as shown Figure 3 The left picture shows the detection of P30 NA-hMSC. Figure 3 (right figure) 72 hours after infection, it was observed that hMSCs that did not express or weakly expressed SLFN11 protein had a sharp increase in SLFN11 protein expression level after overexpressing the SLFN11 gene (h-SLFN11 group), while NA-hMSCs that highly expressed SLFN11 protein had a sharp decrease in SLFN11 protein expression level after knocking out the SLFN11 gene (sh-SLFN11 group), which proved that the lentiviral infection was effective.

[0047] Example 3: Establishment of cell senescence model

[0048] Construction of replicative MSC aging model: hMSCs were cultured in vitro for a long time until P16. P16 hMSCs had a typical aging phenotype, and cell aging markers such as β-galactosidase, p16 and p21 were detected (see Figure 5 Figure C and Figure 5 The control group in Figure D) can be used as a replicative aging model.

[0049] Construction of MSC aging model caused by CPT-induced DNA damage (DNA damage-induced hMSC aging model): hMSCs of P3 generation with good growth condition were treated with CPT at a final concentration of 2 μM for 2 hours, and then replaced with fresh complete medium. After culturing for 48 hours, the cells showed a typical aging phenotype, and cell aging markers such as β-galactosidase, p16 and p21 were detected (see for details). Figure 7 The CPT group in Figure C and Figure 8 CPT group in Figure B).

[0050] Example 4: Effect of SLFN11 knockout on aging of NA-hMSCs

[0051] The 24th generation NA-hMSCs were seeded in a 6-well cell culture plate at a density of 3×105 / well. After 24 hours of culture, the virus stock solution was added and replaced with fresh culture medium after 24 hours. The culture was continued to the 27th generation (P27). P27 NA-hMSCs were divided into a negative control group (Control, without virus solution) and an empty negative control group (Mock-vehicle, Figure 4 The cells were abbreviated as Mock in the table, and empty virus HBLV-ZsGreen-PURO was added) and three SLFN11 knockout groups (sh-1-SLFN11, sh-2-SLFN11 and sh-3-SLFN11, and knockout virus HBLV-h-SLFN11- shRNA-mcherry-PURO was added). The cells were inoculated in 12-well and 6-well cell culture plates at a density of 2×105 / well and 5×105 / well, respectively. After 48 hours of culture, the production of β-galactosidase in each group was detected, and the total cell protein was extracted to detect the expression of aging-related protein p16. Figure 4 As shown, the number of β-galactosidase-positive cells (blue) was significantly increased in NA-hMSCs with SLFN11 knockout (SLFN11 knockout group), and the expression level of p16 was significantly upregulated (p<0.01). Therefore, SLFN11 knockout can cause the immortal cell line NA-hMSC to lose its anti-aging ability.

[0052] Example 5: Effect of SLFN11 on replicative senescence of long-term in vitro expanded hMSCs

[0053] hMSCs were continuously expanded in vitro to P16, and then divided into a negative control group (Control, without virus solution), an empty negative control group (Mock-vehicle, with empty virus HBLV-ZsGreen-PURO) and an overexpression SLFN11 group (h-SLFN11, with overexpression virus HBLV-h-SLFN11-3xflag-ZsGreen-PURO). The cells in each group were grown to 80%-90% in the plate, fixed with 4% PFA for 30 min, washed 3 times with PBS, permeabilized with 0.3% Triton X-100 for 10 min, washed 3 times with PBS, blocked with 0.5% BSA for 1 h, and finally incubated with primary antibody at 4°C overnight. The next day, the cells were incubated with fluorescent secondary antibody from the same source in the dark for 1 h and observed under a microscope. Immunofluorescence staining results of DNA damage marker γH2AX (such as Figure 5 Figure A in the middle shows that the fluorescence intensity and number in the nucleus of the control group were significantly higher than those of hMSCs overexpressing SLFN11 (h-SLFN11 group), indicating that overexpression of SLFN11 can effectively alleviate the accumulation of DNA damage during long-term in vitro expansion of hMSCs. Further quantitative analysis of γH2AX protein immunoblotting obtained consistent results, and overexpression of SLFN11 can significantly reduce the expression level of γH2AX protein (p<0.01) ( Figure 5 Therefore, overexpression of SLFN11 can effectively reduce the accumulation of DNA damage caused by replicative senescence of hMSCs.

[0054] The β-galactosidase positive cell rate of P16 hMSC was detected by β-galactosidase staining. The β-galactosidase staining working solution was prepared according to the kit, the cells at the corresponding time point were taken out, the culture medium in the well was aspirated, 1 mL of fixative solution was added, fixed at room temperature for 30 min, washed 3 times with PBS, 1 mL of staining working solution was added to each well, and incubated in a 37°C water bath until obvious blue-stained cells appeared, and observed under an optical microscope. Figure 5 As shown in Figure C, after long-term in vitro expansion culture, intracellular β-galactosidase accumulated in hMSCs, and the number of positive cells (blue-stained cells) increased. However, in hMSCs overexpressing the SLFN11 gene (h-SLFN11 group), the cell positive rate decreased from (74.52±2.15)% to (37.28±4.73)%. Therefore, overexpression of SLFN11 can effectively reduce the replicative senescence of hMSCs.

[0055] Based on the common cell cycle arrest, decreased proliferation ability, and progressive loss of stem cell pluripotency in senescent cells, the effect of SLFN11 on changing these senescent phenotypes of hMSC was evaluated. The cell proteins of the corresponding groups were extracted, denatured, and the expression of related proteins was detected by Western blot. The results are as follows: After long-term passage of hMSC, the expression of cell cycle regulatory proteins (also senescence-related markers) p16, p21, and p53 in P16 cells (Control group) increased (such as Figure 5 As shown in Figure D), the expression of cyclin-dependent kinase (CDK) 1 and CDK 2 decreased, leading to cell cycle arrest (as shown in Figure Figure 5 E), while overexpression of SLFN11 in P16 hMSCs effectively reduced the expression levels of proteins p16, p21, and p53 (p<0.05 or p<0.01) (as shown in Figure 5E). Figure 5 D), and increased the expression levels of CDK1 and CDK2 proteins (p<0.05 or p<0.01), and reversed the cell cycle arrest (as shown in Figure 5 (Figure E). Therefore, overexpression of SLFN11 can regulate the expression levels of cell cycle regulatory proteins and cell cycle-dependent protein kinases and reverse the cell cycle arrest caused by replicative senescence of hMSCs.

[0056] Example 6: Overexpression of SLFN11 improves stem cell proliferation, pluripotency and anti-apoptosis ability

[0057] EdU kit was used to detect cell proliferation ability. hMSCs were divided into negative control group (Control, without virus solution), empty negative control group (Mock-vehicle, empty virus HBLV-ZsGreen-PURO was added) and overexpression SLFN11 group (h-SLFN11, overexpression virus HBLV-h-SLFN11-3xflag-ZsGreen-PURO was added). Cells were cultured in 6-well plates until the corresponding time point, the original culture medium was aspirated, 1×EdU working solution was added, and incubated in the incubator for 2 h. After EdU labeling cells to the time point, the culture medium was removed, and the cells were resuspended in PBS after trypsin digestion. The precipitate was collected by centrifugation, 1 mL of 4% PFA fixative was added, fixed at room temperature for 30 min, 1 mL of 0.3% TritonX-100 was added, and the membrane was permeabilized at room temperature for 15 min. The reaction working solution was prepared according to the test instructions, 0.5 mL of reaction working solution was added to each tube, and incubated at room temperature in the dark for 30 min. PBS was washed 3 times, 3-5 min each time. Detection was performed on the machine. Figure 6The results in Figure A show that when hMSCs were expanded in vitro to P16, the proportion of EdU positive cells was only (24.67±5.28)%, while the proportion of EdU positive cells in P16 hMSCs overexpressing SLFN11 reached (47.18±2.63)%, indicating that overexpression of SLFN11 can improve the proliferation ability of cells. The expression of three major stemness factors, Nanog, Sox2, and Oct4, also showed that the expression levels of all three stemness factors in hMSCs overexpressing the SLFN11 gene were significantly higher than those in the Control group (p<0.05) (Figure 2 Figure 6 This indicates that overexpression of SLFN11 can effectively maintain the pluripotency characteristics of hMSCs. In addition, we also tested the effect of overexpression of SLFN11 on apoptosis in the replicative senescence MSC model. Figure 6 As shown in Figure C, the expression of Bcl-2 in the SLFN11 overexpression group was upregulated (p<0.01), while the expression of Bax and Caspase-3 splicing forms was significantly downregulated (p<0.05 or p<0.01). In summary, overexpression of SLFN11 can reverse the replicative senescence of hMSCs, reshape cell proliferation ability, maintain stem cell pluripotency, improve cell anti-apoptosis ability, and reduce cell apoptosis.

[0058] Example 7: Effect of overexpression of SLFN11 on camptothecin-induced hMSC senescence

[0059] In order to further confirm the anti-aging function of SLFN11 gene, a drug-induced hMSC aging model was constructed. Camptothecin (CPT) can induce cell DNA damage, leading to cell senescence. We took P4 hMSC or P4 hMSC overexpressing SLFN11 and divided them into four groups: normal control group (Control, no CPT treatment, no virus solution), empty negative control group (CPT+vehicle or CPT+Mock-vehicle, CPT treatment and addition of empty virus HBLV-ZsGreen-PURO) and overexpression SLFN11 group (CPT+h-SLFN11, CPT treatment and addition of overexpression virus HBLV-h-SLFN11-3xflag-ZsGreen-PURO), inoculated in 6-well cell culture plates at a density of 1×106 / well, treated with CPT (2 μM) for 2 hours, and then tested the following indicators:

[0060] After CPT treatment, DNA damage was induced. We detected the expression of DNA damage marker γH2AX by immunofluorescence staining and WB. Figure 7As shown in Figure A, compared with the normal control group (Control group), the fluorescence intensity (red) and number of γH2AX increased significantly after CPT treatment, and overexpression of SLFN11 partially alleviated this situation. Figure 7 As shown in Figure B, the expression level of γH2AX in the CPT+h-SLFN11 group was significantly reduced compared with the CPT group. Therefore, overexpression of SLFN11 can effectively alleviate the accumulation of DNA damage in hMSC senescence induced by CPT.

[0061] The results of the aging marker β-galactosidase staining experiment showed that compared with the normal control group, the number of β-galactosidase-positive cells (blue-stained cells) in the CPT group increased significantly, and the positive cell rate increased from (10.83±2.79)% to (65.56±4.37)%, while the positive cell rate of the SLFN11 overexpression group (CPT+h-SLFN11 group) was only (43.76±3.16)% (Fig. Figure 7 Therefore, overexpression of SLFN11 can effectively reduce CPT-induced hMSC senescence.

[0062] In addition, if Figure 7 As shown in Figure D, compared with the normal control group (Control group), CPT can significantly reduce the expression of Sox2, Nanog, and Oct4, the main stemness factors of hMSC (p<0.05), but it has no effect on hMSC overexpressing SLFN11; compared with the CPT group, the CPT+h-SLFN11 group significantly enhanced the expression levels of these stemness factors (p<0.05 or p<0.01). Therefore, overexpression of SLFN11 can maintain the stem cell pluripotency of hMSC.

[0063] Example 8: SLFN11 reverses cell cycle arrest caused by camptothecin-induced hMSC senescence

[0064] Flow cytometry was used to detect the cell cycle. Well-growing cells were taken and divided into four groups: normal control group (Control, no CPT treatment and no virus solution), empty negative control group (CPT+vehicle or Mock-vehicle, CPT treatment and addition of empty virus HBLV-ZsGreen-PURO) and overexpression SLFN11 group (CPT+h-SLFN11 or h-SLFN11, CPT treatment and addition of overexpression virus HBLV-h-SLFN11-3xflag-ZsGreen-PURO). After treatment with CPT, the cells were washed once with PBS, and the cell pellets were collected by centrifugation at 150×g for 5 min. 500 μL of 70% pre-cooled ethanol was added for fixation overnight and stored at 4°C. The fixative was washed with PBS, 100 μL of RNase A solution was added to the pellet, and it was carefully pipetted and mixed, and then placed in a water bath at 37°C for 30 min. Add 400 μL of PI staining solution, mix well by pipetting, and incubate at 4°C in the dark for 30 min. Detect on the microscope and record the red fluorescence at the excitation wavelength of 488 nm. Figure 8 As shown in Figure 2, compared with the normal control group (Control group), CPT treatment caused a significant upregulation of the expression of cell cycle regulatory proteins (also aging-related markers) p21 (p<0.01), p16 (p<0.01), and p53 (p<0.05) proteins (as shown in Figure 2). Figure 8 Meanwhile, the expression levels of cell cycle-dependent protein kinases CDK1 and CDK2 were significantly decreased (p<0.05) (as shown in Figure B) Figure 8 As shown in Figure C), the cell cycle was arrested at the G2 / M phase, and the percentage of cells in the G2 / M phase increased from (20.65±1.31)% to (41.95±0.95)% (as shown in Figure Figure 8 The SLFN11 overexpression group (CPT+h-SLFN11) reduced the proportion of G2 / M phase cells to (33.07±1.36)% (as shown in Figure A). Figure 8 As shown in Figure A), the expression levels of p21, p16, p53 and other proteins were significantly downregulated (p < 0.05) (as shown in Figure Figure 8 The protein levels of CDK1 and CDK2 increased significantly (p<0.05). Figure 8 (As shown in Figure C). Therefore, overexpression of SLFN11 can effectively regulate the expression levels of cell cycle regulatory proteins and cell cycle-dependent protein kinases, and alleviate the cell cycle arrest caused by CPT-induced hMSC senescence.

[0065] Example 9: Safety analysis of hMSCs overexpressing SLFN11

[0066] After one week of adaptive feeding, 4-week-old BALB / c nude mice were randomly divided into 4 groups, labeled as PBS, hMSC, h-SLFN11 hMSC and A549, with 5 mice in each group, for a total of 20 mice. Among them, 100 μL of normal hMSCs, hMSC overexpressing SLFN11 and non-small cell lung cancer A549 cells (1×107 / mouse) were injected into the armpit of each nude mouse in the hMSC, h-SLFN11 hMSC and A549 groups. 100 μL of sterile PBS was injected in the PBS group. During the observation period, body weight was measured regularly every week, and tumor growth was observed and recorded. On the 6th day after cell transplantation, obvious masses appeared in the A549 group, and the volume of the masses gradually increased with time. On the 35th day after cell transplantation, the A549-bearing mice were killed, the masses were dissected out, the length and width were measured, and the weight was weighed. The other groups continued to be observed until the 90th day. The results of the subcutaneous tumor formation experiment in nude mice are shown in the figure. Fig. 9 As shown in Figure A, among the solvent control PBS group, normal hMSC group, h-SLFN11hMSC group and A549 positive control group, only the A549 group nude mice were found to have lumps in the armpits.

[0067] After the cells were treated with 40μg / mL colchicine for 3 hours, the cells were collected and treated with 0.075mol / L KCl solution for hypotonicity to fix the cells. Use a pipette to draw the cell suspension to an appropriate height (10cm-20cm) and drop it on the slide. Add 2 drops of suspension to each slide (the temperature of the drop slide is required to be 20-25℃, and the humidity is 40%-60%), and immediately put it in a 90℃ oven for baking. Observe the number of metaphase cells, chromosome length, dispersion and other general morphology under a phase contrast microscope. Place the prepared slides in a 37℃ oven for baking. The baked chromosome slides are treated with Giemsa working solution for color development, dried and scanned on the machine. The results of chromosome karyotype analysis are as follows: Fig. 9 As shown in Figure B, the chromosomal karyotype of hMSCs overexpressing SLFN11 remained normal. In summary, hMSCs overexpressing SLFN11 constructed by lentiviral infection have no tumorigenicity, no chromosomal abnormalities, and no safety issues.

[0068] Example 10: Evaluation of the therapeutic efficacy of hMSCs overexpressing SLFN11 in the treatment of ulcerative colitis in mice

[0069] 7-8 week old C57BL / 6 male mice, weighing 20-22g. After one week of adaptive feeding under SPF conditions, the mice were allowed to drink freely with 3% DSS in drinking water for 7 consecutive days to establish an ulcerative colitis mouse model. A total of 40 mice were randomly divided into 4 groups, 10 mice / group, and marked as Normal, DSS, DSS+hMSC, and DSS+h-SLFN11+hMSC. Before the start of modeling and on the fourth day, the DSS+hMSC and DSS+h-SLFN11+ hMSC groups were injected with 0.2mL of normal hMSC and SLFN11 overexpressing hMSC (1.0×106 / mouse) through the tail vein, respectively, and the DSS group was injected with 0.2ML of normal saline. The weight of the mice, stool characteristics (loose stool, diarrhea, bloody stool), and mouse mortality were recorded every day. It was observed that on the fourth and fifth days of DSS feeding, the mice began to show obvious symptoms of inflammatory colitis, including a sharp drop in weight and bloody stools.

[0070] After 9 days of hMSC transplantation, the mice were killed under isoflurane anesthesia, and the complete colon was removed and measured in length. Part of the colon segment was placed in an embedding box, fixed with 4% paraformaldehyde overnight, embedded in paraffin, and made into 4 μm thick histological sections for hematoxylin-eosin (H&E) staining. The crypt structure of the colon tissue, the degree of inflammatory cell infiltration, and the goblet cell structure were observed under a microscope. Fig.10 As shown, the colon length of mice in the DSS group was significantly shortened ( Fig.10 As shown in Figure A, the morphological structure of colon tissue is severely damaged, the goblet cells in the mucosal layer are disordered and reduced in number, there is a large number of inflammatory cells infiltrating, and the crypt structure completely disappears ( Fig.10 hMSC transplantation can significantly alleviate DSS symptoms, maintain the length of the mouse colon, and reduce pathological changes in colon tissue. In particular, the effect of hMSC overexpression of SLFN11 is more obvious, which can better maintain the structural integrity of colon tissue cells ( Fig.10 The therapeutic effect was better than that of the hMSC group.

[0071] Blood was collected from mice by venous sampling, and the blood was allowed to rest for 2 hours, and then centrifuged to separate the serum. The expression of inflammatory factors in the serum was detected using an ELISA kit. Fig.10 As shown in Figure C, the expression of pro-inflammatory factors IL-1β, IL-6, and TNF-α in the serum of mice in the DSS group increased significantly (p<0.01). Compared with the DSS group, hMSC treatment had a significant inhibitory effect on these inflammatory factors (p<0.01), especially in the hMSC group overexpressing SLFN11, which was significantly different from the hMSC group (p<0.01).

[0072] In summary, hMSC overexpressing SLFN11 can significantly alleviate the symptoms of ulcerative colitis in mice and has a better therapeutic effect than normal hMSC transplantation.

[0073] Other aspects of the present invention that are not described in detail are all conventional techniques known to those skilled in the art.

[0074] It should be noted that the terms "comprises", "includes" or any other variations are intended to cover non-exclusive inclusion, so that a process, method, article or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or apparatus.

[0075] The protection scope of the present invention is not limited to the technical solutions disclosed in the specific implementation methods. Any modifications, equivalent replacements, improvements, etc. made to the above embodiments based on the technical essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A method for delaying aging of human mesenchymal stem cells, characterized in that: The SLFN11 gene is overexpressed in human mesenchymal stem cells, and the nucleotide sequence of the SLFN11 gene is shown in SEQ ID NO.

1.

2. The method for delaying aging of human mesenchymal stem cells according to claim 1, characterized in that: The human mesenchymal stem cell senescence includes replicative cell senescence and DNA damage-induced cell senescence.

3. The method for delaying aging of human mesenchymal stem cells according to claim 1, characterized in that: The following steps are involved: S1. Establishment of human mesenchymal stem cell aging model; S2. The human mesenchymal stem cell aging model is infected with lentivirus to overexpress SLFN11 in the human mesenchymal stem cell aging model. The nucleotide sequence of the SLFN11 gene is shown in SEQ ID NO.

1.

4. The method for delaying aging of human mesenchymal stem cells according to claim 3, characterized in that: The human mesenchymal stem cell aging model includes a replicative hMSC aging model and a DNA damage-induced hMSC aging model.

5. The method for delaying aging of human mesenchymal stem cells according to claim 4, characterized in that: The replicative hMSC aging model is obtained by continuously expanding hMSC in vitro to the 16th generation; the DNA damage-induced hMSC aging model is obtained by treating hMSC with camptothecin (CPT) at a final concentration of 2 μM for 2 hours to induce DNA damage and cause aging.

6. A modified human mesenchymal stem cell, characterized in that: The method according to any one of claims 1 to 5 is used to overexpress the SLFN11 gene in human mesenchymal stem cells, wherein the nucleotide sequence of the SLFN11 gene is shown in SEQ ID NO.

1.

7. The modified human mesenchymal stem cell according to claim 6, characterized in that: The overexpression of the SLFN11 gene is achieved by infecting human mesenchymal stem cells with lentivirus.

8. The modified human mesenchymal stem cells according to claim 7, characterized in that: The lentivirus is the overexpression virus HBLV-h-SLFN11-3xflag-ZsGreen-PURO.

9. Use of the modified human mesenchymal stem cells according to claim 6 in the preparation of a drug for treating ulcerative colitis.

10. A drug combination, characterized in that: Comprising the modified human mesenchymal stem cells according to claim 6.

Images