InDel markers of peanut dwarfing genes and their application in molecular-assisted breeding

Abstract

The present invention discloses a peanut dwarf gene InDel marker DW‑1, whose nucleotide sequence is shown in SEQ ID NO.1; the InDel marker is located at 11886663 of peanut chromosome A02, and the nucleotide sequence of its corresponding wild-type gene is shown in SEQ ID NO.2, which is represented by a 16bp base insertion. Application of the InDel marker DW‑1 in molecular assisted breeding. The present invention also discloses specific primers for amplifying the InDel marker DW‑1, including upstream primers and downstream primers, and the nucleotide sequence is shown in SEQ ID NO.3 and SEQ ID NO.4. Application of the specific primers in molecular assisted breeding. The InDel marker DW‑1 of the present invention can clearly distinguish between tall and dwarf peanut materials, and can be used for molecular assisted breeding of dwarf peanuts.

Description

Technical Field

[0001] The invention relates to a peanut dwarf gene InDel marker and application thereof in molecular assisted breeding, belonging to the technical field of molecular biology. Background Art

[0002] Molecular markers are not affected by environmental conditions and have the characteristics of stability and heritability. At different stages of plant development, DNA from different tissues can be used for marker analysis. The emergence of molecular markers has transformed the selection in breeding work from traditional phenotypic selection to genotypic selection, which not only simplifies the cumbersome breeding procedures, but also greatly improves the accuracy. Therefore, the development and utilization of molecular markers are very extensive. At present, molecular marker-assisted breeding has become the mainstream breeding technology system and is applied to the genetic improvement of crops and the breeding of new varieties, accelerating the process of crop breeding. There are various types of molecular markers, mainly PCR-based molecular markers such as RAPD (random amplified polymorphic DNA), SSR (Simple sequence repeat), AFLP (amplified fragment length polymorphism), InDel (insertion-deletion), etc. InDel markers refer to the variation of multiple base insertions / deletions in the DNA sequence at the corresponding position of the genome between different varieties. The length of the PCR product obtained by PCR amplification with specific primers designed on both sides of the target site is polymorphic. InDel markers are co-dominant markers with the advantages of high stability and versatility, and are widely used in population genetic analysis.

[0003] Peanut is an important cash crop and oil crop in my country. It is widely planted in tropical and subtropical regions and provides high-quality protein and oil for humans. Peanut is a leguminous plant. The genus Arachis includes 30 diploid varieties, 1 allotetraploid wild peanut (A.monticola) and 1 allotetraploid cultivated peanut (A.hypogaea) (2n=4x=40). The genome of cultivated peanut is complex, and the homology between the A and B genomes is high, making it very difficult to develop specific molecular markers. The upright type is the main type of peanut production in my country. Under high fertilizer and water and high density conditions, peanut plants tend to grow vigorously in the middle growth period, but tend to fall over, prematurely age leaves, rotten seedlings and rotten fruits in the late growth period, affecting pod yield and quality. The study of the molecular mechanism of peanut plant height regulation and the cultivation of dwarf and semi-dwarf varieties are of great significance to the "cost saving" and "efficiency improvement" of peanut production. Therefore, the development of dwarf peanut molecular markers and the use of molecular marker-assisted breeding methods to improve peanut plant type have important theoretical significance and potential application value. Summary of the invention

[0004] In view of the above-mentioned prior art, the present invention provides a peanut dwarf gene InDel marker and its application in molecular assisted breeding.

[0005] The present invention is achieved through the following technical solutions:

[0006] A peanut dwarf gene InDel marker DW-1, whose nucleotide sequence is shown in SEQ ID NO. 1. The InDel marker is located at 11886663 of peanut chromosome A02, and its corresponding wild type (i.e., a peanut variety with a tall stem phenotype) gene nucleotide sequence is shown in SEQ ID NO. 2, showing a 16 bp base insertion.

[0007] The nucleotide sequence (direction 5'-3') of the peanut dwarf gene InDel marker DW-1 is as follows (the underlined part is the inserted 16 bp base):

[0008] agaaaaacggttcgagccaatacgcgattcagaagtttctcgaagaaaagcataagcagtttccaacgaacttcag aaagcttcttttgttcaatttgaag aagctcgtagcttctg gaaagctcgttaaggttaaaggttccttcaagcttccgg catcaaaggcgccagcatcatcagcgccttcgcaggcaaagaagc.

[0009] The corresponding nucleotide sequence of the wild-type gene (direction 5'-3') is as follows:

[0010] agaaaaacggttcgagccaatacgcgattcagaagtttctcgaagaaaagcataagcagtttccaacgaacttcag aaagcttcttttgttcaatttgaaggaaagctcgttaaggttaaaggttccttcaagcttccggcatcaaaggcgccagc atcatcagcgccttcgcaggcaaagaagc.

[0011] Application of the peanut dwarf gene InDel marker DW-1 in molecular assisted breeding.

[0012] Furthermore, the molecular-assisted breeding is selected from the group consisting of detecting, identifying, screening or breeding dwarf peanuts.

[0013] A specific primer for amplifying the peanut dwarf gene InDel marker DW-1, comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4.

[0014] The nucleotide sequence of the upstream primer (direction 5'-3') is: ttccatacctccctcactggta.

[0015] The nucleotide sequence of the downstream primer (direction 5'-3') is: ttcaactgtccacaaccctttc.

[0016] The application of the specific primers for amplifying the peanut dwarf gene InDel marker DW-1 in molecular assisted breeding.

[0017] Furthermore, the molecular-assisted breeding is selected from the group consisting of detecting, identifying, screening or breeding dwarf peanuts.

[0018] Further, in specific application, the method (a method for detecting dwarf peanuts) is as follows:

[0019] (1) extracting genomic DNA from peanuts to be tested;

[0020] (2) using the extracted genomic DNA as a template, and performing PCR amplification using the above-mentioned specific primers;

[0021] (3) The PCR amplification products are detected by gel electrophoresis, and the genotype of the peanut to be tested is determined based on the test results: if only the 201 bp band is amplified, the dwarf gene of the peanut to be tested is in a homozygous state; if only the 185 bp band is amplified, the peanut to be tested does not contain the dwarf gene; if both the 185 bp band and the 201 bp band are amplified, the dwarf gene of the peanut to be tested is in a heterozygous state.

[0022] Furthermore, the peanuts to be tested are F2 progeny of a breeding population, or other progeny.

[0023] Furthermore, the breeding population is a breeding population with LH14 variety and JH1206 variety as parents.

[0024] Furthermore, the specific method of extracting the genomic DNA of the peanut to be tested is: taking leaves of the peanut to be tested, and extracting the genomic DNA using the CTAB method.

[0025] Furthermore, the reaction system of the PCR amplification is: 10 ng / μL template DNA, 2 μL; 10×PCR buffer containing 20 mM MgCl2, 1 μL; 2.5 mM dNTPs, 0.25 μL; 10 μM upstream primer, 0.2 μL; 10 μM downstream primer, 0.2 μL; 1UTaqDNA polymerase, 0.1 μL; add ddH2O to 10 μL; the total system is 10 μL.

[0026] Furthermore, the amplification program of the PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 15 s, for a total of 36 cycles; extension at 72°C for 10 min.

[0027] Furthermore, the gel electrophoresis is 8% (weight percentage) denatured polyacrylamide gel electrophoresis.

[0028] The present invention discovered the peanut dwarf gene InDel marker DW-1 through gene sequencing, designed specific primers for it, performed PCR amplification on DNA of tall and dwarf peanut inbred lines and F2 generation segregating population materials produced by hybridization of the two, and detected it by gel electrophoresis, and found that the InDel marker DW-1 can obviously distinguish tall and dwarf peanut materials, and can be used for molecular assisted breeding of dwarf peanuts.

[0029] Various terms and phrases used herein have the general meanings that are well known to those skilled in the art. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 : Sequence alignment of InDel marker DW-1.

[0031] Figure 2 : Photographs of electrophoresis test results of parental and F1 population materials, wherein lane 1: LH14 (tall pole); lane 2: JH1206 (short pole); lanes 3-12: F1 populations of hybrids of JH1206 and LH14.

[0032] Figure 3 : Photographs of electrophoresis detection results of F2 generation separated population materials, wherein, lane 1: JH1206 (short rod); lane 2: LH14 (tall rod); lanes 3-14: F2 generation short rod population of hybridization of JH1206 and LH14; lanes 15-26: F2 generation tall rod population of hybridization of JH1206 and LH14.

[0033] Figure 4: Photos of electrophoresis test results of other tall-stem and dwarf-stem peanut materials, among which lanes 1 to 12 are tall-stem varieties (in order: DL001, DL075, DL078, DL098, DL107, DL309, SA464, SA466, SA481, SA575, SA531, SA593), and lanes 13 to 24 are dwarf-stem varieties (in order: DL005, DL006, DL021, DL022, DL026, DL028, SA518, SA520, SA685, SA730, SA731, SA825). DETAILED DESCRIPTION

[0034] The present invention will be further described below in conjunction with the embodiments. However, the scope of the present invention is not limited to the following embodiments. It will be appreciated by those skilled in the art that various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention.

[0035] The instruments, reagents, and materials involved in the following examples, unless otherwise specified, are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through regular commercial channels. The experimental methods and detection methods involved in the following examples, unless otherwise specified, are all conventional experimental methods and detection methods already available in the prior art.

[0036] Source of biological materials: Luhua 14 (LH14) and Jihua 1206 (JH1206) were purchased from Shandong Academy of Agricultural Sciences and Jining Academy of Agricultural Sciences, respectively. The F2 generation materials were the offspring obtained by hybridization of the two varieties in our laboratory.

[0037] Example 1 Development of InDel labeled primers

[0038] Based on the tall (LH14) and short (JH1206) peanuts, the dwarf gene was initially located in the 5.1Mb physical interval on chromosome A02 by constructing a positioning population, developing molecular markers, and using technologies such as BSA. A high-density fine physical map was further established, and the dw1 gene was located through high-precision linkage analysis.

[0039] The peanut dwarf gene was used as a candidate gene, and the whole genome of tall (LH14) and dwarf (JH1206) peanuts was resequenced using resequencing technology. The candidate genes in tall and dwarf peanuts were compared based on the resequencing results. The sequence alignment of the peanut InDel marker DW-1 is shown in the figure. Figure 1 As shown (the nucleotide sequence in JH1206 is shown in SEQ ID NO.1, and the nucleotide sequence in LH14 is shown in SEQ ID NO.2), the underlined region in the figure is the InDel region. Compared with the tall peanut (LH14), the dwarf peanut (JH1206) has a 16 bp insertion.

[0040] Specific primers were designed for the above-mentioned InDel marker DW-1, including an upstream primer and a downstream primer, as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0041] Example 2 Application of InDel labeled primers

[0042] 1. Extraction of plant materials and template DNA

[0043] The leaves of peanut JH1206 and LH14 parents and hybrid F2 plants, as well as leaves of other high-stem and short-stem peanut varieties (12 short-stem varieties: DL005, DL006, DL021, DL022, DL026, DL028, SA518, SA520, SA685, SA730, SA731, SA825; 12 tall-stem varieties: DL001, DL075, DL078, DL098, DL107, DL309, SA464, SA466, SA481, SA575, SA531, SA593) were selected as experimental materials, and genomic DNA was extracted using the modified CTAB method. The specific steps are as follows:

[0044] (1) Take 1.0 g of fresh peanut leaves and grind them into powder quickly in liquid nitrogen;

[0045] (2) Transfer the frozen powder into a pre-cooled centrifuge tube, add an equal volume (w / v, g / ml) of 2× CTAB extraction buffer, and incubate at 65°C for 20 min;

[0046] (3) Add an equal volume of chloroform-isoamyl alcohol mixed solution (the volume ratio of chloroform to isoamyl alcohol is 24:1), invert the centrifuge tube to mix, and centrifuge at 12000 rpm for 10 minutes at room temperature;

[0047] (4) Transfer the supernatant to another centrifuge tube, add an equal volume of chloroform-isoamyl alcohol mixed solution (the volume ratio of chloroform to isoamyl alcohol is 24:1), invert the centrifuge tube to mix, and centrifuge at 12000 r / min at room temperature for 10 minutes;

[0048] (5) Transfer the upper aqueous phase to a new centrifuge tube, add an equal volume of isopropanol, gently invert to mix, and leave at room temperature for 30 minutes;

[0049] (6) Centrifuge at 12000 rpm for 5-10 minutes at room temperature and remove the supernatant;

[0050] (7) Rinse with 70% ethanol solution (volume percentage), centrifuge at 12000 rpm for 5-10 minutes at room temperature, and remove the supernatant;

[0051] (8) Repeat step (7) once;

[0052] (9) Air-dry the precipitate, add 100 μL of ultrapure water to dissolve the DNA, and store at -20°C until use.

[0053] (ii) PCR amplification

[0054] The specific primers designed in Example 1 were synthesized at Sangon Biotechnology Co., Ltd., dissolved and diluted to 10 μM for later use.

[0055] The above-extracted DNA was used as a template and PCR amplification was performed with the above-mentioned specific primers to obtain a PCR product.

[0056] The reaction system for PCR amplification is: 10 ng / μL template DNA, 2 μL; 10×PCR buffer containing 20 mM MgCl2, 1 μL; 2.5 mM dNTPs, 0.25 μL; 10 μM upstream primer, 0.2 μL; 10 μM downstream primer, 0.2 μL; 1 U TaqDNA polymerase, 0.1 μL; add ddH2O to 10 μL; total system 10 μL.

[0057] The amplification program of PCR amplification was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 15 s, for a total of 36 cycles; and extension at 72°C for 10 min.

[0058] (III) Polyacrylamide gel electrophoresis separation and polymorphism detection

[0059] The PCR products were subjected to 8% denaturing polyacrylamide gel electrophoresis and then detected by EB staining.

[0060] After the PCR product was mixed with the loading buffer, it was pre-denatured at 95°C for 10 min. 2 μL was spotted and separated by electrophoresis in a Bio-Rad nucleic acid electrophoresis system (Bio-Rad, USA). The electrode buffer was 1×TBE and the electrophoresis was performed at room temperature at 100 V for 2 h. The results were developed by EB staining, photographed and recorded.

[0061] The electrophoresis test results of the parents JH1206, LH14, and the hybrid F1 population materials are as follows Figure 2 As shown, the electrophoresis detection results of F2 population materials are as follows Figure 3 The electrophoresis test results of other high-stem and short-stem peanut materials are shown in Figure 4 shown.

[0062] Figure 4 The result of 8% denaturing polyacrylamide gel electrophoresis of PCR amplification products of short-stem materials and tall-stem materials using primers labeled with peanut InDel DW-1.

[0063] Depend on Figure 2 , Figure 3 and Figure 4 It can be seen that the specific primers of InDel marker DW-1 can effectively amplify the DNA of tall and dwarf peanuts, with clear band patterns and good polymorphism in tall and dwarf peanut materials. The amplified band of tall materials is 185bp, and the amplified band of dwarf materials is 201bp. It can well distinguish tall and dwarf peanuts and can be used for the breeding of new dwarf peanut varieties.

[0064] The above examples are provided to those skilled in the art to fully disclose and describe how to make and use the claimed embodiments, and are not intended to limit the scope of the disclosure herein. Modifications that are obvious to those skilled in the art will fall within the scope of the appended claims.

Claims

1. A peanut dwarf gene InDel marker DW-1, characterized by: Its nucleotide sequence is shown in SEQ ID NO.1; The nucleotide sequence of the wild-type gene is shown in SEQ ID NO. 2, showing a 16 bp base insertion; The nucleotide sequence of the peanut dwarf gene InDel marker DW-1 is shown below, in the direction of 5'-3', and the underlined part is the inserted 16bp base: agaaaaacggttcgagccaatacgcgattcagaagtttctcgaagaaaagcataagcagtttccaacgaacttcag aaagcttcttttgttcaatttgaag aagctcgtagcttctg gaaagctcgttaaggttaaaggttccttcaagcttccgg catcaaaggcgccagcatcatcagcgccttcgcaggcaaagaagc。

Images