A B cell epitope of invasin D and its application in diagnosing intracellular infection of Salmonella pathogens

Abstract

The present invention discloses a conserved B cell epitope of invasin D and its application in diagnosing intravenous infection of Salmonella pathogens. The SipD described in the present invention is conserved in 912 strains of enteric Salmonella and 9 strains of Salmonella bongore whose genome information is currently disclosed. In the conserved sequence of the SipD protein, the conserved B cell epitope characteristic sequence SEENNDERTL, which is obtained by SipD B cell epitope prediction, is obtained. The B cell epitope can be functionally expressed and presented on the surface of the inert carrier S9 bacteria. The indirect agglutination detection method established based on the expression of SL10 on the surface of S9 bacteria only reacts specifically with serum samples infected with Salmonella pathogens, and has no cross reaction and non-specific reaction with positive sera infected with other pathogens of the Enterobacteriaceae family. The diagnostic method has the advantages of specificity, sensitivity, convenience and low cost, and is expected to become a technical means for diagnosing intravenous infection of Salmonella pathogens.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine and immune diagnosis and detection, and specifically relates to the application of a conserved B cell epitope characteristic sequence SEENNDERTL (SL10) of a Salmonella effector protein invasin D in detecting intracellular infection of Salmonella pathogens. Background Art

[0002] The genus Salmonella includes two species, Salmonella enterica and Salmonella bongori. Among them, Salmonella enterica subsp. enterica can be divided into 7 serogroups (AF group, other groups), including nearly 3,000 serotypes. The diversity of serotypes enables Salmonella to have a wide range of host adaptability. For example, nearly 17 common serotypes such as Enteritis, Typhimurium, Newport, and Infantile can infect humans, poultry, and livestock. It is reported that Salmonella is the foodborne pathogen with the greatest threat to global public safety, causing 93.8 million infections and illnesses and nearly 160,000 deaths each year; in my country, 40% of pathogenic food poisoning cases are caused by Salmonella, and 95% of the infection sources come from contaminated meat, eggs, milk and related products. However, my country currently lacks a broad-spectrum Salmonella (Salmonella) in vivo infection detection technology for poultry and livestock, resulting in the isolation of only pathogenic Salmonella and corresponding serotypes with zoonotic characteristics such as enteritis and typhoid fever from livestock and poultry in my country. Therefore, a specific, sensitive, rapid and convenient in vivo detection and monitoring technology for Salmonella infection is urgently needed instead of being limited to the isolation and identification of a few common pathogens of the Salmonella genus.

[0003] The Salmonella invasion protein D (SipD) is a virulence effector of the type III secretion system (T3SS), a key virulence factor of Salmonella. It is located on the cell surface and plays a key role in invading host cells in the earliest stage of Salmonella infection, which reflects that SipD is the earliest Salmonella protein that mediates the host to produce a specific immune response. The inventors further used bioinformatics and structural biology techniques to clarify that in Salmonella (including Salmonella enterica and Salmonella bongore), SipD is highly conserved (80.2%-100% conservation of the same site; 86.7%-100% conservation of similar sites), and the conserved sequence contains the characteristic sequence of the B cell epitope SEENNDERTL (SL10). Therefore, the present invention successfully predicted, analyzed and verified the SipD key B cell epitope SL10 and functional test verification, and tested its specificity and sensitivity in detecting Salmonella pathogen infection, aiming to establish a specific, sensitive, rapid and convenient Salmonella in vivo detection, monitoring and prevention and control technology, which is suitable for on-site and large-scale testing in livestock and poultry farming, laying the foundation for Salmonella prevention and control and purification, and is also suitable for the detection, monitoring and evaluation of Salmonella pathogen infection in the human body. Summary of the invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a conserved B cell epitope characteristic sequence possessed by SipD of Salmonella and its application in detecting infection within Salmonella pathogens.

[0005] Another technical problem to be solved by the present invention is to provide a nucleic acid or gene encoding the B cell epitope.

[0006] The technical problem that the present invention needs to solve is to provide a recombinant vector or a Salmonella pathogen infection antibody detection system.

[0007] The technical problem that the present invention also aims to solve is to provide a method for constructing a recombinant expression vector or the above-mentioned Salmonella pathogen intra-infection antibody detection system.

[0008] The technical problem that the present invention also aims to solve is to provide a B cell epitope, a nucleic acid or gene of the B cell epitope, a recombinant vector or a Salmonella pathogen infection antibody detection system for use in preparing a reagent or a kit for detecting Salmonella pathogen infection antibodies.

[0009] The final technical problem to be solved by the present invention is to provide a reagent or kit for the intra-infection antibody of Salmonella pathogens.

[0010] Technical solution: In order to solve the above technical problems, the present invention provides a B cell epitope of Salmonella invasin D (SipD), the amino acid sequence of the B cell epitope is SEENNDERTL, referred to as SL10.

[0011] The present invention also includes a nucleic acid molecule encoding the B cell epitope, and the DNA sequence of the nucleic acid molecule is TCTGAAGAGAATAATGACGAGCGCACGCTG, abbreviated as TG30.

[0012] The present invention also includes a recombinant gene fragment, which is obtained by introducing the nucleic acid molecule into a vector containing a Peg pili encoding gene sequence. The sequence of the recombinant gene fragment is shown in SEQ ID NO.3 or SEQ ID NO.5.

[0013] SEQ ID NO.3 (recombinant PegA protein encoding gene):

[0014] The present invention also includes a recombinant protein encoding the recombinant gene fragment, and the amino acid sequence of the recombinant protein is shown in SEQ ID NO.4.

[0015] SEQ ID NO.4 (recombinant PegA protein sequence):

[0016]

[0017] The present invention also includes an expression cassette, a recombinant expression vector, a recombinant cell or a recombinant strain, which contains the nucleic acid molecule or the recombinant gene fragment.

[0018] The recombinant expression vector of the present invention is constructed by inserting the nucleic acid molecule of the B cell epitope into the Peg pili coding gene sequence to obtain the expression vector pBR-Peg-SipD-TG30.

[0019] The Salmonella pathogen infection antibody detection system of the present invention further comprises the step of introducing the expression vector pBR-Peg-SipD-TG30 into the carrier bacteria.

[0020] The present invention also includes a Salmonella pathogen infection antibody detection system, which includes the expression cassette, recombinant expression vector, recombinant cell or recombinant strain.

[0021] The present invention also includes a method for constructing the recombinant expression vector, comprising the following steps:

[0022] (1) Obtaining a B cell epitope DNA sequence of Salmonella invasin D; the DNA sequence is TCTGAAGAGAATAATGACGAGCGCACGCTG;

[0023] (2) Inserting the DNA sequence obtained in step (1) into the Peg pili encoding gene sequence to construct a recombinant expression vector.

[0024] The present invention also includes a method for constructing the recombinant strain, which includes the following steps: introducing the recombinant expression vector into the carrier bacteria by electrotransformation.

[0025] The present invention also includes the use of the B cell epitope, the nucleic acid molecule, the recombinant gene fragment, the expression cassette, the recombinant expression vector, the recombinant cell or recombinant strain, and the Salmonella pathogen infection antibody detection system in the preparation of a reagent or kit for detecting Salmonella pathogen infection antibodies.

[0026] The present invention also includes a reagent or kit for detecting antibodies to Salmonella pathogen infection, wherein the reagent or kit includes the B cell epitope, the recombinant protein, the expression cassette, the recombinant expression vector, the recombinant cell or the recombinant strain or the Salmonella pathogen infection antibody detection system.

[0027] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: the B cell epitope SL10 described in the present invention comes from the conserved epitope domain of Salmonella enterica serogroup SipD, and the specific B cell epitope SL10 is displayed and expressed using Peg pili. Through an indirect agglutination test, it is verified that the vector bacteria express Peg pili, and its bacterial surface functionally displays and expresses SL10. The surface-expressed SL10 can accurately identify and bind to antibodies against the B cell epitope of SipD, thereby realizing specific, sensitive, rapid and convenient detection and monitoring of infection antibodies in Salmonella pathogens. The infection antibody detection system only reacts specifically with Salmonella positive sera of the AE serogroup; and does not cross-react or non-specifically react with positive sera of other pathogens of the Enterobacteriaceae family, such as O2, O78, O157:H7 Escherichia coli and rodent Citrobacter rodentium. The present invention can detect specific antibodies on the 5th day after SPF chickens are artificially infected with Salmonella enteritidis, and the sensitivity is significantly higher than that of traditional plate agglutination test and ELISA (Enzyme linked immunosorbent assay) and other serological detection technologies. In view of the advantages of the present invention in terms of specificity, sensitivity, convenience, low cost and broad-spectrum detection of Salmonella, it is expected to become an important technology and platform for early detection, monitoring, diagnosis and purification of Salmonella infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 , Conservation analysis of SipD protein of Salmonella. The rectangular box highlights the B cell sequence of SipD protein provided by the present invention.

[0029] Figure 2 , and the prediction results of the B cell epitopes of the SipD proteins of Salmonella enterica and Salmonella bongore. The rectangular box highlights the B cell sequence of the SipD protein provided by the present invention.

[0030] Figure 3 AlphaFold 2 prediction results and comparison analysis of the SipD protein structures of Salmonella enterica and Salmonella bongore. The highlighted area of ​​the mesh structure is the key B cell epitope SL10 of SipD screened by the present invention.

[0031] Figure 4, Electrophoretogram of PCR amplification and identification of the complete operon of peg-SipD-TG30 after insertion of SipD-TG30. Lane M is Trans 2K Plus II DNA Marker, Lane 1 is the PCR amplification product of the peg operon gene, and the template DNA comes from the standard strain of Salmonella pullorum CVCC 526 as a positive control; Lane 2 is the PCR amplification product of peg-SipD-TG30 (4850bp is the recovered DNA amplification product); Lane 3 is the genome of the avian pathogenic Escherichia coli isolate APEC-XM as a negative control; Lane 4 is the genome of the Escherichia coli engineered strain DH5α as a negative control.

[0032] Figure 5 , The electrophoresis diagram of enzyme digestion identification of the recombinant plasmid pBR-Peg-SipD-TG30 containing the peg-SipD-TG30 gene. Lane M is Trans 15K DNA Marker, Lane 1 is the circular plasmid of pBR-Peg-SipD-TG30; Lane 2 is the NheI single digestion product of pBR-Peg-SipD-TG30; Lane 3 is the BamHI single digestion product of pBR-Peg-SipD-TG30; Lane 4 is the NheI and BamHI double digestion product of pBR-Peg-SipD-TG30.

[0033] Figure 6 , Schematic diagram of the expression vector pBR-Peg-SipD-TG30 plasmid.

[0034] Figure 7, The agglutination reaction results of the Salmonella pathogen infection antibody detection system S9+Peg-SipD-TG30 and the Peg pili empty vector control S9+Peg with the AE serogroup Salmonella positive serum and Enterobacteriaceae pathogen positive serum respectively. A: Agglutination reaction results of the detection system and control for antibody to Salmonella pathogen infection with positive serum of Salmonella paratyphi A serogroup A; B: Agglutination reaction results of the detection system and control for antibody to Salmonella pathogen infection with positive serum of Salmonella typhimurium serogroup B; C: Agglutination reaction results of the detection system and control for antibody to Salmonella pathogen infection with positive serum of Salmonella choleraesuis serogroup C; D: Agglutination reaction results of the detection system and control for antibody to Salmonella pathogen infection with positive serum of Salmonella enteritidis serogroup D; E: Agglutination reaction results of the detection system and control for antibody to Salmonella pathogen infection with positive serum of Salmonella pullorum serogroup D; F: Agglutination reaction results of the detection system and control for antibody to Salmonella pathogen infection with positive serum of Salmonella pathogen infection with positive serum of Salmonella pullorum serogroup D : The results of agglutination reaction with positive serum of Salmonella enterica serogroup D; G: The results of agglutination reaction of the Salmonella pathogen infection antibody detection system and the control with positive serum of Salmonella enterica serogroup E; H: Negative control 1, the Salmonella pathogen infection antibody detection system and the control did not agglutinate with positive serum of Escherichia coli O2; I: Negative control 2, the Salmonella pathogen infection antibody detection system and the control did not agglutinate with positive serum of Escherichia coli O78; J: Negative control 3, the Salmonella pathogen infection antibody detection system and the control did not agglutinate with positive serum of Escherichia coli O157:H7; K: Negative control 4, the Salmonella pathogen infection antibody detection system and the control did not agglutinate with positive serum of Citrobacter rodentium. Arrows indicate agglutinated particles.

[0035] Figure 8 , Salmonella pathogen infection antibody detection system S9+Peg-SipD-TG30 qualitatively and quantitatively tests the serum of SPF chickens artificially infected with Salmonella Enteritidis (0-21 days after infection). DETAILED DESCRIPTION

[0036] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific specific embodiments rather than to limit the scope of protection of the present invention. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the examples, according to the technical staff of the present art's grasp of the prior art and the description of the present invention, any methods, equipment, and materials of the prior art that are similar or equivalent to the methods, equipment, and materials in the examples of the present invention can also be used to implement the present invention.

[0037] Example 1. Conservation analysis of SipD protein of Salmonella (including Salmonella enterica and Salmonella bongore)

[0038] The NCBI (https: / / www.ncbi.nlm.nih.gov / ) Nucleotide database was used to search for Salmonella enterica and Salmonella bongori, and only strains with complete genome information were collected, including 912 strains of Salmonella enterica and 9 strains of Salmonella bongori that met the requirements. Then, the SipD protein information in the genome of the standard strain of Salmonella typhimurium LT2 (Salmonella enterica subsp. enterica serovar Typhimurium str. LT2, complete genome, GenBank accession number: AE006468.2) (the expression product was annotated as "cell invasion protein") was used as the reference sequence, and the SipD amino acid sequences of the above 921 Salmonella strains were compared and data analyzed using SnapGene 6.0.2 software.

[0039] The results are shown in Table 1. Among the enteric subspecies of Salmonella enterica, the SipD protein sequences of serogroup A Salmonella (Salmonella paratyphi A, 3 strains) were 87.17% ± 0.00% conservative at the same sites (meaning that the amino acid sequence is exactly the same) and 93.29% ± 0.00% conservative at the similar sites (meaning that the amino acid properties of the sites are similar); the SipD protein sequences of serogroup B Salmonella (such as serotypes Typhimurium, Heidelberg, and Indiana, a total of 348 strains) were 87.17% ± 0.00 conservative at the same sites (meaning that the amino acid sequence is exactly the same) and 93.29% ± 0.00 conservative at the similar sites (meaning that the amino acid properties of the sites are similar); the SipD protein sequences of serogroup A Salmonella (such as serotypes Typhimurium, Heidelberg, and Indiana, a total of 348 strains) were 87.17% ± 0.00 conservative at the same sites (meaning that the amino acid sequences of the sites are exactly the same) and 93.29% ± 0.00 conservative at the similar sites; the SipD protein sequences of serogroup B Salmonella (such as serotypes Typhimurium, Heidelberg, and Indiana, a total of 348 strains) were 87.17% ± 0.00 conservative at the same sites (meaning that the amino acid properties of the sites are similar). ) were compared with the reference strains, the conservation of the same sites was 99.72% ± 0.44%, and the conservation of similar sites was 99.78% ± 0.31%; the SipD protein sequences of serogroup C Salmonella (such as Newport, suis, and Tennessee serotypes, a total of 87 strains) were compared with the reference strains, the conservation of the same sites was 96.94% ± 3.70%, and the conservation of similar sites was 97.66% ± 2.53%; the SipD protein sequences of serogroup D Salmonella (such as Enteritis, Gallinaria, Typhoid serotypes, a total of 330 strains) compared with the reference strains, the conservation of the same sites of the SipD protein sequence is 96.03% ± 4.61%, and the conservation of similar sites is 97.35% ± 3.41%; the conservation of the SipD protein sequence of serogroup E Salmonella (such as Wetafeldt and Muenster serotypes, a total of 24 strains) compared with the reference strains, the conservation of the same sites is 95.76% ± 4.19%, and the conservation of similar sites is 97.07% ± 2.66%; the conservation of the SipD protein sequence of serogroup F Salmonella is 96.03% ± 4.61%, and the conservation of similar sites is 97.35% ± 3.41%; the conservation of the SipD protein sequence of serogroup E Salmonella (such as Wetafeldt and Muenster serotypes, a total of 24 strains) compared with the reference strains, the conservation of the same sites is 95.76% ± 4.19%, and the conservation of similar sites is 97.07% ± 2.66%; Compared with the reference strain, the SipD protein sequences of Salmonella (such as Aberdin and Abatetuba serotypes, a total of 55 strains) were 92.94%±5.22% conservative at the same sites, and 94.44%±4.49% conservative at similar sites; compared with the reference strain, the SipD protein sequences of other serogroups of Salmonella (such as Adjame serotype, a total of 18 strains) were 92.94%±3.75% conservative at the same sites, and 95.37%±4.17% conservative at similar sites.In Salmonella enterica subsp. diarizonae, the conservation of its SipD protein sequence was 86.23%±0.95% at the same sites and 92.71%±0.47% at the similar sites compared with the reference strain; in Salmonella enterica subsp. salamae, the conservation of its SipD protein sequence was 81.43%±0.45% at the same sites and 89.21%±0.15% at the similar sites compared with the reference strain; in Salmonella enterica subsp. arizonae, the conservation of its SipD protein sequence was 80.53%±0.12% at the same sites and 88.63%±0.09% at the similar sites compared with the reference strain. Compared with the reference strain, the conservation of the SipD protein sequences of 9 strains of Salmonella bongori was 87.75%±2.76% at the same sites and 92.71%±1.56% at similar sites. In summary, the results of bioinformatics analysis fully demonstrated that SipD exists and is conserved throughout the genus Salmonella. It is necessary to further explore the conserved B cell epitopes contained in SipD to provide a basis for finding detection targets for Salmonella detection and monitoring technology.

[0040] Table 1 Results of conservation analysis of SipD proteins of Salmonella

[0041]

[0042]

[0043] Example 2: Bioinformatics prediction and structural biology analysis of conserved B cell epitopes shared by Salmonella SipD proteins

[0044] MEGA 7.0 software was used to compare the amino acid sequences of the SipD proteins of the following Salmonella strains: the representative of Salmonella enterica subspecies A serogroup was Salmonella paratyphi A ATCC 9150 (accession number: CP000026.1); the representative of Salmonella enterica subspecies B serogroup was Salmonella typhimurium LT2 (GenBank accession number: AE006468.2); the representative of Salmonella enterica subspecies C serogroup was Salmonella Newport CVM 22462 (GenBank accession number: CP010280.1); the representative of Salmonella enterica subspecies D serogroup is Salmonella enterica P125109 (GenBank accession number: NC_011294.1); the representative of Salmonella enterica subspecies E serogroup is Salmonella vetavreden 1655 (GenBank accession number: CP014996.1); the representative of Salmonella enterica subspecies F serogroup is Salmonella abattoba ATCC 35640 (GenBank accession number: CP007532.1); the representative of other serogroups of Salmonella enterica subspecies is Adjame Salmonella 400321 (GenBank accession number: CP049877.1); the representative of Salmonella enterica subspecies diarizona is 16-SA00356 (GenBank accession number: CP034074.1); the representative of Salmonella enterica subspecies salamander is 1315K (GenBank accession number: CP022139.1); the representative of Salmonella enterica subspecies arizona is SA20100345 (GenBank accession number: CP022504.1); the representative of Salmonella bongore is N268-08 (GenBank accession number: CP006608.1). The results are as follows. Figure 1 As shown, the amino acid sequence of the Salmonella SipD protein is completely identical at amino acid residues 69-87, 149-175 and 316-342.

[0045] It is necessary to further clarify whether the regions with the same amino acid sequence of the above SipD proteins contain consistent conserved B cell epitopes: the B cell epitope prediction tool (Bepipred Linear EpitopePrediction 2.0, http: / / tools.iedb.org / bcell / ) of the Immunology and Epitope Database was used to predict the B cell epitopes contained in the SipD proteins of Salmonella enterica (represented by Salmonella typhimurium LT2, GenBank accession number: AE006468.2) and Salmonella bongore (represented by the N268-08 strain, GenBank accession number: CP006608.1). The database scores each amino acid residue, and residues with a score of >0.5 are considered to be antigenic, and multiple consecutive amino acid residues with a score of >0.5 are identified as B cell epitopes. The prediction results are as follows: Figure 2 As shown, comprehensive analysis of the predicted B cell epitopes and the conserved regions of the Salmonella SipD protein revealed a B cell epitope region that was consistently conserved in the Salmonella genus, namely, positions 69-86 of the SipD amino acid sequence: SEENNDERTLARQQLTSS.

[0046] Considering that the predicted B cell epitope region may be shielded in the spatial position of the protein structure (difficult to be exposed and taken up by the host), thus failing to produce a good immune response, the AlphaFold 2 protein structure prediction was further performed on the SipD proteins of Salmonella enterica (represented by Salmonella typhimurium LT2, GenBank accession number: AE006468.2) and Salmonella bongore (represented by the N268-08 strain, GenBank accession number: CP006608.1). The AlphaFold2 integrated platform ColabFold v1.5.5 was used for protein structure prediction (https: / / colab.research.google.com / github / sokrypton / ColabFold / blob / main / AlphaFold2.ipyn b?authuser=1). First, the SipD amino acid sequences of Salmonella enterica and Salmonella bongore were entered into the "query sequence", and then the relaxation and template mode options were disabled. The number of cycles (recycles) was selected as "6", and then all the code execution programs were run to start prediction. The PDB file (containing protein structure information) with the highest confidence was analyzed and compared using Pymol software. The results are shown in the figure. Figure 3As shown, the SipD protein structures of Salmonella enterica (light gray) and Salmonella bongore (dark gray) are almost completely overlapped, wherein the consistent conservative amino acid sequence SEENNDERTL (green mesh structure highlighted) completely overlaps in spatial structure and is located on the surface of the SipD protein without any other structural shielding, and the hydrophilic amino acid residues are well exposed. Therefore, the consistent conserved B cell epitope SL10 (SEENNDERTL) of the SipD protein provided by the present invention is finally obtained, and its DNA sequence is: TCTGAAGAGAATAATGACGAGCGCACGCTG (TG30).

[0047] Example 3 Construction of Peg pili expression vector carrying the consistent conserved B cell epitope SL10 of SipD protein and verification of its functional expression

[0048] The predicted and preferred DNA sequence of the Salmonella SipD protein B cell epitope SL10 (TG30) was inserted into the Peg pili gene sequence of Salmonella pullorum to construct an expression vector pBR-Peg-SipD-TG30, which was introduced into the Escherichia coli vector bacteria for amplification and expression, and the functional display expression of SipD-TG30 on the surface of the vector bacteria was verified. The specific implementation procedures are as follows:

[0049] The chimeric gene of peg (reference sequence is Salmonella enterica SPstrain, GenBank accession number CP077668.1, 1831920-1827125) and SipD-TG30 was synthesized by Nanjing Qingke Biotechnology Co., Ltd., and the site AATTACACTCTGAATTCAAGTAAGTTTGAA of the peg operon gene sequence was replaced by SipD-TG30. The obtained chimeric gene was named peg-SipD-TG30. The gene sequence of peg-SipD-TG30 is as follows: (SEQ ID NO, 5)

[0050]

[0051]

[0052]

[0053]

[0054] The primer information for peg operon amplification is as follows: upstream primer SP Peg Up: 5'-CGC GCTAGC ATGAAACGTTCACTTATTGCTGCT-3' downstream primer SP Peg Down: 5'-CGT GGATCCTTAATTATAAGATACCACGATTAATGC-3', the underlined sequences represent NheI and BamHI restriction enzyme sites, respectively. The above primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd. The chimeric gene was used as a template (SEQ ID NO. 5, 1 μL, containing 1 ng of the chimeric gene), the genome of the standard strain of Salmonella pullorum CVCC 526 (purchased from China Veterinary Drug Administration, China Veterinary Microbiological Culture Collection Center) was used as a positive control, the genome of the avian pathogenic Escherichia coli isolate APEC-XM (Liu Jiaqi, Wu Hucong, Yin Yi, Zhang Dong, Xia Pengpeng, Ren Wenkai, Zhu Guoqiang. Construction of a mouse model of neonatal Escherichia coli meningitis caused by avian Escherichia coli [J]. China Poultry, 2019, 41(10): 26-30.) and the genome of the engineered Escherichia coli DH5α were used as negative controls, and PCR amplification was performed using the upstream and downstream primers SP Peg Up / Down. The amplification system was: pfu high-fidelity DNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd.) 2 μL, 5×pfu DNA polymerase buffer 10 μL, dNTPs 5μL, 2μL of upstream and downstream primers (10mM), 2μL of chimeric gene or APEC-XM genome or Escherichia coli engineered bacteria DH5α genome, CVCC 526 genome (250ng / μL), 27μL of ultrapure water. After mixing the above system evenly, use a thermal cycler (Bio-Red) for PCR amplification. The procedure is as follows: pre-denaturation at 94℃ for 5min, amplification stage for a total of 30 cycles, including denaturation at 94℃ for 30s, annealing at 52℃ for 30s and extension at 72℃ for 5min, further amplification at 72℃ for 10min, and the temperature is lowered to 12℃ after the amplification. Prepare 1% agarose gel, electrophoresed at 110V for 45min, stained with ethidium bromide and imaged under a UV imager. The PCR results are as follows: Figure 4 As shown, the amplified size of the positive control is 4850 bp; the PCR product of peg-SipD-TG30 is: 4850 bp (other bands are non-specific extension products, and only the 4850 bp DNA product is recovered later); the negative control has no amplified band. The PCR amplified product (4850 bp) of the PCR product of peg-SipD-TG30 was recovered using a universal DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0055] The PCR amplification product of peg-SipD-TG30 and the pBR322 plasmid were double-digested with NheI and BamHI restriction endonucleases (NEB), and then the linear DNA fragments were connected in a 16°C metal bath overnight with T4 DNA ligase (NEB). The next day, the ligation product was transformed into S9 competent cells (Zhu Guoqiang, Yang Bin, Yang Yang, Meng Xia, Xia Pengpeng, Duan Qiangde, Zhu Xiaofang, an inert carrier Salmonella and its potential application, national invention patent, patent number: ZL201910424369.8), and resistance screening was performed by coating solid culture medium containing 100 μg / mL ampicillin. A single colony on the plate was picked and inoculated into LB liquid culture medium containing 100 μg / mL ampicillin and grown to the stationary phase. After the plasmid was recovered, it was single-digested with NheI and BamHI and double-digested with two restriction endonucleases. Prepare 1% agarose gel, electrophoresis at 110V for 45 minutes, stain with ethidium bromide and image under UV imaging. The results are as follows: Figure 5 As shown, the NheI and BamHI single digestion products of the recombinant plasmid pBR-Peg-SipD-TG30 are 9071 bp respectively; the double digestion product of the vector contains a 4215 bp linear vector and a 4850 bp peg-SipD-TG30 linear DNA fragment, which is consistent with the expected size. The schematic diagram of the expression vector pBR-Peg-SipD-TG30 plasmid is shown in Figure 6 shown.

[0056] The S9 engineered bacteria carrying the recombinant plasmid pBR-Peg-SipD-TG30 were grown in LB liquid medium containing 100 μg / mL ampicillin to the stationary phase, centrifuged at 4000 rpm for 5 min, discarded the supernatant, and resuspended with an equal volume of sterile saline. The bacterial suspension was prepared by continuous centrifugation and washing twice in this way (final concentration 1×10 10CFU / mL). The recombinant S9 engineered bacteria carrying the above recombinant plasmid were subjected to agglutination tests with Salmonella negative serum (10 copies of SPF mouse serum) and Salmonella positive serum (10 copies of SPF mouse serum infected with Salmonella enteritidis), and the bacterial suspension of S9 engineered bacteria containing pBR-Peg (Zhu Guoqiang, Yang Bin, Yang Yang, Meng Xia, Xia Pengpeng, Duan Qiangde, Zhu Xiaofang, An inert carrier of Salmonella and its potential application, national invention patent, patent number: ZL201910424369.8) was used as a negative control. The results are shown in Table 3. The bacterial suspensions of all strains did not react with negative serum. The recombinant S9 engineered bacteria suspension carrying the recombinant plasmid pBR-Peg-SipD-TG30 showed obvious agglutination with positive serum, with large agglutination particles and clear background. However, the S9 engineered bacteria suspension containing only the pBR-Peg plasmid did not agglutinate with positive serum, with no agglutination particles and a turbid background. This result shows that the B cell epitope SL10 from the SipD protein of Salmonella can be expressed on the bacterial surface through the Peg pili Peg, and can specifically detect agglutination antibodies against Salmonella.

[0057] In this antibody detection system, S9+pBR-Peg bacterial suspension is used as the control system, and only SL10 is added to the antibody detection system, which specifically recognizes and binds to specific antibodies and eliminates non-specific false positive reactions, thereby ensuring accurate individual diagnosis; pBR-Peg-SipD-TG30 bacterial suspension is used as a Salmonella-specific antibody detection system, which can specifically recognize and bind to infection antibodies targeting consistent conserved B cell epitopes in Salmonella SipD.

[0058] Table 3 Functional verification of Peg-SipD-TG30 expressed on the surface of vector bacteria S9

[0059]

[0060] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction

[0061] Example 4: Specificity and sensitivity test of the Salmonella pathogen infection antibody detection system

[0062] Based on the functional verification of Peg-SipD-TG30 expressed on the surface of the vector bacteria S9, the specificity and sensitivity of the Salmonella infection antibody detection system were further tested. The specific implementation procedures are as follows:

[0063] According to the same method in Example 3, a control system S9+pBR-Peg bacterial suspension and a Salmonella infection antibody detection system S9+pBR-Peg-SipD-TG30 bacterial suspension were prepared. The above two bacterial suspensions were subjected to agglutination tests with sera from different background sources to verify the specificity of the agglutination antibody detection system. The sera involved in the test and their sources included: 2 positive sera of serogroup A paratyphoid Salmonella (provided by the Inspection Center of Subei People's Hospital), 145 positive sera of serogroup B typhimurium (provided by the Animal and Poultry Disease Diagnosis Center of Yangzhou University), 3 positive sera of serogroup C choleraesuis Salmonella (provided by the Animal and Poultry Disease Diagnosis Center of Yangzhou University), 547 positive sera of serogroup D enteritidis Salmonella (obtained by this laboratory using enteritidis Salmonella standard strain CMCC 50336 to infect SPF chickens), 364 positive sera of serogroup D pullorum Salmonella (obtained by this laboratory using pullorum Salmonella standard strain CVCC 535 to infect SPF chickens), 80 positive sera of serogroup D Salmonella typhi (obtained by our laboratory using Salmonella typhi vaccine strain SG01 to infect SPF chickens), 20 positive sera of serogroup E Salmonella enterica sera (provided by Yangzhou University Animal Disease Diagnostic Center), 10 positive sera of O2 Escherichia coli (obtained by our laboratory using O2 Escherichia coli APEC TW-XM to infect SPF mice), 10 positive sera of O78 Escherichia coli (provided by Yangzhou University Animal Disease Diagnostic Center), 5 positive sera of O157:H7 Escherichia coli (provided by Nanjing Agricultural University), and 24 positive sera of rodent Citrobacter rodentium (obtained by our laboratory using rodent Citrobacter rodentium standard strain DBS100 to infect SPF mice). The test results are shown in Table 4. Two sera positive for Salmonella paratyphi A of serogroup A, 145 sera positive for Salmonella typhimurium of serogroup B, three sera positive for Salmonella choleraesuis of serogroup C, 547 sera positive for Salmonella enteritidis of serogroup D, 364 sera positive for Salmonella pullorum of serogroup D, 80 sera positive for Salmonella galli typhi of serogroup D, and 20 sera positive for Salmonella duck of serogroup E did not agglutinate with the control system (S9+pBR-Peg), but agglutinated with the S9+pBR-Peg-SipD-TG30 Salmonella infection antibody detection system. At the same time, the above system did not agglutinate with all 10 sera positive for Escherichia coli O2, 10 sera positive for Escherichia coli O78, 5 sera positive for Escherichia coli O157:H7, and 24 rodent Citrobacter rodentium positive sera, and its specificity was 100%. The agglutination patterns of serum samples are shown in Figure 7 shown.

[0064] Table 4 Specificity verification of Peg-SipD-TG30 infection antibody detection system

[0065]

[0066] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction

[0067] The sensitivity test of the present invention was verified by artificially infecting SPF chicken enteritis Salmonella standard strain CMCC 50336 (purchased from China Veterinary Drug Administration). The specific implementation plan is as follows: 15 21-day-old SPF chickens were randomly divided into two groups: a control group (5 chickens) and an infection group (10 chickens). The control group and the infection group were inoculated with 0.2 mL PBS (0.01 M, pH = 7.2) and 5×10 7 CFU dose of Enteritidis Salmonella standard strain CMCC 50336. On the 0th, 5th, 7th, 10th, 14th and 21st days after artificial infection, blood was collected from all chickens under the wing vein, and serum was separated and stored at 4°C for later use. n 10 μL of sterile saline was added to each well of the 96-well plate, and then 10 μL of serum was added to the first well of each column. After fully mixing with sterile saline, 10 μL of diluted serum was added to the next well, and this cycle was repeated until the dilution reached 2. 12 times. The serum of each dilution was subjected to agglutination test with the control system S9+pBR-Peg bacterial suspension and the Salmonella Peg-SipD-TG30 infection antibody detection system (S9+pBR-Peg-SipD-TG30) bacterial suspension, and the last dilution at which agglutinated particles appeared was taken as the titer of the serum agglutination antibody. The positive rate results of the agglutination test are shown in Table 5. On the 5th day after artificial infection, 70% (7 / 10) of the artificially infected SPF chicken sera had a positive agglutination reaction with the S9+pBR-Peg-SipD-TG30 antibody detection system, indicating that the infection antibody can be detected as early as the 5th day. Considering that the sensitivity can be reflected according to the earliest detection time after infection, that is, the earlier the time of detection after infection, the higher the sensitivity. The sensitivity is significantly higher than that of traditional serological detection technology, and with the increase of immunization time, the positive rate of agglutination test gradually increases; the quantitative test results are shown in Table 5. Figure 8 As shown, on the 10th day after immunization, the titer of specific agglutination antibodies targeting the targeted epitope can be measured to be as high as 1:16. It is worth noting that the antibody titer quantitatively tested by the agglutination test described in the present invention is generated by the specific epitope antigen-antibody binding reaction and does not contain non-specific components; while the complete pathogen or complete protein antigen used in traditional immunoserological techniques contains a large number of redundant components, resulting in non-specific reactions, background reactions and other unknown cross-reactions, and the antibody titer cannot truly reflect the specific antigen-antibody binding reaction.

[0068] In summary, the Salmonella Peg-SipD-TG30 infection antibody detection system of the present invention has good specificity and sensitivity. Compared with the results reported by the current Salmonella detection technology in livestock and poultry farming (whole bacteria plate agglutination antigen, D group Salmonella ELISA, etc.), the sensitivity of this technology is significantly improved, and the specific infection antibody titer can be quantitatively detected.

[0069] Table 5 Sensitivity verification of the Peg-SipD-TG30 Salmonella pathogen infection antibody detection system

[0070]

[0071]

[0072] In summary, the present invention provides the use of the unanimously conserved B cell epitope SEENNDERTL (SL10) of Salmonella invasin D (SipD) in detecting Salmonella pathogen infection.

Claims

1. A recombinant gene fragment, characterized in that: The recombinant gene fragment is obtained by introducing a nucleic acid molecule encoding the B cell epitope of the Salmonella effector protein invasin D into a vector containing the Peg pili encoding gene sequence. The sequence of the recombinant gene fragment is shown in SEQ ID NO.5, the amino acid sequence of the B cell epitope of the Salmonella effector protein invasin D is SEENNDERTL, and the DNA sequence of the nucleic acid molecule is TCTGAAGAGAATAATGACGAGCGCACGCTG.

2. An expression cassette, a recombinant expression vector, a recombinant cell or a recombinant strain, characterized in that: It comprises the recombinant gene segment according to claim 1.

3. A Salmonella pathogen infection antibody detection system, characterized in that: The Salmonella pathogen infection antibody detection system comprises the expression cassette, recombinant expression vector, recombinant cell or recombinant strain according to claim 2.

4. The method for constructing the recombinant expression vector according to claim 2, characterized in that: The following steps are involved: (1) Obtaining the B cell epitope DNA sequence of the Salmonella effector protein invasin D; the DNA sequence is TCTGAAGAGAATAATGACGAGCGCACGCTG; (2) Inserting the DNA sequence obtained in step (1) into the Peg pili encoding gene sequence to obtain the recombinant gene fragment of claim 1, and then constructing a recombinant expression vector.

5. The method for constructing the recombinant strain according to claim 2, characterized in that: The method comprises the following steps: introducing the recombinant expression vector described in claim 2 into the carrier bacteria by means of electrotransformation.

6. Use of the recombinant gene fragment according to claim 1, the expression cassette, the recombinant expression vector, the recombinant cell or the recombinant strain according to claim 2, and the Salmonella pathogen intranasal infection antibody detection system according to claim 3 in the preparation of a reagent or a kit for detecting Salmonella pathogen infection antibodies.

7. A reagent or kit for detecting antibodies against Salmonella pathogen infection, characterized in that: The reagent or kit comprises the recombinant gene fragment according to claim 1, the expression cassette, recombinant expression vector, recombinant cell or recombinant strain according to claim 2 or the Salmonella pathogen infection antibody detection system according to claim 3.

Images