A snp molecular marker related to daily gain on pig chromosome 1 and application thereof

Abstract

This invention belongs to the fields of molecular biology and molecular marker technology, specifically relating to a SNP molecular marker on pig chromosome 1 associated with daily weight gain and its application. The SNP molecular marker on pig chromosome 1 associated with daily weight gain corresponds to nucleotide position 158,590,427 on chromosome 1 of the international pig genome version 11.1 reference sequence, and the base at this position is C. By selecting the dominant allele of this SNP, this invention can increase the frequency of the dominant allele generation by generation, thereby improving the daily weight gain of pigs, accelerating the progress of pig genetic breeding, and effectively improving the economic benefits of breeding pigs.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a SNP molecular marker located on pig chromosome 1 that is associated with daily weight gain and its application. Background Technology

[0002] Currently, my country's pig farming industry has entered an era of large-scale and industrialized development. Pig farms are gradually expanding in size, and production efficiency has become a key factor determining their economic benefits. The growth rate of pigs directly affects the time to market, thus influencing output efficiency and production turnover. Higher daily weight gain not only means a shorter market cycle but also higher output, which is crucial for meeting market demand and improving economic efficiency. The development of the pig industry has benefited from significant progress in the genetic improvement of breeding and commercial pigs. When it comes to the sustainable development and improved economic efficiency of modern pig farming, increasing the daily weight gain of pigs has become an indispensable key factor.

[0003] However, improving daily weight gain in pigs is not a simple task. Pig growth performance is influenced by a variety of factors, including genetics, feeding management, and environmental conditions. Therefore, in-depth research into the impact of genetic factors on daily weight gain in pigs can provide more precise directions for breeding and selection. Utilizing advanced molecular biotechnology, such as genome-wide association studies (GWAS), genetic markers associated with daily weight gain can be identified at the genomic level, thereby accelerating the breeding process and achieving high-efficiency production.

[0004] In conclusion, increasing the daily weight gain of pigs is not only crucial for meeting market demand but also a key pathway to improving the economic efficiency of the pig farming industry. In the development of modern pig farming, through in-depth research into genetic mechanisms and the application of molecular biotechnology, we can expect to achieve a significant increase in the daily weight gain of pigs, laying a solid foundation for the sustainable development of the pig farming industry. Summary of the Invention

[0005] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide a SNP molecular marker located on chromosome 1 of pigs that is associated with daily weight gain.

[0006] Another object of the present invention is to provide applications of the above-mentioned SNP molecular markers.

[0007] Another object of the present invention is to provide a primer pair for identifying the above-mentioned SNP molecular markers.

[0008] A fourth objective of this invention is to provide applications of the aforementioned primer pairs.

[0009] The fifth objective of this invention is to provide a method for genetic improvement of pigs.

[0010] The objective of this invention is achieved through the following technical solution:

[0011] A molecular marker of daily weight gain located on pig chromosome 1, whose SNP site corresponds to the C insertion / deletion at position 158590427 on chromosome 1 in International Pig Reference Genome Version 11.1;

[0012] The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where M in the sequence represents C insertion or C deletion, leading to different daily weight gain traits in pigs;

[0013] The SNP site of the SNP molecular marker is the C179-179 nucleotide insertion / deletion at position 179 of the sequence marked in SEQ ID NO:1 (located at the 179th nucleotide of the nucleic acid in this sequence fragment, position 158590427 on chromosome 1 of the International Pig Reference Genome 11.1 version, named: g.158590427delC);

[0014] The aforementioned SNP molecular markers are used in identifying daily weight gain traits and genetic breeding in Duroc pigs;

[0015] A method for detecting daily weight gain traits in pigs includes the following steps:

[0016] The above-mentioned SNP molecular markers on pig chromosome 1 were detected to determine whether the SNP site single nucleotide C of the SNP molecular markers was missing.

[0017] The preferred pigs are Duroc and its synthetic strains;

[0018] The preferred pigs are S22 Duroc and its synthetic lines;

[0019] A primer pair for identifying the above-mentioned SNP molecular markers, comprising primer-F and primer-R, has the following nucleotide sequence:

[0020] Upstream primer-F: 5'-ACAGACATTCCCGATCCAGG-3';

[0021] Downstream primer-R: 5'-CCTTGCTGTACAGTGGGAAA-3';

[0022] A kit for detecting the above-mentioned SNP molecular markers, comprising the above-mentioned primer pairs;

[0023] Application of the primer pairs or kits described herein in identifying traits affecting daily weight gain in breeding pigs;

[0024] Application of the primer pairs or kits in marker-assisted breeding of pigs;

[0025] Application of the primer pairs or kits in improving the daily weight gain of breeding pigs;

[0026] A method for screening pig breeds with high daily weight gain includes the following steps:

[0027] The genotype at position 158590427 bp on chromosome 1 of the International Swine Reference Genome 11.1 was detected, and individuals with genotype C at position 158590427 bp (homozygous or heterozygous individuals) were selected as breeding pigs.

[0028] The pigs mentioned are Duroc pigs and their synthetic lines;

[0029] The preferred pigs are S22 Duroc and its synthetic lines;

[0030] The method for detecting the genotype at position 158590427 bp on chromosome 1 of the International Swine Reference Genome 11.1 includes the following steps:

[0031] (1) Extract genomic DNA from the pigs to be tested;

[0032] (2) Using the primer pairs mentioned above or the primer pairs in the kit mentioned above as amplification primers, and using the genomic DNA of the pig to be tested as template DNA, PCR amplification was performed to obtain PCR amplification products.

[0033] (3) Sequencing the PCR amplification products to obtain sequencing results;

[0034] (4) Based on the sequencing results, determine the genotype of the SNP molecular markers;

[0035] A method for genetic improvement of pigs, comprising the following steps:

[0036] The above-mentioned SNP molecular markers of breeding pigs in the core breeding pig population were identified, and corresponding selections were made based on the molecular markers: breeding pig individuals with the C genotype at 158590427bp on chromosome 1 of the International Swine Reference Genome 11.1 were selected for succession breeding, and breeding pig individuals with the C genotype missing at this locus were eliminated, so as to increase the frequency of the C allele at this locus in each generation, thereby increasing the daily weight gain of offspring pigs;

[0037] The pigs mentioned are Duroc pigs and their synthetic lines;

[0038] The preferred pigs are S22 Duroc and its synthetic lines;

[0039] The present invention has the following advantages and effects compared with the prior art:

[0040] (1) This invention studies and identifies the molecular markers that affect daily weight gain in pigs, which are located on the nucleotide sequence of chromosome 1 of pigs. The molecular markers are InDel molecular markers of the single-base insertion / deletion type. This invention verifies the effect of these markers on the daily weight gain trait of pigs and finally establishes a molecular marker-assisted selection breeding technology for rapid improvement of the daily weight gain trait. This greatly improves the breeding process of Duroc and its synthetic lines, meets the needs of the live pig market, increases the price of pork, increases the sales profit of enterprises, and enhances their core competitiveness.

[0041] (2) This invention provides a primer pair for detecting SNP molecular markers located on chromosome 1 of pigs that are related to daily weight gain. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established, and traits can be selected quickly and accurately, accelerating the breeding process. This technology can be applied to the genetic improvement of daily weight gain traits in breeding pigs, thereby increasing the daily weight gain of pigs, thereby increasing enterprise profits and enhancing core competitiveness. Attached Figure Description

[0042] Figure 1 This is a Manhattan plot of genome-wide association analysis of the daily weight gain trait of the S22 Duroc strain on chromosome 1; where: the horizontal axis represents the chromosome number of the pig; and the vertical axis represents the -logP value.

[0043] Figure 2 This is a graph showing the phenotypic ratios of daily weight gain in pigs with different genotypes. Detailed Implementation

[0044] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0045] Example 1

[0046] (1) Laboratory animals

[0047] The experimental pig population used in this invention consists of 2,082 purebred S22 Duroc pigs from the breeding pig division of Wens Foodstuff Group Co., Ltd., which is the core group of the breeding pig division.

[0048] This experiment selected S22 Duroc pigs from this resource population. The pigs had free access to feed and water, and the feeding method and rearing conditions remained consistent throughout the experiment, which was a conventional method.

[0049] The average daily weight gain of live pigs from 30 kg to 100 kg was determined using the Osborne FIRE Pig Performance Testing System (Kansas, NE, USA).

[0050] (2) Sample collection

[0051] The collected tail and ear tissues from the above-mentioned breeding pigs were soaked in a 75% ethanol solution and stored at -20°C for later use.

[0052] (3) Pig genome 50K SNP genotyping

[0053] Ear or tail tissues were collected from each of the 2082 S22 Duroc pigs selected from the aforementioned resource population. Whole-genome DNA was extracted using the standard phenol-chloroform method. The concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately determined using a NanoDrop 2000 / 2000C nucleic acid and protein analyzer. DNA samples that passed the NanoDrop 2000 / 2000C nucleic acid and protein analyzer test were diluted to approximately 50 ng / μL. 6 μL of the extracted DNA sample was then mixed with 2 μL of loading buffer and loaded onto a 1% (w / v) agarose gel. Electrophoresis was performed at 150V for 25 min. The DNA integrity was observed and photographed using a UV spectrophotometer and gel imaging device.

[0054] DNA samples were sent to Neogene Biotech (Shanghai) Co., Ltd., where the pig whole genome 50K SNP chip (Illumina, USA) genotype was determined on the Illumina Beadstration platform according to the company's standard procedures.

[0055] (4) Genotype filling

[0056] Genotyping of the 50K SNP microarray dataset was performed using the SWIM database (https: / / quantgenet.msu.edu / swim / ), a website for pig genotyping. The padded whole-genome sequence dataset was quality controlled using PLINK v1.9. SNP markers with a detection rate <99%, mimor allelic frequency (MAF) <1%, or deviation from Hardy-Weinberg equilibrium (HWE) with a p-value ≤10⁻⁶ were removed. Individuals with a detection rate <90% and a family Mendelian error rate higher than 0.1 were excluded. SNPs located at unknown positions and on sex chromosomes were also excluded. Finally, valid genotyping data for 862,880 SNPs were obtained.

[0057] (5) Genome-wide association analysis (GWAS)

[0058] To eliminate population stratification effects, this invention employs a linear mixed model with single-point regression analysis combined with GWAS analysis using the GenABEL software package in R. The analysis model utilizes the similarity of genomes among individuals to correct for stratification effects. The significance threshold for genomes is 1E-08; the significance threshold for chromosomes is 1E-05.

[0059] GWAS analysis results are as follows Figure 1 As shown. From Figure 1 It is known that in Duroc pigs, there is a locus on chromosome 1 that significantly affects daily weight gain, with the strongest association SNP being g.158590427delC (P value 4.85E-06).

[0060] (6) Association analysis between genotypic deletion at this locus (158590427) and daily weight gain phenotype.

[0061] As shown in Table 1, the SNP site g.158590427delC (nucleotide 179 in SEQ NO.1, corresponding to the insertion / deletion of C at position 158590427 on chromosome 1 of the International Swine Reference Genome Version 11.1) was significantly associated with the daily weight gain trait (P<0.001). This indicates that this molecular marker significantly affects the daily weight gain trait of commercial pigs. By using assisted selection at this SNP site in pigs, the daily weight gain of commercial pigs can be improved, thereby increasing economic benefits.

[0062] Furthermore, the variance analysis results for genotype and daily weight gain were highly significant (P<0.01), according to Table 1 and Figure 2 The results showed that the daily weight gain of the CC genotype (homozygous insertion of C) and the -C genotype (deletion of one C) was greater than that of the -- genotype (homozygous deletion of C). The daily weight gain of CC genotype breeding pigs was 17.45g higher than that of -- genotype breeding pigs, and the difference was highly significant (P<0.001). This result indicates that gradually eliminating -- genotype breeding pigs during breeding can significantly improve the daily weight gain of commercial pigs, bringing greater economic benefits to pig farming enterprises.

[0063] Table 1. Correlation between SNP site g.179delC of molecular marker and traits.

[0064]

[0065] Note: ① Daily weight gain of 100 kg is expressed as mean ± standard deviation (SD); ② Lowercase letters indicate the results of multiple comparison analysis of daily weight gain between different genotypes. If the lowercase letters are the same, it means that there is no significant difference in daily weight gain between the two genotype groups. If the lowercase letters are different, it means that the difference in daily weight gain between the two genotype groups is extremely significant (P<0.01); ③ - indicates C deletion; ④ The total sample size is 2082, of which 5 have no genotype.

[0066] Example 2: Target DNA Sequence Amplification and Sequencing

[0067] (1) Primer design

[0068] The DNA sequence of SEQ ID NO:1 on pig chromosome 1 was downloaded from the Ensembl website (http: / / asia.ensembl.org / index.html). Primers were designed using the primer design software Primer Premier 6.0. The DNA sequences of the designed primers are shown below:

[0069] Upstream primer-F: 5'-ACAGACATTCCCGATCCAGG-3';

[0070] Downstream primer-R: 5'-CCTTGCTGTACAGTGGGAAA-3';

[0071] (2) PCR amplification

[0072] To a 10 μL reaction mixture, add 1 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2×Tag PCR StanMix with Loading Dye, and 0.3 μL each of primers primer-F and primer-R. The PCR reaction conditions were: 94℃ pre-denaturation for 5 min; 35 cycles of 94℃ denaturation for 30 s, 58.5℃ annealing for 30 s, and 72℃ extension for 30 s; and a final extension at 72℃ for 5 min.

[0073] (3) DNA sequencing

[0074] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions (positive and negative). The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below:

[0075] ACAGACATTCCCGATCCAGGGACTGAATCAAACCATAGCTGTGACCTGTGCCACAGCTGCAGCAATGCCAGATCCTTTTAACCCACTGTGCTGGGCCAGAGATTTAACCCATGCCTCTTCAATGACCGGATTCAACTGGATTCTTAACTCACTGCAGCAGAGCGTGAACTCCAGAATT M(C / delC) TACTTTTATTTATTTATTTTTTTTATTTTCCCACTGTACAGCAAGG

[0076] Note: M marked in the sequence is the mutation site, indicated by an underline (the part in parentheses indicates C insertion / deletion, and the part in parentheses indicates allele insertion / deletion). The beginning and end of the sequence are bolded to indicate the primer binding position.

[0077] Example 3: Analysis of the g.179delC effect of SNP sites on molecular markers

[0078] This invention provides a SNP molecular marker that can significantly increase the daily weight gain of Duroc breeding pigs. Using this SNP molecular marker for marker-assisted selection can greatly accelerate the breeding process for increasing daily weight gain in Duroc pigs. If this invention successfully breeds all individuals with the -type of the molecular marker affecting daily weight gain into CC-type individuals, the average daily weight gain per pig will increase by 17.45g. Breeders can reduce breeding time by increasing the daily weight gain of pigs, thus reducing breeding losses and improving animal welfare. In individuals with this SNP molecular marker, by selecting the dominant allele (C) of the S22 Duroc SNP, the economic benefits of commercial pigs can ultimately be improved, thereby increasing enterprise profits.

[0079] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a SNP molecular marker located on chromosome 1 of pigs that is associated with daily weight gain in identifying the daily weight gain trait in pigs and in breeding for the genetics of the daily weight gain trait, characterized by: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where M in the sequence represents C insertion or C deletion, leading to different daily weight gain traits in pigs; specifically, for individual pigs, the daily weight gain of the homozygous C-inserted genotype and the heterozygous C-deleted genotype is greater than that of the homozygous C-deleted genotype. The pigs mentioned are S22 Duroc and its synthetic strains.

2. A method of detecting a pig daily gain trait, characterized in that It includes the following steps: The method involves detecting whether the SNP molecular marker described in claim 1 is missing at the SNP site of the SNP molecular marker; wherein, for individual pigs, the daily growth rate of the genotypes with homozygous insertion of C and heterozygous deletion of C at the SNP molecular marker is greater than that of the genotype with homozygous deletion of C. The pigs mentioned are S22 Duroc and its synthetic strains.

3. The application of a primer pair for identifying SNP molecular markers associated with daily weight gain located on pig chromosome 1, or a kit for detecting SNP molecular markers associated with daily weight gain located on pig chromosome 1, in identifying the daily weight gain trait in pigs, characterized in that: The primer pair comprises primers primer-F and primer-R, whose nucleotide sequences are as follows: Upstream primer-F: 5'-ACAGACATTCCCGATCCAGG-3'; Downstream primer-R: 5'-CCTTGCTGTACAGTGGGAAA-3'; The kit contains the primer pairs described above; The SNP molecular marker is the SNP molecular marker described in claim 1; wherein, for pig individuals, the daily growth rate of the genotype with homozygous insertion C and the genotype with heterozygous deletion C at the SNP molecular marker is greater than that of the genotype with homozygous deletion C. The pigs mentioned are S22 Duroc and its synthetic strains.

4. The application of a primer pair for identifying SNP molecular markers associated with daily weight gain located on pig chromosome 1, or a kit for detecting SNP molecular markers associated with daily weight gain located on pig chromosome 1, in marker-assisted breeding of pig daily weight gain trait, characterized in that: The primer pair comprises primers primer-F and primer-R, whose nucleotide sequences are as follows: Upstream primer-F: 5'-ACAGACATTCCCGATCCAGG-3'; Downstream primer-R: 5'-CCTTGCTGTACAGTGGGAAA-3'; The kit contains the primer pairs described above; The SNP molecular marker is the SNP molecular marker described in claim 1; wherein, for pig individuals, the daily growth rate of the genotype with homozygous insertion C and the genotype with heterozygous deletion C at the SNP molecular marker is greater than that of the genotype with homozygous deletion C. The pigs mentioned are S22 Duroc and its synthetic strains.

5. A method of selecting a pig breed for high daily gain trait, characterized in that It includes the following steps: The genotype at position 158590427 bp on chromosome 1 of the International Swine Reference Genome 11.1 was detected, and individuals with the C genotype at position 158590427 bp were selected as breeding pigs. The pigs mentioned are S22 Duroc and its synthetic strains.

6. A method of genetic improvement of swine, characterized in that It includes the following steps: Identify the SNP molecular markers described in claim 1 for breeding pigs in the core breeding pig herd, and make corresponding selections based on the molecular markers: in the successive breeding of breeding pigs, select breeding pig individuals with the C genotype of the SNP molecular marker described in claim 1, and eliminate breeding pig individuals lacking the C genotype, so as to increase the frequency of the allele C at this locus in each generation, thereby increasing the daily weight gain of offspring pigs. The pigs mentioned are S22 Duroc and its synthetic strains.

Images