An indel molecular marker related to yield of alfalfa on chromosome 3 and application thereof

Abstract

This invention belongs to the field of molecular marker technology and discloses an InDel molecular marker located on chromosome 3 related to alfalfa yield and its applications. The upstream primer sequence of the primer pair for amplifying the molecular marker is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2. The molecular marker is located on chromosome 3 of alfalfa, and the nucleotide sequence of its inserted or deleted fragment is shown in the sequence listing SEQ ID NO.3. The InDel molecular marker and primer pair provided by this invention can predict, identify, or assist in the identification of alfalfa yield traits. This invention also provides a method for identifying alfalfa yield traits using the InDel molecular marker; this method is simple, rapid, and provides accurate identification results, with good prospects for widespread application.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an InDel molecular marker located on chromosome 3 that is associated with alfalfa yield and its application. Technical Background

[0002] Alfalfa (Medicago sativa L.) is a perennial herbaceous plant belonging to the genus *Medicago* in the legume family (Fabaceae). It is one of the most widely distributed forage crops in the world. Its crude protein content can reach over 20%, and it has good palatability, making it a high-quality source of animal feed. It is widely cultivated in northern my country. With the increasing demand for meat, eggs, and dairy products, the livestock industry faces higher development requirements. As a plant with extremely high protein content, alfalfa is crucial for the development of the livestock industry. Therefore, cultivating high-yield and high-quality alfalfa new materials is of great significance for increasing alfalfa production and promoting the development of the forage and livestock industries.

[0003] With the continuous development and improvement of modern biogenetic technology, scholars are increasingly emphasizing the use of molecular marker technology to assist genetic breeding, thereby improving breeding efficiency and eliminating blind spots in the breeding process. Marker breeding technology selects genes for target traits by tracking genetic markers, thus achieving the goal of breeding new materials. This technology has advantages such as accuracy, speed, and efficiency, and is widely used in an increasing number of crops. Genome-wide association studies (GWAS) are one of the most efficient methods for analyzing quantitative traits. By performing high-density genetic marker typing on a large-scale population DNA sample, it seeks genetic information related to complex traits. This invention uses 231 alfalfa accessions to construct a population, resequencing them and combining this with GWAS for fresh weight traits, developing an InDel locus associated with yield. This invention provides theoretical support and genetic resources for high-yield molecular genetic improvement of alfalfa and the breeding of new materials. Summary of the Invention

[0004] One of the objectives of this invention is to provide an InDel molecular marker located on chromosome 3 that is associated with alfalfa yield.

[0005] The second objective of this invention is to provide the application of the InDel molecular marker located on chromosome 3 that is associated with alfalfa yield.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] This invention discloses a molecular marker associated with alfalfa yield, located on alfalfa chromosome 3, named Ms_Chr3_19294879.

[0008] The primer pairs for amplifying the above molecular markers have the following primer pair sequences:

[0009] Ms_Chr3_19294879-F: GTCTGAGTTGTGTTTGGTGA (as shown in SEQ ID NO.1);

[0010] Ms_Chr3_19294879-R: CTCATTTCCACAAATTATAATCACAT (as shown in SEQ ID NO.2);

[0011] This invention also discloses the application of the above-mentioned molecular marker primer pairs in yield-assisted breeding of alfalfa. That is, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage, the presence of the molecular markers of this invention can be detected, thereby identifying yield-related traits in alfalfa materials. The detection can be performed using PCR, specifically using the above-mentioned molecular marker primer pairs, or it can be performed using sequencing methods.

[0012] This invention also discloses the application of the above-mentioned molecular markers in identifying yield traits in alfalfa, especially in screening and identifying high and low yields of alfalfa. Specifically, the specific steps for identifying whether alfalfa has a high-yield trait are as follows:

[0013] (1) Using the DNA of the tested germplasm as a template for PCR amplification, and Ms_Chr3_19294879-F and Ms_Chr3_19294879-R as primers, the PCR amplification reaction system is shown in Table 1:

[0014] Table 1. Reaction system for PCR amplification

[0015]

[0016] Pre-denaturation at 98℃ for 30 seconds; denaturation at 98℃ for 10 seconds, annealing at 59℃ for 5 seconds, extension at 72℃ for 2 seconds, 35 cycles; extension at 72℃ for 5 minutes; storage at 4℃.

[0017] (2) Detection of PCR product by agarose gel electrophoresis: Take 2.5 μL and judge the yield of alfalfa based on the band results.

[0018] PCR amplification was performed using primers Ms_Chr3_19294879-F and Ms_Chr3_19294879-R.

[0019] If the PCR amplification product has only one characteristic band of 250 bp as shown in SEQ ID NO.4, then alfalfa is a low-yielding type; if the PCR amplification product has both one characteristic band of 250 bp as shown in SEQ ID NO.4 and one characteristic band of 198 bp as shown in SEQ ID NO.5, then alfalfa is a high-yielding type.

[0020] In addition, this invention also protects a kit for identifying yield traits in alfalfa, the kit containing primer pairs Ms_Chr3_19294879-F and Ms_Chr3_19294879-R. Other components of the kit are conventional reagents. Specifically, it also includes 10×PCR Buffer, dNTPs, and Taq DNA polymerase. This invention does not impose any special restrictions on the concentration of the primer pairs; primer concentrations well-known in the art can be used. This invention also does not impose any special restrictions on the source of the 10×PCR Buffer, dNTPs, and Taq DNA polymerase; common PCR amplification reagents well-known in the art can be used.

[0021] The kit of this invention can rapidly identify the yield trait of alfalfa and its yield genotype. The specific method is the same as for identifying whether alfalfa possesses a high-yield trait. The specific steps are as follows: Electrophoresis and / or sequencing are performed on the PCR amplification products. If the PCR amplification product contains only one characteristic band of 250 bp as shown in SEQ ID NO.4, then the alfalfa is a homozygous low-yield genotype; if the PCR amplification product contains both one characteristic band of 250 bp as shown in SEQ ID NO.4 and one characteristic band of 198 bp as shown in SEQ ID NO.5, then the alfalfa is a heterozygous high-yield genotype.

[0022] The present invention has the following advantages:

[0023] (1) Using markers linked to yield traits for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0024] (2) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be applied to alfalfa high-yield breeding practice and material identification in a simple, rapid and high-throughput manner. Attached Figure Description

[0025] Figure 1 The genome-wide association analysis results for alfalfa yield are based on the Manhattan plot obtained from EMMAX software analysis. The red dots indicate the InDel positions associated in this invention.

[0026] Figure 2 This is a box plot showing the fresh weight distribution of the genotype at the Ms_Chr3_19294879 locus in the alfalfa population of this invention; 0 / 0 indicates that the genotype at the Ms_Chr3_19294879 locus is homozygous and low-yielding, and 0 / 1 indicates that the genotype at the Ms_Chr3_19294879 locus is heterozygous and high-yielding; the dots represent extreme values ​​of the data, and *** represents P<0.001.

[0027] Figure 3 This is a partial sequence alignment result between high-yield and low-yield materials in the yield-related region.

[0028] Figure 4 Electrophoresis images of amplified molecular markers from 15 alfalfa germplasm resources, using agarose gels with a concentration of 3%. M in the image represents the DNA marker. Detailed Implementation

[0029] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0030] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0032] Example 1: Development of molecular markers associated with alfalfa yield

[0033] This invention uses the fresh weight of alfalfa at the initial flowering stage to measure alfalfa yield. A higher value indicates higher yield, and a lower value indicates lower yield. After measuring the fresh weight of the alfalfa population, GWAS analysis was used to locate an InDel locus in the alfalfa. Figure 1The red locus, named Ms_Chr3_19294879, is located at locus 19294879 on chromosome 3 of the alfalfa reference genome. The first allele is genotype 0 / 0, and the second allele is genotype 0 / 1. A box plot showing the yield distribution of Ms_Chr3_19294879 at this locus in the population is provided. Figure 2 This indicates that alfalfa lines with genotype 0 / 0 have significantly higher yields than those with genotype 0 / 1. An insertion / deletion fragment TTGTAAGGAATGTAGAACTAAGGTATGGCACATCTCGAAACACTACGGTTAC (shown in SEQ ID NO. 3) is present at locus 19294879 on alfalfa chromosome 3. Figure 3 The insertion of the fragment shown in SEQ ID NO.3 affects alfalfa yield. Alfalfa with the fragment shown in SEQ ID NO.3 inserted is low-yielding alfalfa; alfalfa without the fragment shown in SEQ ID NO.3 is high-yielding alfalfa.

[0034] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using Snapgene software:

[0035] Ms_Chr3_19294879-F: GTCTGAGTTGTGTTTGGTGA (as shown in SEQ ID NO.1);

[0036] Ms_Chr3_19294879-R: CTCATTTCCACAAATTATAATCACAT (as shown in SEQ ID NO.2);

[0037] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of homozygous low-yielding alfalfa samples had only a 250bp characteristic band, while the PCR product of heterozygous high-yielding alfalfa samples had both a 250bp characteristic band and a 198bp characteristic band.

[0038] Example 2: Accuracy verification of the molecular markers described in this invention

[0039] The 231 germplasm accessions were identified, and the specific germplasm materials used are shown in Table 2:

[0040] Table 2. Yield and genotype of 231 germplasm materials

[0041]

[0042]

[0043]

[0044]

[0045]

[0046] 1) Using the genomic DNA of alfalfa to be identified as a template, PCR amplification was performed using the primer pair to obtain the PCR product;

[0047] The PCR amplification reaction system is as follows: template DNA 10–100 ng, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, 2×Phanta Flash Mix 5 μL, and deionized water to a final volume of 10 μL. The preferred PCR amplification reaction program is: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 59℃ annealing for 5 s, 72℃ extension for 2 s, 35 cycles; 72℃ extension for 5 min; and storage at 4℃. Separation is performed by electrophoresis on a 3% agarose gel. After loading, the samples are electrophoresed at 120V DC for 45 min, and the PCR banding patterns of each sample are then read.

[0048] 2) Determine the yield of alfalfa based on the size of the PCR product: When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, then the alfalfa to be identified is a high-yielding alfalfa.

[0049] When the PCR product of the alfalfa to be identified contains the fragment shown in SEQ ID NO.3, the alfalfa to be identified is low-yielding alfalfa.

[0050] Specifically, when the PCR product of the alfalfa to be identified contains the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 250 bp, then the alfalfa to be identified is low-yielding alfalfa.

[0051] The sequence of SEQ ID NO.4 is as follows:

[0052]

[0053] When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 198bp, then the alfalfa to be identified is a high-yielding alfalfa.

[0054] The sequence of SEQ ID NO.5 is as follows:

[0055]

[0056] Furthermore, as shown in Table 2, this study identified 231 alfalfa accessions. Among them, 202 alfalfa materials amplified only one 250bp characteristic band, and the identification result was homozygous low-yielding genotype (0 / 0). The average fresh weight of these 202 alfalfa materials was 0.796 kg. 29 alfalfa materials amplified both one 250bp characteristic band and one 198bp characteristic band, and the identification result was heterozygous high-yielding genotype (0 / 1). The average fresh weight of these 29 alfalfa materials was 1.016 kg, which was higher than the average of the 202 low-yielding alfalfa materials. Analysis of variance showed a highly significant difference in fresh weight between the high-yielding and low-yielding genotypes (P<0.001). Figure 4 The PCR results of 15 germplasms (CF005602, CF050248, WL440HQ, PI634028, Plato ZS, CF002724, Juneng 601, CF020828, Zhongmu 4, Leiting, Xinmu 4, Naiyanzhixing, P610821619, CF039770, and Juneng 201) were shown, and they corresponded consistently with the actual fresh weight results. The electrophoresis images of the remaining germplasms also corresponded consistently with the actual fresh weight results. Therefore, the InDel molecular marker of this invention can effectively identify the yield trait of alfalfa and can be used for the prediction and screening of high-yielding alfalfa materials.

[0057] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A molecular marker located on chromosome 3 associated with alfalfa yield, characterized in that, The nucleotide sequences of the molecular marker are shown in SEQ ID NO.4 and SEQ ID NO.

5. This molecular marker is an insertion / deletion of the fragment shown in SEQ ID NO.3 on chromosome 3 of the alfalfa reference genome. The primer pair sequences for amplifying the molecular marker are as follows: Ms_Chr3_19294879-F: GTCTGAGTTGTGTTTGGTGA; Ms_Chr3_19294879-R:CTCATTCCACAAATTATAATCACAT.

2. The application of the primer pair of the molecular marker described in claim 1 in predicting, identifying or assisting in the identification of yield traits of alfalfa.

3. A method for identifying yield traits of alfalfa, characterized in that, The method includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) The determination is based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are as follows: PCR amplification was performed using primers Ms_Chr3_19294879-F and Ms_Chr3_19294879-R. If the PCR amplification product contained only one characteristic band of 250 bp as shown in SEQ ID NO.4, then the alfalfa was of low-yield type. If the PCR amplification product contained both one characteristic band of 250 bp as shown in SEQ ID NO.4 and one characteristic band of 198 bp as shown in SEQ ID NO.5, then the alfalfa was of high-yield type.

4. The application of a reagent kit in identifying the yield genotype of alfalfa, characterized in that, The kit contains the primer pair described in claim 1. A method for identifying alfalfa yield genotypes using the kit includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the kit, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) Perform electrophoresis and / or sequencing on the PCR amplification products. If the PCR amplification product has only one characteristic band of 250 bp as shown in SEQ ID NO.4, then alfalfa is a homozygous low-yielding genotype; if the PCR amplification product has both one characteristic band of 250 bp as shown in SEQ ID NO.4 and one characteristic band of 198 bp as shown in SEQ ID NO.5, then alfalfa is a heterozygous high-yielding genotype.

Images