A nucleic acid aptamer for recognizing compound phenanthrene

Abstract

The present invention relates to the field of pollutant detection, and specifically to a nucleic acid aptamer for identifying compound phenanthrene. The present invention screens out a nucleic acid aptamer for compound phenanthrene through exponential enrichment ligand system evolution technology combined with specific positive screening and reverse screening strategies, and its nucleotide sequence is shown in SEQ ID NO: 1. The present invention also provides a method for detecting compound phenanthrene, which detects compound phenanthrene through nanogold colorimetry, which is convenient, rapid, highly sensitive, and has a wide detection range.

Description

Technical Field

[0001] The invention relates to the field of pollutant detection, and in particular to a nucleic acid aptamer for recognizing compound phenanthrene. Background Art

[0002] PAHs are a class of hazardous compounds widely present in the environment, mainly produced by incomplete combustion and pyrolysis of organic materials such as coal, wood, oil and natural gas. Most PAHs are considered to be highly carcinogenic, mutagenic and teratogenic, and among these compounds, phenanthrene has been listed as a priority pollutant by the European Union and the US Environmental Protection Agency due to its stable properties and high environmental concentration detection.

[0003] However, there is no good detection method for phenanthrene at present. The common gas and liquid chromatography methods cannot accurately detect phenanthrene due to the large number of structural analogs of phenanthrene. At present, there is no establishment of phenanthrene antibodies, so there is no immunological detection technology for phenanthrene.

[0004] Nucleic acid aptamers are a single-stranded nucleic acid sequence that can be folded into a variety of structures including stem loops and concave loops through intermolecular interaction forces, and can bind to specific groups to identify substances with similar structures. At the same time, compared with antibodies, nucleic acid aptamers have higher variability and can be folded into more complex structures to accurately identify phenanthrene. At present, the screening of nucleic acid aptamers is mainly obtained by screening through the systematic evolution of ligands by exponential enrichment (Systematic Evolution of Ligands by Exponential Enrichment, SELEX), which has the advantages of easy synthesis, labeling and transformation, low toxicity, good biochemical stability, etc., and is considered to be a substitute for antibodies and has been used to establish a variety of detection methods including biosensors. There is no report on nucleic acid aptamers for compound phenanthrene. Summary of the invention

[0005] In order to solve the technical problem of how to conveniently detect compound phenanthrene in the art, the inventor screened out nucleic acid aptamers of compound phenanthrene through exponential enrichment ligand system evolution technology, combined with specific positive screening and reverse screening strategies, and provided a method for detecting compound phenanthrene. The present invention adopts the following technical solution:

[0006] The present invention provides a nucleic acid aptamer of a compound phenanthrene, and the nucleotide sequence thereof is shown in SEQ ID NO:1.

[0007] In some embodiments, the nucleotide sequence of the nucleic acid aptamer of the compound phenanthrene is coupled with a fluorescent group, a quenching group, biotin, a nanomaterial, a sulfhydryl group, an amino group or an enzyme.

[0008] In some embodiments, a position on the nucleotide sequence of the nucleic acid aptamer of the compound phenanthrene is phosphorylated, oxygen-methylated, methylated, aminated, thiolated, fluorinated, or isotopized.

[0009] The present invention also provides the use of the nucleic acid aptamer of the compound phenanthrene in detecting the compound phenanthrene.

[0010] The present invention also provides a method for screening nucleic acid aptamers of the compound phenanthrene, which comprises firstly screening a certain number of nucleic acids through systematic evolution of ligands by exponential enrichment (SELEX), then performing affinity verification through nanogold colorimetry, and determining the nucleic acid aptamer of the compound phenanthrene according to the affinity.

[0011] In some embodiments, the affinity verification is determined by measuring 530nm / 650nm OD values.

[0012] The present invention also provides a method for detecting compound phenanthrene, comprising: adding a nucleic acid aptamer of the compound phenanthrene to a nanogold solution for incubation, adding a standard substance with gradient concentrations for incubation and color development, measuring 530nm / 650nm OD values, and drawing a standard curve; adding the nucleic acid aptamer of the compound phenanthrene to a nanogold solution for incubation, then adding a sample to be tested for incubation and color development, and determining the concentration of the compound phenanthrene in the sample to be tested according to the standard curve.

[0013] In some embodiments, the concentration of the gradient concentration standard is 0.97-62.5 ng / mL.

[0014] The present invention also provides a detection kit for the compound phenanthrene, comprising: a nucleic acid aptamer for the compound phenanthrene and nanogold.

[0015] Compared with the prior art, the beneficial effects of the present invention include at least:

[0016] 1. The present invention screened out the nucleic acid aptamer of the compound phenanthrene for the first time, which has high affinity and strong specificity for the compound phenanthrene and can be used to detect the compound phenanthrene in the sample.

[0017] 2. The nucleic acid aptamer of the present invention detects the compound phenanthrene by nanogold colorimetry, which is convenient, rapid, highly sensitive and has a wide detection range. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 PCR results for high-throughput sequencing analysis.

[0019] Figure 2 is the enrichment of the aptamer library.

[0020] Figure 3 The gold nanoparticle colorimetric method based on the F5 sequence was used to detect different concentrations of phenanthrene;

[0021] Figure 4 To establish a standard curve for nanogold colorimetry based on the F5 sequence. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical scheme and beneficial effects of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. Examples of the embodiments are shown in the accompanying drawings. It should be understood that the specific embodiments described in the following embodiments of the present invention are only exemplary descriptions of the specific embodiments of the present invention, and are intended to be used to explain the present invention, but do not constitute a limitation of the present invention.

[0023] The endpoints of ranges and any values ​​disclosed herein are not limited to the exact range or value, and these ranges or values ​​should be understood to include approximations to these ranges.

[0024] Example 1 Screening of nucleic acid aptamers for compound phenanthrene

[0025] The nucleic acid aptamers of the compound phenanthrene are mainly screened by the capture SELEX method. The specific screening process includes the following steps:

[0026] (1) Design of the initial library: The initial library sequence is 5'-ATTGGCACTCCACGCATAGG-N(40)-CCTATGCGTGCTACCGTGAA-3' (SEQ ID NO: 2), wherein N(40) is a random sequence and both ends are primer binding regions, which facilitate the amplification of nucleic acid aptamers and the hybridization of primer aptamers labeled with biotin.

[0027] (2) Primary screening: First, 1OD of the initial library was dissolved in a 1mL sterilized EP tube using 0.1M PBS, and 14μL of the pre-dissolved 100μM primer S1-CS was added. The nucleotide sequence was shown in SEQ ID NO: 3, and the 3' end was labeled with biotin (i.e. CCTATGCGTGGAGTGCCAAT-biotin). A PCR instrument was used for slow denaturation, and the denaturation program was 95℃, 10min; 60℃, 1min; 25℃, 1min; the above cooling rate was 0.1℃ / min. After the denaturation was completed, 1mL of streptavidin magnetic beads (Thermo Fisher Scientific, American) was added and incubated for 30min. After the coupled magnetic beads were washed 6 times with 0.1M PBS solution, phenanthrene was added as a target for incubation. The incubation time was 30min. Then, the magnetic beads were fished with a magnet, and the supernatant solution was collected to obtain the primary screening nucleic acid aptamer library.

[0028] (3) Preparation of secondary library: The initial library obtained by screening was subjected to PCR amplification. The PCR amplification system is shown in Table 1. The amplification conditions are: pre-denaturation at 95°C for 5 min, 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 30 cycles, and 72°C for 5 min. After the PCR was completed, the PCR products were collected, 5 times the volume of n-butanol was added and centrifuged at 8000rpm for 1min. The solution was clearly stratified, and the supernatant was discarded. After the lower layer solution was concentrated to 0.1mL, an equal volume of 2X TBE-Urea loading buffer (Sangonbiotech, Shanghai) was added. After boiling for 10min, 8% urea denaturing PAGE was used for separation, the voltage was 300V, and the time was about 45min. Because the upstream primer of PCR had a green fluorescent marker and the downstream primer had a spacer arm, it would be divided into two single-stranded DNAs due to different molecular weights. Under the irradiation of ultraviolet light, the fluorescent band was cut out, and the band was placed in 4mL PBS solution and boiled for 10min. After collecting the supernatant, the solution was concentrated again with n-butanol. After repeated several times, the sample volume was concentrated to about 0.1mL, and the concentrated solution was placed in a dialysis bag and dialyzed in a PBS solution at 4℃ overnight. The solution in the dialysis bag was collected the next day as a new single-stranded library for the next round of screening. At the same time, in order to avoid the preferential amplification of PCR products, 9 mL of emulsion (73% Tegosoft, 20% mineral oil, 7% ABIL WE) was added to the common PCR system from the third round to perform emulsion PCR. The amplification conditions were: 95°C pre-denaturation for 5 min, 95°C for 1 min, 60°C for 1 min, 72°C for 1 min, 30 cycles, 72°C for 5 min. After the amplification, the emulsion was broken by centrifugation at 12000 rpm, and then concentrated with n-butanol and separated by urea denaturing PAGE.

[0029] Table 1 Common PCR reaction system

[0030]

[0031] (4) Multiple screening: Referring to the first round of screening, a total of 4 rounds of screening were performed. The results of each round of screening were then monitored using RT-PCR and the retention rate after each round of screening was calculated.

[0032] (5) Library sequencing: The libraries screened in four rounds were subjected to conventional PCR amplification. The amplification system was as follows: 25 μL 2× Pro Taq Master Mix (Takara, Shanghai), 2 μL template (library obtained in each round of screening), 1 μL upstream primer (S1-FAM, 10 μM), 1 μL downstream primer (A2-ployA, 10 μM), and water was added to make up to 50 μL; the reaction system was as follows: pre-denaturation at 94°C for 5 min, 98°C for 10 s, 55°C for 30 s, 72°C for 1 min, 30 cycles, and 72°C for 5 min. The nucleotide sequence of the upstream primer S1-FAM is shown in SEQ ID NO: 4, and it has a FAM fluorescent label at the 5' end (i.e., 6-FAM-ATTGGCACTCCACGCATAGG); the sequence of the downstream primer A2-ployA is shown in SEQ ID NO: 5, and the first 20 adenylate residues are connected to the subsequent nucleotide residues through the spacer arm Spacer18 (i.e., A(20)-spacer18-TTCACGGTAGCACGCATAGG).

[0033] After PCR, use Shanghai Biotech's oligonucleotide purification kit to recover and purify each library. The specific method is to add 450μL Binding Buffer I and mix well, then transfer the mixed solution to the adsorption column, place it at room temperature for 2 minutes, and centrifuge it at 8000rpm for 2 minutes; pour out the liquid in the collection tube and put the adsorption column into the same collection tube; add 500μL Wash Solution to the adsorption column, centrifuge it at 10000rpm for 1 minute, and repeat this step once; pour out the waste liquid in the collection tube, put the adsorption column into the same collection tube, and centrifuge it at 10000rpm for 2 minutes; put the adsorption column into a clean 1.5mL centrifuge tube, add 30-50μl Elution Buffer to the center of the adsorption membrane, let it stand at room temperature for 5 minutes, centrifuge it at 10000rpm for 2 minutes, and perform high-throughput sequencing analysis on the purified libraries at each level. PCR results are as follows: Figure 1 As shown, the single band of the 4-round library can be used for high-throughput sequencing results.

[0034] (6) High-throughput results show (such as Figure 2 As the number of screening rounds progressed, multiple sequences were enriched, among which the highest F1 enrichment number was 246. In this study, the 40 aptamers with the highest enrichment were selected for subsequent experiments.

[0035] Example 2: Screening of nucleic acid aptamers that effectively recognize phenanthrene by nanogold colorimetry

[0036] (1) Preparation of gold nanoparticles

[0037] Nano-gold particles were prepared by sodium citrate reduction method. First, 100 mL of ultrapure water was heated to boiling, followed by the addition of 1 mL of 1% chloroauric acid solution, and 10 mL of 1% sodium citrate solution after 1 min. The solution turned from light yellow to gray and finally to wine red. After heating for 5 min, the heat source was turned off and cooled to room temperature.

[0038] (2) Establishment of gold nanoparticle colorimetry

[0039] According to the high-throughput sequencing results, 40 sequences that were significantly enriched were selected, and the above sequences were synthesized by Shanghai Biotech and diluted to 10 μM. Then 168 μL of nanogold solution was added to a 96-well plate, followed by 2 μL of 10 μM nucleic acid aptamer, and after incubation at room temperature for 30 minutes, 30 μL of different concentrations of phenanthrene solution (0.97-125 ng / mL) were added respectively, and after incubation at room temperature for 30 minutes, 10 μL of 10% NaCl solution was added, and after incubation at room temperature for 5 minutes, the OD values ​​at 530nm and 650nm were measured using an enzyme marker, and the affinity of the aptamer was determined according to OD530 / OD650. Figure 3 The affinity determination result of the F5 sequence shows that F5 can effectively recognize phenanthrene. The nucleotide sequence of the F5 sequence is CGCATAGGTACAATGTCCCCGTATATTGGCCTATGTGTGGTGTGTCTCCTATGCG (SEQ ID NO: 1), which is the nucleic acid aptamer of the compound phenanthrene of the present invention.

[0040] Example 3: Detection of phenanthrene concentration by nucleic acid aptamer

[0041] (1) Establishment of standard curve for gold nanoparticle colorimetry

[0042] 2 μL of 10 μM aptamer was added to 168 μL of nanogold solution and incubated at room temperature for 5 min. Then 30 μL of standard was added. After incubation at room temperature for 5 min, 10% NaCl solution was added and color was developed for 10 min. The OD value at 530 nm / 650 nm was measured and a standard curve was drawn. Figure 4 shown. Figure 4 It is shown that the nucleic acid aptamer provided by this patent can be used to establish a nanogold colorimetric method for detecting phenanthrene, wherein the detection range is 0.97-62.5 ng / mL.

[0043] (2) Testing of samples to be tested

[0044] According to the step (1), 30 μL of the sample to be tested was added and the OD value at 530 nm / 650 nm was measured to be 0.518, indicating that the concentration of the compound phenanthrene in the sample to be tested was approximately 20 ng / mL.

[0045] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention and do not constitute a limitation on the content of the present invention. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A nucleic acid aptamer of a compound phenanthrene, characterized in that: The nucleotide sequence thereof is shown in SEQ ID NO:

1.

2. The nucleic acid aptamer of the compound phenanthrene according to claim 1, characterized in that The nucleotide sequence of the nucleic acid aptamer of the compound phenanthrene is coupled with a fluorescent group, a quenching group, biotin, a nano material, a sulfhydryl group, an amino group or an enzyme.

3. The nucleic acid aptamer of the compound phenanthrene according to claim 1, characterized in that A certain position on the nucleotide sequence of the nucleic acid aptamer of the compound phenanthrene is phosphorylated, oxygen-methylated, methylated, aminated, sulfhydrylated, fluorinated or isotopeated.

4. Use of the nucleic acid aptamer of the compound phenanthrene according to any one of claims 1 to 3 in detecting the compound phenanthrene.

5. A method for detecting compound phenanthrene, characterized in that, include: The phenanthrene nucleic acid aptamer of any one of claims 1 to 3 is added to a nanogold solution for incubation, a standard substance with gradient concentrations is added for incubation and color development, the OD value at 530 nm / 650 nm is measured, and a standard curve is drawn; The nucleic acid aptamer of the compound phenanthrene according to any one of claims 1 to 3 is added to a nanogold solution for incubation, and then the sample to be tested is added for incubation and color development, and the concentration of the compound phenanthrene in the sample to be tested is determined according to the standard curve.

6. The method for detecting compound phenanthrene as claimed in claim 5, characterized in that, The concentration of the standard substance in the gradient concentration ranges from 0.97 to 62.5 ng / mL.

7. A detection kit for compound phenanthrene, comprising: The compound phenanthrene nucleic acid aptamer and nanogold according to any one of claims 1 to 3.

Images