A product for evaluating the aspect ratio of fresh tea leaves and its application

Abstract

The present invention discloses a SNP molecular marker site linked to the quantitative trait of the length-to-width ratio of tea leaves and its application. The present invention discovered for the first time a SNP molecular marker site linked to the quantitative trait of the length-to-width ratio of tea leaves, which is located on the tea genome Chr01: 22487501. Its genotype is significantly correlated with the leaf length-to-width ratio, and the leaf length-to-width ratio corresponding to the AA genotype is significantly different from that of the GG and AG types. Statistically speaking, when the genotype is wild-type GG or single mutation AG, it is highly likely that the tea leaf length-to-width ratio is low; when the genotype is double mutation AA, it is highly likely that the tea leaf length-to-width ratio is high. Further establishing a detection method for detecting this site can be used to evaluate the length-to-width ratio of tea leaves, so as to be further used in tea resource screening and molecular breeding. This is the basis for carrying out molecular marker-assisted selection breeding of tea trees.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular breeding of tea trees, and more specifically, to a product for evaluating the length-width ratio of fresh leaves of tea trees and an application thereof. Background Art

[0002] Tea (Camellia sinensis (L.) O. Kuntze) belongs to the Camellia family, the tea group, and originated in southwest China, with a cultivation history of more than 5,000 years. Tea, coffee, and cocoa are known as the world's three major non-alcoholic beverages, with important economic value and a significant impact on society and culture.

[0003] Tea tree is a perennial, evergreen, woody plant, belonging to the genus Camellia of the family Theaceae. It is an evergreen shrub or small tree. Its leaves are thin and leathery, elliptical or oblong, with serrated edges. Tea leaves and buds are generally used to make tea. Some people pick one top bud and the first leaf next to the bud (one heart and one leaf), some pick more than one leaf (one heart and two leaves), and some pick one heart and three leaves.

[0004] The morphological characteristics of tea leaves, including the length-to-width ratio of the leaf shape, are important economic indicators of tea. Generally speaking, longer tea leaves are often considered one of the indicators of high quality. Studying the shape of tea leaves can help evaluate the appearance quality of tea leaves and guide the selection and identification of tea leaves.

[0005] Tea tree leaf shape is also related to tea yield. Tea trees with different leaf shapes may have different photosynthesis efficiency and leaf area, which will affect the growth and nutrient utilization efficiency of tea trees. By selecting tea tree varieties with larger leaf area and reasonable leaf shape, the photosynthesis capacity of tea leaves can be improved and the yield of tea trees can be increased.

[0006] In summary, the research and application of tea tree leaf shape in tea tree breeding can help select tea tree varieties with high quality and high yield, promote the development of the tea industry and the sustainability of tea tree planting.

[0007] Tea trees use sexual reproduction, which uses the combination of tea tree reproductive cells to produce the next generation of tea trees, also known as seed reproduction. At present, tea tree breeding is mainly carried out through conventional methods, selecting excellent individual plants from wild populations and hybrid offspring for systematic breeding. This method is time-consuming and inefficient, resulting in slow replacement of new varieties and failure to quickly meet the public's demand for new products. Molecular marker-assisted breeding can significantly improve breeding efficiency because it can select breeding materials at the seedling stage.

[0008] Discovering molecular markers that are closely linked to the excellent traits of tea plants is the basis for conducting molecular marker-assisted selection breeding of tea plants. However, due to the limitations of traditional QTL positioning research progress, SNP molecular marker sites that affect the leaf length-width ratio have not been found. Summary of the invention

[0009] The purpose of the present invention is to overcome the deficiencies of the prior art and to provide a product for evaluating the aspect ratio of fresh tea leaves and its application.

[0010] The first object of the present invention is to provide a product for evaluating the aspect ratio of fresh tea leaves.

[0011] A second object of the present invention is to provide a method for evaluating the aspect ratio of fresh tea leaves.

[0012] The third object of the present invention is to provide a product for detecting the genotype of a SNP located at Chr01:22487501 site in the tea plant genome and its use in establishing a method for evaluating the length-width ratio of fresh tea leaves.

[0013] The fourth object of the present invention is to provide a product for detecting the genotype of a SNP located at Chr01:22487501 site in the tea plant genome for use in establishing a kit for evaluating the length-width ratio of fresh tea leaves.

[0014] The fifth object of the present invention is to provide the use of any of the products or the methods described in claim 6 or 7 in molecular breeding of tea trees.

[0015] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0016] The present invention claims protection for a product for evaluating the length-to-width ratio of fresh tea leaves, wherein the product detects the genotype of a SNP located at the Chr01:22487501 site of the tea tree genome. When the genotype of the individual tea tree is GG or AG, the leaf length-to-width ratio is likely to be low; when the genotype of the individual tea tree is AA, the tea leaf length-to-width ratio is likely to be high, and the tea tree genome is the Tieguanyin genome.

[0017] That is, the site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO:1.

[0018] Preferably, the product is a kit.

[0019] More preferably, the kit contains primers with nucleotide sequences as shown in SEQ ID NOs: 2-3.

[0020] Primer F: GCGTAATTTCTACACTAAAGGTAGGC (SEQ ID NO: 2);

[0021] Primer R: GTGGAGAAATACAATAAGATTGTGGTC (SEQ ID NO: 3).

[0022] More preferably, it also contains a PCR amplification reagent.

[0023] Preferably, the product is a primer with a nucleotide sequence as shown in SEQ ID NO: 2-3.

[0024] As a specific embodiment, a kit for evaluating the aspect ratio of fresh tea leaves comprises

[0025] Primers with nucleotide sequences as shown in SEQ ID NO: 2-3, 2×Taq PCR Master Mix, and ddH2O.

[0026] The present invention also claims protection for a method for evaluating the length-to-width ratio of fresh tea leaves, which detects the genotype of a SNP located at the Chr01:22487501 site of the tea tree genome. When the genotype of the individual tea tree is GG or AG, it is likely that the leaf length-to-width ratio is low; when the genotype of the individual tea tree is AA, it is likely that the tea leaf length-to-width ratio is high, and the tea tree genome is the Tieguanyin genome.

[0027] Preferably, primers having nucleotide sequences as shown in SEQ ID NOs: 2-3 are used for detection.

[0028] As a specific embodiment, the following steps are included:

[0029] (1) Extracting total DNA from tea plants and ensuring that the A260 / A280 ratio of each DNA sample is between 1.8 and 2.0 and the concentration is greater than 100 μg / μL;

[0030] (2) PCR amplification

[0031] The PCR system (10 μl) is as follows:

[0032] 2×Taq PCR Master Mix 5μl Primers (SEQ ID NO: 2 and 3) 0.5 μl each DNA template 1μl <![CDATA[ddH2O]]> 3μl

[0033] The PCR amplification procedure is as follows:

[0034]

[0035] (3) Product purification

[0036] The PCR amplification product was subjected to gel electrophoresis and then recovered and purified.

[0037] (4) Sequencing and result interpretation

[0038] The recovered purified product was sequenced by Sanger method, and the sequencing result was compared with the nucleotide sequence shown in SEQ ID NO: 1. The Chr01: 22487501 site was located at the 101st base of the amplified product. Statistically speaking, when the genotype is wild type GG or single mutation AG, the length-to-width ratio of the tea leaves is likely to be low; when the double mutation AA is performed, the length-to-width ratio of the tea leaves is likely to be high.

[0039] The present invention also claims to protect the use of a product for detecting the genotype of a SNP located at Chr01:22487501 site of a tea plant genome in establishing a method for evaluating the length-width ratio of fresh tea leaves, wherein the tea plant genome is a Tieguanyin genome.

[0040] And, use of a product for detecting the genotype of a SNP located at Chr01:22487501 site in a tea plant genome in establishing a kit for evaluating the length-width ratio of fresh tea leaves, wherein the tea plant genome is a Tieguanyin genome.

[0041] It is further claimed to protect the use of any of the products or methods described in molecular breeding of tea trees, wherein the molecular breeding of tea trees is the selection of the length-to-width ratio of fresh leaves of tea trees.

[0042] Compared with the prior art, the present invention has the following beneficial effects:

[0043] The present invention discloses a SNP molecular marker site linked to the quantitative trait of the length-to-width ratio of tea leaves, which is located on the tea genome Chr01: 22487501. Its genotype is significantly correlated with the leaf length-to-width ratio, and the leaf length-to-width ratio corresponding to the AA genotype is significantly different from that of the GG and AG types. Statistically speaking, when the genotype is wild-type GG or single mutation AG, it is highly likely that the tea leaf length-to-width ratio is low; when the genotype is double mutation AA, it is highly likely that the tea leaf length-to-width ratio is high. Further, a detection method for detecting this site is established, which can be used to evaluate the length-to-width ratio of tea leaves, so as to be further used in tea resource screening and molecular breeding. It can be used as a basis for conducting molecular marker-assisted selection breeding of tea trees. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Leaf length-width ratio in 259 accessions from all populations for genome-wide association analysis.

[0045] Figure 2 Schematic diagram of Chr01:22487501 site and primers, N (highlighted with a yellow background) represents the base to be tested at the Chr01:22487501 position, and the bold and underlined parts are the upstream and downstream primers.

[0046] Figure 3 In the association analysis population, the Chr01:22487501 genotype was significantly correlated with the leaf length-to-width ratio.

[0047] Figure 4 The Chr01:22487501 genotype is also significantly correlated with the leaf length-to-width ratio in the test population. Statistically speaking, when the genotype is wild-type GG or single mutation AG, the tea leaf length-to-width ratio is likely to be low; when it is double mutation AA, the tea leaf length-to-width ratio is likely to be high. DETAILED DESCRIPTION

[0048] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0049] Example 1 SNP sites associated with fresh leaf length-width ratio in the tea plant genome

[0050] 1. Experimental Sample

[0051] 259 tea tree materials were collected from the Tea Germplasm Resource Bank of the Tea Research Institute of Fujian Academy of Agricultural Sciences (Fu'an, Fujian, 27°N, 119°E), including 112 from Fujian, 34 from Zhejiang, 21 from Guizhou, 15 from Yunnan, 14 from Guangdong, 13 from Guangxi, 11 from Hunan, 7 from Sichuan, 6 from Anhui, 3 from Hubei, 2 from Taiwan, 2 from Shandong, 2 from Jiangxi, 2 from Chongqing, 1 from Shaanxi, 1 from Jiangsu, 1 from Henan, and 1 from Gansu. In addition, there were 5 from Vietnam, 2 from Myanmar, 1 from Sri Lanka, 1 from Kenya, 1 from Japan, and 1 from Georgia. The selected materials are widely representative.

[0052] The selected tea tree resources are randomly distributed in the resource library. Double-row single-plant planting is adopted, with each row of 4 meters, row spacing of 1.5m, and plant spacing of 35cm. The resource library carries out routine water and fertilizer management. At the end of 2022, the resources are pruned and deep pit basal fertilizer is applied, 4 tons of organic fertilizer, 0.75 tons of peanut bran and 10 kilograms of compound fertilizer per mu. After the spring tea and summer tea in 2023, pruning and foliar topdressing are carried out, 30 kilograms of compound fertilizer and 60 kilograms of urea per mu. In May 2023, the mature leaves of the tea trees are picked for leaf length-width ratio determination.

[0053] 2. Determination of the length-width ratio of fresh tea leaves

[0054] 1. Experimental methods

[0055] The length and width of mature leaves of the current year's tea trees were measured using a ruler, and the leaf length was divided by the leaf width to obtain the leaf length-to-width ratio. The length-to-width ratio of each accession was derived from the average value of no less than 30 leaves.

[0056] 2. Experimental results

[0057] The leaf length-width ratio is shown in Table 1. The variation of leaf length-width ratio among populations is shown in Figure 1 .

[0058] Table 1 Determination results of length-width ratio of fresh leaves of 259 tea germplasms

[0059]

[0060]

[0061]

[0062]

[0063] 3. Correlation analysis between genotype and length and width of fresh tea leaves

[0064] 1. Experimental methods

[0065] The total DNA of 259 tea tree resources was extracted by CTAB method, and the A260 / A280 of each DNA sample was between 1.8 and 2.0, and the concentration was greater than 100 μg / μL. The extracted DNA samples were used to construct a sequencing library with a fragment length of 500 bp, and double-end 150 bp sequencing was performed using the DNBSEQ-T7 platform. The reads after sequencing were aligned to the "Tieguanyin" CSS cultivated tea tree genome (http: / / tpia.teaplants.cn / ; Tieguanyin, TGY, PMID: 34267370) using bwa software. The whole genome single nucleotide variation (SNP) of 259 germplasms was detected using GATK (https: / / github.com / broadinstitute / gatk), and the whole genome SNPs and shape were analyzed by genome-wide association analysis (GWAS) using rMVP.

[0066] 2. Experimental results

[0067] The significance level of the association is determined by the P value, and the p value less than 1.0E-05 is considered significant. Figure 3 As shown, the P value of the SNP site located at Chr01: 22487501 was 4.53E-08, much smaller than 1.0E-05, and its genotype was significantly associated with the leaf length-width ratio.

[0068] From a statistical point of view, when the genotype of the tea tree individual is GG or AG, it is likely to show a low leaf length-to-width ratio; when the genotype of the tea tree individual is AA, it is likely to show a high leaf length-to-width ratio. Example 2 Correlation between the genotype of the tea tree SNP site (Chr01: 22487501) and the fresh leaf length-to-width ratio

[0069] 1. Experimental Sample

[0070] A group of 139 tea germplasm resources, including 15 germplasms from Jiangbei tea industry area, 30 germplasms from Jiangnan tea industry area, 45 germplasms from South China tea industry area, 45 germplasms from Southwest tea industry area, and 4 foreign germplasms. All germplasms were uniformly planted at the Tea Research Institute of Guangdong Academy of Agricultural Sciences. They were used to detect the genotype of the SNP site located at Chr01:22487501 and the length-to-width ratio of mature tea leaves, and to conduct correlation analysis.

[0071] 2. Experimental Methods

[0072] 1. Check the leaf aspect ratio of the sample

[0073] The detection method is the same as in Example 1.

[0074] 2. Detection of the genotype of the tea tree SNP locus (Chr01: 22487501)

[0075] The sanger sequencing technology platform was used to detect the genotype of the Chr01:22487501 SNP site of each sample.

[0076] (1) Primer design

[0077] Primers were designed and synthesized based on the location of Chr01: 22487501 in the genome. Among them, Chr01: 22487501 extended 200 bp upstream and 150 bp downstream. Its nucleotide sequence is shown in SEQ ID NO: 1 ( Figure 2 , where N represents the base to be tested at position Chr01:22487501).

[0078] PCR Primers:

[0079] F: GCGTAATTTCTACACTAAAGGTAGGC (SEQ ID NO: 2);

[0080] R: GTGGAGAAATACAATAAGATTGTGGTC (SEQ ID NO: 3).

[0081] (2) PCR amplification

[0082] The PCR system (10 μl) is as follows:

[0083] 2×Taq PCR Master Mix 5μl PrimerMix (matched according to amplification conditions) 1μl DNA template 1μl <![CDATA[ddH2O]]> 3μl

[0084] The PCR amplification procedure is as follows:

[0085]

[0086] (3) Gel electrophoresis verification and extraction of PCR products

[0087] The PCR amplification products are analyzed by gel electrophoresis to confirm whether the target fragment is successfully amplified. The size of the PCR product is determined by comparison with molecular weight markers. The PCR product is extracted from the gel for subsequent Sanger sequencing.

[0088] (4) Sanger sequencing

[0089] The PCR product was sequenced using Sanger sequencing technology. Amplification primers (SEQ ID NO: 2 and SEQ ID NO: 3) were selected for reverse and forward sequencing, respectively, to increase the accuracy of sequencing.

[0090] (5) Analysis of sequencing results

[0091] The sequence data obtained by sequencing is compared with the reference sequence to check whether there is a base difference at the target mutation site. The genotype of the target site is determined by analyzing the peak map.

[0092] 3. Use T-test to test the correlation between genotype and fresh leaf length-width ratio quality inspection

[0093] 3. Experimental Results

[0094] The leaf length-width ratio of each sample and the genotype of the SNP locus Chr01:22487501 are shown in Table 2.

[0095] Table 2 Verification of resource leaf length-width ratio and genotype in the population:

[0096]

[0097]

[0098]

[0099]

[0100] The results of significance analysis showed that Figure 4As shown, the genotype of Chr01: 22487501 is extremely significantly correlated with the leaf length-width ratio. Statistically, when the sample genotype is double mutation AA, the genotype with a high probability of tea leaf length-width ratio higher than the normal average level is the wild type GG or single mutation AG sample. This result is consistent with the result of Example 1, indicating that Chr01: 22487501 can be used to evaluate the leaf length-width ratio of tea trees, and further used for high leaf length-width ratio tea tree resource screening and molecular breeding, which has great research value.

[0101] Example 3 A method for evaluating the aspect ratio of fresh tea leaves

[0102] (1) The total DNA of tea plant buds was extracted using the CTAB method, and the A260 / A280 of each DNA sample was ensured to be between 1.8 and 2.0, and the concentration was greater than 100 μg / μL;

[0103] (2) PCR amplification

[0104] The PCR system (10 μl) is as follows:

[0105] 2×Taq PCR Master Mix 5μl Primers (SEQ ID NO: 2 and 3) 0.5 μl each DNA template 1μl <![CDATA[ddH2O]]> 3μl

[0106] The PCR amplification procedure is as follows:

[0107]

[0108] (3) Product purification

[0109] The PCR amplification product was subjected to gel electrophoresis and then recovered and purified using a commercially available gel electrophoresis DNA recovery kit.

[0110] (4) Sequencing and result interpretation

[0111] The recovered purified product was sent to a sequencing company for Sanger sequencing, and the sequencing result was compared with the nucleotide sequence shown in SEQ ID NO: 1. Figure 2 As shown (the bold and underlined parts are the upstream and downstream primers, and N represents the base to be tested at the Chr01:22487501 position), the Chr01:22487501 site is located at the 101st base of the amplified product. Statistically speaking, when the genotype is wild-type GG or single mutation AG, the length-to-width ratio of the tea leaves is likely to be low; when the genotype is double mutation AA, the length-to-width ratio of the tea leaves is likely to be high.

[0112] Example 4 A kit for evaluating the aspect ratio of tea leaves

[0113] 1. Composition

[0114] Primers with nucleotide sequences as shown in SEQ ID NO: 2-3, 2×Taq PCR Master Mix, and ddH2O.

[0115] Among them, primer F: GCGTAATTTCTACACTAAAGGTAGGC (SEQ ID NO: 2);

[0116] Primer R: GTGGAGAAATACAATAAGATTGTGGTC (SEQ ID NO: 3).

[0117] 2. Usage

[0118] Same as Example 3.

Claims

1. A method for evaluating the aspect ratio of fresh tea leaves, characterized in that: The genotype of the SNP site located in Chr01: 22487501 of the tea tree genome is detected, wherein the SNP site is located in the 200th base of the nucleotide sequence shown in SEQ ID NO: 1, and the length-to-width ratio of fresh leaves of tea tree individuals with genotype AA is highly likely to be higher than that of tea tree individuals with genotype GG or AG, and the tea tree genome is the Tieguanyin genome.

2. The method according to claim 1, characterized in that The detection was performed using primers having nucleotide sequences as shown in SEQ ID NOs: 2-3.

3. Use of a reagent for detecting the genotype of the SNP locus described in claim 1 in establishing a method for evaluating the length-to-width ratio of fresh tea leaves, characterized in that: The length-to-width ratio of fresh leaves of tea tree individuals with genotype AA is likely to be higher than that of tea tree individuals with genotype GG or AG.

4. Use of a reagent for detecting the genotype of the SNP locus described in claim 1 in preparing a kit for evaluating the aspect ratio of fresh tea leaves, characterized in that: The length-to-width ratio of fresh leaves of tea tree individuals with genotype AA is likely to be higher than that of tea tree individuals with genotype GG or AG.

5. Use of a reagent for detecting the genotype of the SNP site described in claim 1 in tea plant molecular breeding, characterized in that: The tea tree molecular breeding is the selection of the length-width ratio of fresh leaves of the tea tree.

6. The use according to any one of claims 3 to 5, characterized in that: The reagent is a primer with a nucleotide sequence as shown in SEQ ID NO: 2-3.

7. Application of the method according to any one of claims 1 to 2 in tea plant molecular breeding, characterized in that: The tea tree molecular breeding is the selection of the length-width ratio of fresh leaves of the tea tree.

Images