Rice OsMED23 gene, its encoded protein and its application

Abstract

The present invention relates to a rice OsMED23 gene, a protein encoded therein and an application thereof. The present invention provides an OsMED23 gene for regulating rice plant type, wherein the nucleotide sequence of the OsMED23 gene is shown in SEQ ID No.2 or SEQ ID No.3, and the amino acid sequence of the protein encoded therein is shown in SEQ ID No.1. The present invention clones a new gene OsMED23 for regulating rice plant type. The OsMED23 gene functional deletion mutant exhibits characteristics such as reduced plant height, increased tillering, shorter and thinner stems, upright leaves, smaller panicle type, reduced fruit setting rate, reduced grain width and thickness, and reduced thousand-grain weight, indicating that the OsMED23 gene has application value in regulating rice plant type, for example, it has important value in breeding rice with good stress resistance and excellent yield and quality traits.

Description

Technical Field

[0001] The invention relates to the technical field of plant gene engineering and rice molecular genetic breeding, and in particular to the cloning and application of the mediator subunit OsMED23 gene for regulating rice plant type. Background Art

[0002] In 2006, Roger D. Kornberg et al. published the structure and function of the Mediator-Pol II complex and proposed the view that the Mediator complex is involved in the translation of various genetic materials. In the same year, the Nobel Prize in Chemistry announcement stated that "the discovery of Mediator is a real milestone in understanding the transcription process." To date, many scientists have discovered that different structures of Mediator subunit complexes are involved in the transcription of eukaryotic genes in plants, animals and even eukaryotic microorganisms.

[0003] The Mediator subunit is a highly evolutionarily conserved macromolecular protein complex that can form a complex with multiple protein subunits in eukaryotes that has an important impact on the rice regulatory network. The Mediator subunit complex is an important auxiliary factor in the RNA polymerase II transcription apparatus, and its conservation indicates that it helps to enhance the complexity of transcriptional regulation in eukaryotes. Specifically, the Mediator subunit complex is a bridge between specific transcription factors and RNA polymerase II to transmit information. It is essential for the transcription of almost all genes in eukaryotes and is called the "central controller" of eukaryotic gene transcription.

[0004] Rice (Oryza sativa L.) is one of the most important food crops in China and even in the world. Therefore, the improvement of traits related to rice yield has an important impact on the production and yield of food crops. Among them, the mediator subunit complex that affects rice gene transcription is a research focus.

[0005] With the isolation and identification of mediator subunits in plants, phenotypic analysis caused by the loss of function of mediator subunit genes revealed that the loss of function of different mediator subunit genes led to different phenotypic variations in plant growth and development, indicating that mediator subunits are indispensable in the developmental regulation of plants and are involved in various growth and development stages of plants.

[0006] At present, the research on plant mediator subunits is mainly concentrated in the model plant Arabidopsis thaliana. Arabidopsis mediator subunits play an important role in regulating various developmental processes, plant hormone signaling pathways, transitions in developmental stages, and biotic and abiotic stress processes in plants. Patent application with publication number CN110305875A discloses a rice mediator subunit OsMED25 gene. Rice mediator subunit OsMED25 participates in the rice BR signaling pathway. Rice mediator subunit OsMED25 is used to regulate rice leaf angle and regulate the expression of rice BR synthesis genes.

[0007] However, there are relatively few studies on the functions of rice mediator subunits. Therefore, mining the gene resources of rice mediator subunits is still an important direction in rice molecular genetic breeding research and has important practical application value.

[0008] In addition, on the one hand, there are differences in understanding among those skilled in the art; on the other hand, the applicant studied a large number of documents and patents when making the present invention, but due to space limitations, not all details and contents are listed in detail. However, this does not mean that the present invention does not have the characteristics of these prior arts. On the contrary, the present invention already has all the characteristics of the prior art, and the applicant reserves the right to add relevant prior art to the background technology. Summary of the invention

[0009] Plant type is usually defined as the three-dimensional structure of the aboveground part of a plant, which includes traits that affect the structural morphology of the aboveground part of the plant, such as plant height, number of tillers, leaf shape, ear shape, grain shape, stem shape, and leaf angle.

[0010] Plant type is a complex of many agronomic traits, which directly affects and determines the yield of crops. In the evolution and improvement of crops, reasonable plant type has always been the main selection direction for high-yield breeding. Understanding the genetic mechanism of plant type will help to cultivate new high-yield and high-quality crop varieties. The study of rice plant type functional genes has important theoretical and guiding significance for rice plant type molecular design breeding, and many plant type genes have been applied to the specific practice of rice breeding, making significant contributions to the improvement of rice plant type and the increase of yield. Therefore, exploring new genes that regulate rice plant type is of great significance to improving rice yield and clarifying the laws of plant growth and development. The present invention successfully cloned the rice gene OsMED23 encoding the mediator subunit at the molecular level for the first time, and found that the mediator subunit encoded by the gene OsMED23 has a significant effect on the rice plant type through the exploration of the phenotypes of mutants and gene knockout strains.

[0011] Based on this, one aspect of the present invention relates to the use of mediator subunit OsMED23 in regulating rice plant type, panicle type or grain type. The amino acid sequence of mediator subunit OsMED23 is shown in SEQ ID No. 1. The amino acid sequence of mediator subunit OsMED23 can be generated by adding, replacing, inserting, deleting one or more amino acids in the amino acid sequence shown in SEQ ID No. 1 or by homologous sequences of other species to generate an amino acid sequence or derivative.

[0012] According to a preferred embodiment, the nucleotide sequence encoding the mediator subunit OsMED23 is shown in SEQ ID No. 2 or SEQ ID No. 3. The nucleotide sequence of the OsMED23 gene can generate mutants, alleles or derivatives by adding, substituting, inserting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 3.

[0013] According to a preferred embodiment, the rice plant type includes plant height, number of tillers, single-node stem length and leaf angle.

[0014] According to a preferred embodiment, the rice panicle type includes panicle length, primary branch length, secondary branch length, single plant fruit setting rate and total number of grains per panicle.

[0015] According to a preferred embodiment, the rice grain shape includes grain width, grain thickness and thousand-grain weight.

[0016] Another aspect of the present invention relates to an ornamental rice. In 2007, Zhao Zesheng first proposed ornamental rice in "Research and Utilization of Special Rice", and colored rice, as a unique variety, has gradually been known by more and more people. The plant type of ornamental rice is improved in that it is colorful, dwarfed and clumping, that is, the leaves and / or grains have different colors, the plant height is reduced, and the number of tillers is increased.

[0017] Based on this, another aspect of the present invention relates to the use of the mediator subunit OsMED23 in improving the plant type of ornamental rice. Preferably, the purpose of dwarfing and clumping of ornamental rice is achieved by down-regulating the expression of the OsMED23 gene in rice, down-regulating the expression of the mediator subunit OsMED23 in rice, or reducing the activity of the mediator subunit OsMED23 in rice.

[0018] Lodging refers to the phenomenon that upright-growing crops become crooked in patches or even fall to the ground. Lodging can reduce the yield and quality of crops and make harvesting difficult. When rice lodges severely, its yield can even be reduced by more than half. Lodging mostly occurs in the middle and late stages of crop growth. The earlier rice, wheat and other cereal crops lodge after jointing, the greater the loss. In 1993, the National Committee for the Examination of Scientific and Technological Terms approved and announced that lodging resistance is an agricultural term.

[0019] The improvement direction of rice lodging resistance traits includes plant height (dwarfing reduces the impact of external stress on plants) and stems (increasing the hardness and toughness of crop stems to increase the ability of plants to resist external stress). The present invention has found through relevant experimental studies that down-regulating the expression of the OsMED23 gene in rice or down-regulating the expression of the mediator subunit OsMED23 in rice can significantly reduce the plant height of rice.

[0020] Based on this, another aspect of the present invention relates to a method for reducing plant height or improving plant lodging resistance. The method comprises the following steps:

[0021] Down-regulating the expression of OsMED23 gene in rice,

[0022] or down-regulating the expression of the protein encoded by the OsMED23 gene in rice,

[0023] Or reduce the activity of the protein encoded by the OsMED23 gene in rice.

[0024] According to a preferred embodiment, the method for down-regulating the expression level of the OsMED23 gene in rice, down-regulating the expression level of the protein encoded by the OsMED23 gene in rice, or reducing the activity of the protein encoded by the OsMED23 gene in rice comprises:

[0025] The nucleotide 1078 of the OsMED23 gene was mutated from G to T.

[0026] Or an A base was added at nucleotide position 181 of the OsMED23 gene.

[0027] According to a preferred embodiment, the method for down-regulating the expression level of the OsMED23 gene in rice, down-regulating the expression level of the protein encoded by the OsMED23 gene in rice, or reducing the activity of the protein encoded by the OsMED23 gene in rice comprises:

[0028] The OsMED23 gene or an expression construct / vector containing the OsMED23 gene is introduced into plants.

[0029] For example, an engineering vector containing the OsMED23 gene is constructed as described in the examples and introduced into rice to form transgenic rice, or a plant containing the OsMED23 gene or a plant expressing a high level of the protein encoded by the gene is used as a parent for hybridization.

[0030] One aspect of the present invention relates to a method for increasing the yield or biomass of a plant. The method comprises the following steps:

[0031] Up-regulating the expression of OsMED23 gene in rice,

[0032] or up-regulating the expression of the protein encoded by the OsMED23 gene in rice,

[0033] Or increase the activity of the protein encoded by the OsMED23 gene in rice.

[0034] According to a preferred embodiment, the method for up-regulating the expression level of the OsMED23 gene in rice, up-regulating the expression level of the protein encoded by the OsMED23 gene in rice, or increasing the activity of the protein encoded by the OsMED23 gene in rice comprises gene knockout, RNA interference or natural variant screening.

[0035] The present invention also provides a recombinant vector comprising the aforementioned OsMED23 gene for regulating rice plant type. Preferably, the basic vector of the recombinant vector comprises a prokaryotic expression vector and / or a eukaryotic expression vector. More preferably, the recombinant vector comprises a binary Agrobacterium vector or a vector that can be used for plant gene gun bombardment, such as pCAMBIA3301, pCAMBIA2300, pCAMBIA2301, pCAMBIA1300, pCAMBIA1301, pWM101, pGreen0029, pBI121, pBin19, pCAMBIA1301-UbiN, etc. or other derived plant expression vectors. More preferably, the recombinant vector can use an enhancer, including a translation enhancer or a transcription enhancer, and these enhancer regions can be an ATG start codon (in the reading frame of the coding sequence) or an adjacent region start codon (in the reading frame of the coding sequence), etc.

[0036] The recombinant vector can use a gene encoding an enzyme or luminescent compound that is expressed in plants and produces a color change, an antibiotic resistance marker, or a chemical resistance marker gene to screen positive plants.

[0037] The OsMED23 gene comprises a 5'UTR, 21 exons, 20 introns and a 3'UTR. Preferably, the recombinant vector may comprise an exon sequence, which may also comprise an intron. Preferably, the recombinant vector comprises the 21 exons of the OsMED23 gene. Preferably, the recombinant vector comprises the 21 exons of the OsMED23 gene and the 20 introns of the OsMED23 gene. Preferably, the recombinant vector comprises the 21 exons of the OsMED23 gene and the 5'UTR of the OsMED23 gene. Preferably, the recombinant vector comprises the 21 exons of the OsMED23 gene and the 3'UTR of the OsMED23 gene.

[0038] The method for introducing the recombinant vector into plants can specifically be Agrobacterium-mediated method, gene gun method, electric shock method, pollen tube introduction method, liposome fusion method and any other method that can introduce plasmids to transform plant cells or tissues.

[0039] Another aspect of the present invention provides a recombinant cell comprising the aforementioned OsMED23 gene for regulating rice plant type.

[0040] Another aspect of the present invention provides the use of the aforementioned OsMED23 gene for regulating rice plant type, the protein encoded by the aforementioned OsMED23 gene for regulating rice plant type, the aforementioned recombinant vector or the aforementioned recombinant cell in improving rice plant type. Preferably, the improvement is achieved by inhibiting or reducing the expression of the OsMED23 gene in rice.

[0041] Another aspect of the present invention provides the use of the aforementioned OsMED23 gene for regulating rice plant type, the protein encoded by the aforementioned OsMED23 gene for regulating rice plant type, the aforementioned recombinant vector or the aforementioned recombinant cell in improving rice plant type. Preferably, the improvement is achieved by inhibiting or reducing the expression of the OsMED23 gene in rice.

[0042] Another aspect of the present invention provides the use of the aforementioned OsMED23 gene for regulating rice plant type, the protein encoded by the aforementioned OsMED23 gene for regulating rice plant type, the aforementioned recombinant vector or the aforementioned recombinant cell in improving rice stalks. Preferably, the improvement is achieved by inhibiting or reducing the expression of the OsMED23 gene in rice.

[0043] Another aspect of the present invention provides the use of the aforementioned OsMED23 gene for regulating rice plant type, the protein encoded by the aforementioned OsMED23 gene for regulating rice plant type, the aforementioned recombinant vector, the aforementioned plant cell transformation vector or the aforementioned recombinant cell in improving the number of rice tillers. Preferably, the improvement is achieved by inhibiting or reducing the expression of the OsMED23 gene in rice.

[0044] Another aspect of the present invention provides the use of the aforementioned OsMED23 gene for regulating rice plant type, the protein encoded by the aforementioned OsMED23 gene for regulating rice plant type, the aforementioned recombinant vector or the aforementioned recombinant cell in improving the rice stalk phenotype. Preferably, the improvement is achieved by inhibiting or reducing the expression of the OsMED23 gene in rice.

[0045] Another aspect of the present invention provides the use of the aforementioned OsMED23 gene for regulating rice plant type, the protein encoded by the aforementioned OsMED23 gene for regulating rice plant type, the aforementioned recombinant vector or the aforementioned recombinant cell in improving rice leaf pillow.

[0046] Another aspect of the present invention provides the use of the aforementioned OsMED23 gene for regulating rice plant type, the protein encoded by the aforementioned OsMED23 gene for regulating rice plant type, the aforementioned recombinant vector or the aforementioned recombinant cell in improving the angle of rice leaves. Preferably, the improvement is achieved by inhibiting or reducing the expression of the OsMED23 gene in rice.

[0047] In another aspect, the present invention also provides the use of the aforementioned OsMED23 gene for regulating rice plant type, the protein encoded by the aforementioned OsMED23 gene for regulating rice plant type, the aforementioned recombinant vector or the aforementioned recombinant cell in improving rice panicle type. Preferably, panicle type includes panicle length, total number of grains per panicle and fruit setting rate. Preferably, the improvement is achieved by inhibiting or reducing the expression of the OsMED23 gene in rice.

[0048] In another aspect, the present invention also provides the use of the aforementioned OsMED23 gene for regulating rice plant type, the protein encoded by the aforementioned OsMED23 gene for regulating rice plant type, the aforementioned recombinant vector or the aforementioned recombinant cell in improving rice grain type. Preferably, grain type includes grain width and thousand-grain weight. Preferably, the improvement is achieved by inhibiting or reducing the expression of the OsMED23 gene in rice.

[0049] Another aspect of the present invention provides a method for improving the stress resistance of rice, which utilizes gene editing technology to inhibit the expression of the OsMED23 gene or reduce the expression level of the OsMED23 gene.

[0050] Another aspect of the present invention provides a method for improving the stress resistance of rice, which utilizes gene knockout, RNA interference or natural variants to downregulate the expression level of the OsMED23 gene, thereby reducing the plant height of rice and thereby increasing the lodging resistance of rice.

[0051] Preferably, the aforementioned method for improving the stress resistance of rice is to reduce the leaf angle of rice by inhibiting the expression of OsMED23 gene or reducing the expression level of OsMED23 gene.

[0052] Preferably, the method for improving the stress resistance of rice mentioned above inhibits the expression of OsMED23 gene or reduces the expression level of OsMED23 gene to reduce the internode length of rice stem, thereby increasing the lodging resistance of rice.

[0053] Another aspect of the present invention provides the use of the aforementioned OsMED23 gene for regulating rice plant type or the protein encoded by the aforementioned OsMED23 gene for regulating rice plant type in breeding rice with excellent yield and / or lodging resistance.

[0054] Another aspect of the present invention provides use of a nucleotide sequence encoding the mediator subunit OsMED23 in genetic engineering design, wherein the nucleotide sequence is shown as SEQ ID No. 2 or SEQ ID No. 3.

[0055] On the other hand, the present invention also provides the use of the mediator subunit OsMED23 to regulate one or more of the rice panicle shape, rice grain shape, plant height, tiller number, single-node stem length or leaf angle of rice.

[0056] The present invention also provides transgenic rice containing the OsMED23 gene. The present invention provides a transgenic rice, comprising a gene encoding the mediator subunit OsMED23, the nucleotide sequence of the gene being shown as SEQ ID No. 2 or SEQ ID No. 3. The present invention provides an improved rice, comprising a mutated OsMED23 gene, wherein the mutation comprises mutating the nucleotide at position 1078 of the OsMED23 gene from G to T, or adding a base A at the nucleotide at position 181 of the OsMED23 gene target site.

[0057] The present invention also provides a gene editing composition for regulating rice growth, comprising a sgRNA targeting the OsMED23 gene and a recombinant vector for knocking out the OsMED23 gene.

[0058] The present invention also provides a gene expression composition, comprising an expression construct or vector, wherein the construct or vector comprises a gene sequence encoding the mediator subunit OsMED23 as shown in SEQ ID No. 2 or SEQ ID No. 3. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 It is the plant height and tillering phenotype of mutant lk20, among which, A: comparison of plant height between wild type R600 and mutant lk20 at seedling stage; B: comparison of plant height between wild type R600 and mutant lk20 at tillering stage; C: comparison of plant height between wild type R600 and mutant lk20 at jointing and booting stage; D: comparison of plant height between wild type R600 and mutant lk20 at heading stage; E: comparison of plant height between wild type R600 and mutant lk20 at full heading stage; F: comparison of plant height between wild type R600 and mutant lk20 at maturity stage; G: weekly plant height change trend between wild type R600 and mutant lk20 after transplanting; H: comparison of effective tiller number between wild type R600 and mutant lk20 at maturity stage;

[0060] Figure 2 It is the phenotype of the mutant lk20 at the mature stage, where A: comparison of the stems of wild-type R600 and mutant lk20; B: comparison of the length of each internode of the stems of wild-type R600 and mutant lk20; C: comparison of the cross-section diameter of the middle of each internode of the stems of wild-type R600 and mutant lk20; D: statistics of the stem length of wild-type R600 and mutant lk20; E: statistics of the length of each internode of the stems of wild-type R600 and mutant lk20; F: statistics of the cross-section diameter of the middle of each internode of the stems of wild-type R600 and mutant lk20;

[0061] Figure 3The leaves of mutant lk20 are upright phenotypes, including A: comparison of leaf angles of wild-type R600 and mutant lk20 at maturity; B: pulvinus structure of wild-type R600; C: pulvinus structure of mutant lk20; D: statistics of leaf angles of wild-type R600 and mutant lk20 at maturity; E: statistics of adaxial and abaxial lengths of pulvinus of wild-type R600 and mutant lk20 at maturity; F: statistics of the ratio of adaxial length to abaxial length of pulvinus of wild-type R600 and mutant lk20;

[0062] Figure 4 is the panicle type of mutant lk20, among which, A: comparison of panicle length of wild type R600 and mutant lk20 at maturity; B: comparison of panicle type of wild type R600 and mutant lk20 at maturity; C: comparison of grains, full grains and empty grains per panicle of wild type R600 and mutant lk20 at maturity; D: statistics of panicle length of wild type R600 and mutant lk20 at maturity; E: statistics of primary branch length of wild type R600 and mutant lk20 at maturity; F: statistics of secondary branch number of wild type R600 and mutant lk20 at maturity; G: statistics of total number of grains per panicle of wild type R600 and mutant lk20 at maturity; H: statistics of fruit setting rate of wild type R600 and mutant lk20 at maturity;

[0063] Figure 5 It is the grain type of mutant lk20, where A: comparison of grain width between wild type R600 and mutant lk20; B: statistics of grain width between wild type R600 and mutant lk20; C: statistics of grain thickness between wild type R600 and mutant lk20; D: statistics of thousand-grain weight between wild type R600 and mutant lk20;

[0064] Figure 6 It is the genetic analysis and gene localization of mutant lk20, in which A: comparison of wild-type R600, F1 (LK20 / lk20) and mutant lk20 plant types; B: F2 phenotypic segregation statistics; C: mutant lk20 gene localization;

[0065] Figure 7 It is the plant height and tillering phenotype of knockout mutant KO, among which, A: comparison of plant height between wild-type ZH11 and knockout mutant KO at seedling stage; B: comparison of plant height between wild-type ZH11 and knockout mutant KO at tillering stage; C: comparison of plant height between wild-type ZH11 and knockout mutant KO at jointing and booting stage; D: comparison of plant height between wild-type ZH11 and knockout mutant KO at heading stage; E: comparison of plant height between wild-type ZH11 and knockout mutant KO at heading stage; F: comparison of plant height between wild-type ZH11 and knockout mutant KO at maturity stage; G: weekly plant height change trend between wild-type ZH11 and knockout mutant KO after transplanting; H: comparison of effective tiller number between wild-type ZH11 and knockout mutant KO at maturity stage;

[0066] Figure 8 It is the phenotype of the mature stem of the knockout mutant KO, where A: comparison of the stems of wild-type ZH11 and knockout mutant KO; B: comparison of the length of each internode of the stems of wild-type ZH11 and knockout mutant KO; C: comparison of the cross-section diameter of the middle of each internode of the stems of wild-type ZH11 and knockout mutant KO; D: statistics of the stem length of wild-type ZH11 and knockout mutant KO; E: statistics of the length of each internode of the stems of wild-type ZH11 and knockout mutant KO; F: statistics of the cross-section diameter of the middle of each internode of the stems of wild-type ZH11 and knockout mutant KO;

[0067] Fig. 9 It is the upright phenotype of the knockout mutant KO leaves, among which, A: comparison of leaf angles of wild-type ZH11 and knockout mutant KO at maturity; B: pulvinus structure of wild-type ZH11; C: pulvinus structure of knockout mutant KO; D: statistics of leaf angles of wild-type ZH11 and knockout mutant KO at maturity; E: statistics of adaxial and abaxial lengths of pulvinus of wild-type ZH11 and knockout mutant KO at maturity; F: statistics of the ratio of adaxial length to abaxial length of pulvinus of wild-type ZH11 and knockout mutant KO;

[0068] Fig.10 is the knockout mutant KO panicle type, among which, A: comparison of panicle length between wild-type ZH11 and knockout mutant KO at maturity; B: comparison of panicle type between wild-type ZH11 and knockout mutant KO at maturity; C: comparison of grains, filled grains and empty grains per panicle between wild-type ZH11 and knockout mutant KO at maturity; D: statistics of panicle length between wild-type ZH11 and knockout mutant KO at maturity; E: statistics of primary branch length between wild-type ZH11 and knockout mutant KO at maturity; F: statistics of secondary branch number between wild-type ZH11 and knockout mutant KO at maturity; G: statistics of total number of grains per panicle between wild-type ZH11 and knockout mutant KO at maturity; H: statistics of fruit setting rate between wild-type ZH11 and knockout mutant KO at maturity;

[0069] Fig.11 It is the grain shape of knockout mutant KO, among which, A: comparison of grain width between wild-type ZH11 and knockout mutant KO; B: statistics of grain width between wild-type ZH11 and knockout mutant KO; C: statistics of grain thickness between wild-type ZH11 and knockout mutant KO; D: statistics of thousand-grain weight between wild-type ZH11 and knockout mutant KO. DETAILED DESCRIPTION

[0070] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0071] The technical solution of the present invention is not limited to the specific implementation modes listed below, but also includes any combination of the specific implementation modes, which will be described in detail below with reference to the accompanying drawings.

[0072] The nucleotide sequence of the rice OsMED23 gene of the present invention is shown in SEQ ID NO: 2 or SEQ ID NO: 3. The nucleotide sequence of SEQ ID NO: 2 includes exons and introns. The nucleotide sequence of SEQ ID NO: 3 includes exons. The amino acid sequence of the rice mediator subunit OsMED23 of the present invention is shown in SEQ ID NO: 1.

[0073] Considering the role of conserved proteins in various eukaryotic organisms, the plants referred to in the present invention may be rice, rice subspecies or other grasses. Preferably, the rice varieties may be R600, Zhonghua 11, and Nipponbare. In this embodiment, a mutant lk20 with shorter plant height, upright leaves, smaller panicle type, and smaller grain type was screened from the mutant library of indica rice Shuhui 600 (R600) induced by ethyl methanesulfonate (EMS), and the gene was located using MutMap technology combined with co-segregation verification, and then the OsMED23 gene was knocked out and verified using CRISPR-Cas9 gene editing technology. The comprehensive use of forward genetics and reverse genetics methods verified that the OsMED23 gene plays an important role in regulating rice plant type.

[0074] In this example, a new gene OsMED23 for regulating rice plant type was cloned. The OsMED23 gene functional loss mutant showed the following characteristics: reduced plant height, increased tillering, shorter and thinner stems, upright leaves, smaller panicle type, reduced fruit setting rate (or seed setting rate), reduced grain width and thickness, and reduced thousand-grain weight, indicating that the OsMED23 gene has application value in regulating rice plant type.

[0075] In particular, after superior breeding and superior hybridization of the selected mutants, rice plants with dwarfing and other traits restored to normal can be obtained through the OsMED23 gene's participation in regulation, providing advantageous genetic resources for the optimization of the "ideal plant type" of rice. At the same time, the OsMED23 gene function explored in this application also enriches the molecular information library related to rice plant type / yield, and further clarifies the mechanism of the rich regulatory network between rice genes and traits.

[0076] Example 1

[0077] 1. Mutant creation

[0078] A mutant lk20 with shorter plant height, erect leaves, smaller panicle and smaller grain size was screened from the mutant library of indica rice Shuhui 600 (R600) induced by ethyl methanesulfonate (EMS). After continuous cultivation in Wenjiang, Sichuan and Lingshui, Hainan for many years, the mutant lk20 was phenotypically genetically stable.

[0079] 2. Phenotypic Identification of the lk20 Mutant

[0080] The mutant lk20 had reduced plant height and increased tillering. Figure 1 As shown. The mutant lk20 Figure 1 A) Tillering stage ( Figure 1 B) Jointing and Booting Stage ( Figure 1 C) Heading period ( Figure 1 D) Heading stage Figure 1 E) Maturity Figure 1 F) were significantly lower than the wild type R600. Every week after transplanting, the plant height of mutant lk20 was significantly lower than that of wild type R600 ( Figure 1 G), the number of effective tillers of the mutant lk20 at maturity was significantly greater than that of the wild type R600 ( Figure 1 H). Figure 1 In G, the height of wild-type R600 was 119.725 cm at the 10th week after transplantation, and the height of mutant lk20 was 100.725 cm. The height of wild-type R600 was 125.750 cm at the 12th week after transplantation, and the height of mutant lk20 was 109.475 cm. The height of wild-type R600 was 126.450 cm at the 14th week after transplantation, and the height of mutant lk20 was 109.625 cm.

[0081] The mutant lk20 has shorter stems, with each node becoming shorter and thinner. Figure 2 The total stem length of the mature mutant lk20 was significantly shorter than that of the wild type R600 ( Figure 2 A and 2D), the length and cross-sectional diameter of each node of the mature stem were measured. The results showed that the length of each internode of the mature mutant lk20 stem was significantly shorter than that of the wild type R600 ( Figure 2 B. Figure 2 E), the cross-section diameter of the middle of each internode was significantly shorter than that of wild type R600 ( Figure 2 C. Figure 2 F).

[0082] The asymmetric changes in the length of the adaxial (Ad) and abaxial (Ab) planes of the leaf occipital of the mutant lk20 lead to an upright leaf blade. Figure 3 As shown. The leaf angle of the mature mutant lk20 is significantly smaller than that of the wild type R600 ( Figure 3A, 3D). The size of the leaf angle depends largely on the structure of the pulvinus. The ratio of the adaxial surface to the abaxial surface is the reason for the difference in leaf angle. Further observation and measurement of the pulvinus revealed that the length of the adaxial surface of the pulvinus of the mutant lk20 was significantly smaller than that of the wild type R600 ( Figure 3 B, 3C, 3E), resulting in the ratio of the adaxial surface to the abaxial surface of the occipital of the mutant lk20 being significantly smaller than that of the wild-type R600 ( Figure 3 F), resulting in a smaller leaf angle. Figure 3 As shown in D, the leaf angle of the wild-type R600 at maturity is 20.10°, while the leaf angle of the mutant lk20 at maturity is 8.45°. Figure 3 As shown in E, the length of the adaxial surface of the leaf occipital of the mature wild-type R600 is 3.465 mm, the length of the adaxial surface of the leaf occipital of the mature mutant lk20 is 2.563 mm, the length of the abaxial surface of the leaf occipital of the mature wild-type R600 is 1.085 mm, and the length of the abaxial surface of the leaf occipital of the mature mutant lk20 is 1.307 mm. Figure 3 As shown in F, the ratio of the adaxial surface to the abaxial surface of the occipital of the wild-type R600 at the mature stage is 3.224, while the ratio of the adaxial surface to the abaxial surface of the occipital of the mutant lk20 at the mature stage is 1.969.

[0083] The mutant lk20 had smaller panicles and a lower fruiting rate. Figure 4 As shown. The ear length of the mature mutant lk20 is significantly smaller than that of the wild type R600 ( Figure 4 A. Figure 4 D), the length of the primary branch of mutant lk20 is significantly shorter than that of wild type R600 ( Figure 4 B. Figure 4 E), the number of secondary branches in mutant lk20 was significantly less than that in wild type R600 ( Figure 4 B. Figure 4 F), the total number of grains per ear and the fruit setting rate of mutant lk20 were significantly lower than those of wild type R600 ( Figure 4 C. Figure 4 G. Figure 4 H). Figure 4 As shown in D, the ear length of the wild-type R600 is 23.045 cm, and the ear length of the mature mutant lk20 is 21.655 cm. Figure 4 As shown in E, the length of the primary branch of the wild-type R600 is 13.965 cm, and the length of the primary branch of the mature mutant lk20 is 11.253 cm. Figure 4 As shown in F, the number of secondary branches of the wild type R600 is 114.525, while the number of secondary branches of the mature mutant lk20 is 81.675. Figure 4 As shown in G, the total number of grains per ear of the wild-type R600 is 522.867, while the total number of grains per ear of the mature mutant lk20 is 365.133. Figure 4 As shown in H, the fruit setting rate of the wild type R600 was 77.66%, and the fruit setting rate of the mature mutant lk20 was 34.793%.

[0084] The mutant lk20 had a smaller grain width and a lower thousand-grain weight. Figure 5 As shown. The grain width of mutant lk20 is significantly smaller than that of wild type R600 ( Figure 5 A. Figure 5 B), the thickness of mutant lk20 is significantly smaller than that of wild type R600 ( Figure 5 C), the thousand-grain weight of mutant lk20 was significantly less than that of wild type R600 ( Figure 5 D) Figure 5 As shown in B, the grain width of the wild-type R600 is 3.151 mm, and the grain width of the mature mutant lk20 is 2.791 mm. Figure 5 As shown in C, the grain thickness of wild-type R600 is 1.942 mm, and the grain thickness of mature mutant lk20 is 1.803 mm. Figure 5 As shown in D, the thousand-grain weight of the wild-type R600 is 24.464 g, and the thousand-grain weight of the mature mutant lk20 is 18.508 g.

[0085] 3. Genetic analysis, gene localization and cloning

[0086] Genetic analysis of mutant lk20, the results are as follows Figure 6 As shown: The wild-type R600 and the mutant lk20 were crossed to obtain F1 (LK20 / lk20). LK20 / lk20 is phenotypically the same as the wild-type R600 ( Figure 6 A); Subsequently, the F1 was self-pollinated to obtain the F2 population. The segregation ratio of the wild-type phenotype to the mutant phenotype in the F2 population was close to 3:1, which was consistent with Mendel's law of inheritance ( Figure 6 B) These results indicate that the gene controlling the mutant lk20 phenotype is a recessive nuclear gene.

[0087] Mutant lk20 gene localization: The gene localization was performed using MutMap technology combined with co-segregation verification. 40 mutant lk20 phenotypes in the F2 population were selected for mixed pool sequencing and compared with the wild-type R600 genome as a reference. The mutation site with a SNP index of 1 was co-segregated and verified. Finally, the mutation site was determined to be located in the coding region of the LOC_Os02g49992 gene on the long arm of chromosome 2. The nucleotide 1078 mutated from G to T, resulting in premature termination of translation ( Figure 6 C). Bioinformatics analysis revealed that the gene encodes a mediator subunit, OsMED23.

[0088] OsMED23 gene cloning: The total RNA of R600, Zhonghua 11 and Nipponbare was extracted using the Plant Total RNA Isolation Kit (Chengdu Fuji Biotechnology Co., Ltd., Catalog No. RE-05011), and cDNA was obtained by reverse transcription using the Master Premix (For qPCR) Kit [RT EasyTMII (WithgDNase), Chengdu Fuji Biotechnology Co., Ltd., Catalog No. RT-01031].

[0089] The obtained cDNA template was used to amplify the OsMED23 gene by forward primer (OsMED23-CDS-F: ATGGACGGGGCGCACGGG) and reverse primer (OsMED23-CDS-R: CTAAGATGGGTTTTGAACTAACTTGG). The PCR reaction conditions were as follows: 96°C pre-denaturation for 3 min; 96°C denaturation for 15 s, 56°C annealing for 20 s, 72°C extension for 3 min, for a total of 35 cycles; and then 72°C extension for 7 min. The PCR product was sequenced by Bio-Tech. The sequencing primers included:

[0090] OsMED23-CX1-R: GTCACCTCTAGCTGTCAGA;

[0091] OsMED23-CX2-F:CTTCAAATCCCACATCTCCA;

[0092] OsMED23-CX3-R:GTGTTGAAAGACCAAATCCG;

[0093] OsMED23-CX4-R: CTCTCCACGTTTGACTTTAAT;

[0094] OsMED23-CX5-F:CGCATTTTACGACATTAACAC;

[0095] OsMED23-CX6-F:TTCACCCGAAGAAGTTACAG;

[0096] OsMED23-CX7-R: AGAAGTGTGTGGAATTCTGG;

[0097] OsMED23-CX8-F:CACAGCAAGTGGAATCAATGC.

[0098] The sequencing results showed that in R600, Zhonghua 11 and Nipponbare, the OsMED23 gene consisted of 4863 bases, as shown in Table 1, with the sequence being SEQ ID NO:2 or SEQ ID NO:3, and encoded a protein with the amino acid sequence shown in SEQ ID NO:1.

[0099] Table 1

[0100]

[0101]

[0102]

[0103]

[0104] Example 2

[0105] Creation and phenotypic identification of knockout mutants of OsMED23 gene

[0106] In order to further confirm the function of OsMED23 gene in regulating rice plant type, this example uses CRISPR-Cas9 gene editing technology to knock out OsMED23 gene. According to the gene structure of OsMED23, a specific sgRNA target GCGGGTCGAGGATCCAACTAGGG was designed in the exon segment, a vector was constructed and genetically transformed into the japonica rice variety Zhonghua 11 (ZH11) by Agrobacterium-mediated method, and the target sequence of the knockout strain was amplified by PCR and sequenced to identify that the positive plant OsMED23-KO (KO) added a base A at the target position, causing an amino acid frameshift and terminating protein translation prematurely.

[0107] The knockout mutant KO had reduced plant height and increased tillering. Figure 7 As shown. The knockout mutant KO at the seedling stage ( Figure 7 A) Tillering stage ( Figure 7 B) Jointing and Booting Stage ( Figure 7 C) Heading period ( Figure 7 D) Heading stage Figure 7 E) Maturity Figure 7 F) were significantly lower than the wild-type ZH11, and the knockout mutant KO was significantly lower than the wild-type ZH11 ( Figure 7 G), the number of effective tillers of the mature knockout mutant KO was significantly higher than that of the wild type ZH11 ( Figure 7 H). Figure 7 As shown in G, the plant height of the wild-type ZH11 was 118.850 cm at 12 weeks after transplanting, and the plant height of the mutant KO was 103.575 cm at 12 weeks after transplanting.

[0108] The knockout mutant KO has shorter stems, with each node becoming shorter and thinner. Figure 8 The total stem length of the mature knockout mutant KO was significantly shorter than that of the wild type ZH11 ( Figure 8 A. Figure 8 D), the length and cross-sectional diameter of each node of the mature stem were measured, and the results showed that the length of each internode of the mature knockout mutant KO stem was significantly shorter than that of the wild-type ZH11 ( Figure 8 B. Figure 8 E), the cross-section diameter of the middle of each internode is significantly shorter than that of wild type ZH11 ( Figure 8 C. Figure 8 F).

[0109] The asymmetric changes in the length of the adaxial plane (Ad) and the abaxial plane (Ab) of the occipital of the knockout mutant KO caused the leaves to stand upright. Fig. 9 The leaf angle of the mature knockout mutant KO is significantly smaller than that of the wild type ZH11 ( Fig. 9 A. Fig. 9 D). The size of the leaf angle depends largely on the structure of the pulvinus. The ratio of the adaxial surface to the abaxial surface is the reason for the difference in leaf angle. Further observation and measurement of the pulvinus revealed that the length of the adaxial surface of the knockout mutant KO pulvinus was significantly smaller than that of the wild-type ZH11, and the length of the adaxial surface was significantly larger than that of the wild-type ZH11 ( Fig. 9 B. Fig. 9 C. Fig. 9 E), resulting in the ratio of the adaxial surface to the abaxial surface of the occipital of the knockout mutant KO being significantly smaller than that of the wild-type ZH11 occipital ( Fig. 9 F), resulting in a smaller leaf angle. Fig. 9 As shown in D, the leaf angle of wild-type ZH11 is 36.225°, while that of mutant KO is 17.425°. Fig. 9 As shown in E, the adaxial length of the pulvinus of the wild-type ZH11 is 2.072 mm, the adaxial length of the pulvinus of the mutant KO is 1.820 mm, the abaxial length of the pulvinus of the wild-type ZH11 is 0.811 mm, and the abaxial length of the pulvinus of the mutant KO is 1.116 mm. Fig. 9 As shown in F, the ratio of the adaxial surface to the abaxial surface of the occipital of the wild-type ZH11 is 2.621, while the ratio of the adaxial surface to the abaxial surface of the occipital of the mutant KO is 1.644.

[0110] The knockout mutant KO had smaller panicles and a lower fruiting rate. Fig.10 The ear length of the mature knockout mutant KO is significantly shorter than that of the wild type ZH11 ( Fig.10 A. Fig.10D), the length of the first branch of the knockout mutant KO is significantly shorter than that of the wild type ZH11 ( Fig.10 B. Fig.10 E), the number of secondary branches in the knockout mutant KO was significantly less than that in the wild type ZH11 ( Fig.10 B. Fig.10 F), the total number of grains per ear and the fruit setting rate of the knockout mutant KO were significantly lower than those of the wild type ZH11 ( Fig.10 C. Fig.10 G. Fig.10 H).

[0111] The knockout mutant KO had smaller grain width and decreased thousand-grain weight. Fig.11 As shown. The KO mutant granule width is significantly smaller than the wild-type ZH11 ( Fig.11 A. Fig.11 B), the knockout mutant KO grain thickness is significantly smaller than the wild-type ZH11 ( Fig.11 C), the thousand-grain weight of the knockout mutant KO was significantly lower than that of the wild-type ZH11 ( Fig.11 D).

[0112] Regulating the expression level of the OsMED23 gene can improve the plant type of rice. Down-regulating the expression level of the OsMED23 gene can improve the stress resistance of rice, especially the resistance to lodging and pests and diseases. In addition, this example makes a reasonable inference based on the phenotypic results produced by the functional inactivation of the OsMED23 gene knockout mutant: up-regulating the expression level of the OsMED23 gene can improve the yield shape and quality traits of rice from aspects such as plant height, tillering, stem, leaf angle, panicle type and grain type.

[0113] It should be noted that the above-mentioned specific embodiments are exemplary, and those skilled in the art can come up with various solutions inspired by the disclosure of the present invention, and these solutions also belong to the disclosure scope of the present invention and fall within the protection scope of the present invention. Those skilled in the art should understand that the present invention specification and its drawings are illustrative and do not constitute a limitation of the claims. The scope of protection of the present invention is defined by the claims and their equivalents. The present invention specification contains multiple inventive concepts, such as "preferably" and "according to a preferred embodiment", both of which indicate that the corresponding paragraph discloses an independent concept, and the applicant reserves the right to file a divisional application based on each inventive concept. Throughout the text, the features guided by "preferably" are only an optional method and should not be understood as a must-have setting. Therefore, the applicant reserves the right to abandon or delete the relevant preferred features at any time.

Claims

1. Application of silencing or knocking out the mediator subunit OsMED23 in regulating rice plant type, wherein the regulated rice plant type is shorter plant height, increased tillering, shorter stems, upright leaves, smaller panicle type, smaller grain width and thickness, or decreased thousand-grain weight, characterized in that: The amino acid sequence of the mediator subunit OsMED23 is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The nucleotide sequence encoding the mediator subunit OsMED23 is shown as SEQ ID No.

2.

3. A method for reducing rice plant height or improving rice lodging resistance, characterized in that: The following steps are involved: Silencing or knocking out the gene for the mediator subunit OsMED23 in rice, The amino acid sequence of the mediator subunit OsMED23 is shown in SEQ ID No.

1.

4. The method according to claim 3, characterized in that The method for silencing or knocking out the OsMED23 gene in rice comprises: The nucleotide sequence of the OsMED23 gene of SEQ ID NO: 2 is mutated from G to T at position 1078. Or a base A is added to the nucleotide sequence such as nucleotide 181 of the OsMED23 gene target site in SEQ ID NO:

2.

5. The method according to claim 3, characterized in that: The method for silencing or knocking out the OsMED23 gene in rice comprises: The OsMED23 gene was knocked out using CRISPR-Cas9 gene editing technology.

Images