Use of a target succinyl-coa in the treatment of rheumatoid arthritis
By targeting and inhibiting the accumulation of succinyl-CoA and using OGDH enzyme inhibitors to block the accumulation of Succinyl-CoA, the problem of poor efficacy of existing RA treatment drugs has been solved, achieving effective treatment and diagnosis of rheumatoid arthritis and significantly alleviating joint inflammation.
Patent Information
- Application Number
- CN202410502070.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-25
- Publication Date
- 2026-08-25
- Estimated Expiration
- 2044-04-25
AI Technical Summary
Existing RA treatments have failed to effectively control inflammation and have side effects. Patients require long-term treatment and are prone to relapse, and there is a lack of effective treatment targets.
This product targets and inhibits the accumulation of succinyl-CoA by suppressing OGDH enzyme activity, thereby blocking the accumulation of succinyl-CoA. It is used in drugs and diagnostic kits for the treatment of rheumatoid arthritis, including succinyl-CoA detection kits and OGDH enzyme inhibitors.
It significantly alleviates the severity of rheumatoid arthritis, reduces abnormal differentiation of CD4+Trm cells, decreases joint inflammation, and improves patients' quality of life.
Smart Images

Figure CN118526587B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of targeting Succinyl-CoA in the treatment of rheumatoid arthritis. Background Technology
[0002] Rheumatoid arthritis (RA) is a typical chronic autoimmune disease characterized by progressive joint damage caused by an immune inflammatory response, leading to joint dysfunction and disability. It also affects multiple organs, impacting approximately 1% of the global population and imposing a significant burden on individuals, families, and society. The preclinical stage of RA can last for over a decade, during which patients lose immune tolerance and begin producing autoantibodies. In the clinical stage, innate and adaptive immune cells infiltrate the synovial tissue, leading to progressive tissue destruction characterized by intra-articular immune inflammation, severely impacting patients' quality of life.
[0003] Currently, RA treatment includes medication, surgery, physical therapy, occupational therapy, and self-care, with the goals of controlling inflammation, relieving pain, reducing disability, and improving quality of life. Current medications for RA mainly include nonsteroidal anti-inflammatory drugs (NSAIDs), corticosteroids, DMARDs, and biologics. However, these drugs have not achieved the expected results and have side effects such as gastric irritation, liver damage, increased risk of infection, and bone loss. Furthermore, RA treatment is lifelong, with patients experiencing repeated relapses and remissions, severely impacting their physical and mental health. Therefore, it is urgent to explore the pathogenesis of RA to find more effective therapeutic targets. Summary of the Invention
[0004] To address the shortcomings of existing technologies, this invention proposes an application of targeting Succinyl-CoA in the treatment of rheumatoid arthritis.
[0005] The objective of this invention can be achieved through the following technical solutions:
[0006] A drug for treating or preventing rheumatoid arthritis, the drug containing an ingredient that inhibits the accumulation of succinyl-CoA.
[0007] Preferably, the succinyl-CoA is derived from Trm cells in synovial tissue.
[0008] Preferably, the component that inhibits the accumulation of succinyl-CoA contains an OGDH enzyme inhibitor.
[0009] A kit for diagnosing rheumatoid arthritis, the kit containing a component for determining succinyl-CoA levels.
[0010] Preferably, the kit comprises a Succinyl-CoA detection kit.
[0011] The application of a component that inhibits the accumulation of succinyl-CoA in the preparation of a drug for treating rheumatoid arthritis.
[0012] Preferably, the application includes inhibiting CD4. + Trm cell differentiation.
[0013] Preferably, the component that inhibits succinyl-CoA accumulation contains an OGDH enzyme inhibitor.
[0014] The beneficial effects of this invention: This invention fully relies on clinical patient samples and humanized disease models, and explores CD4... + The mechanism of abnormal differentiation of Trm cells focuses on CD4. + Succinyl-CoA in Trm cells; by constructing a humanized rheumatoid arthritis mouse model, it was found that reducing the level of succinyl-CoA can significantly alleviate the severity of rheumatoid arthritis; this fully demonstrates that succinyl-CoA is a promising new therapeutic target for rheumatoid arthritis and has clinical translational value. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of this disclosure or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, those skilled in the art can obtain other drawings based on these drawings without creative effort.
[0016] Figure 1 For the detection of CD4 in this invention + Differentiation characteristics of Trm cells; Figure A shows the flow cytometry analysis of CD4 in healthy individuals and RA patients. + Figure B shows the characteristic expression of CD103, a marker molecule of Trm; Figure B is a statistical graph of the expression of CD103 as detected by cell flow cytometry.
[0017] Figure 2 To detect the intracellular accumulation of Succinyl-CoA in this invention, an ELISA kit was used to detect CD4 in healthy individuals and RA patients. + The intracellular Succinyl-CoA content of Trm cells.
[0018] Figure 3 For the detection of Succinyl-CoA on CD4 in this invention + The role of Trm cells in abnormal differentiation; using OGDH enzyme inhibitors to inhibit OGDH enzyme activity, blocking the accumulation of Succinyl-CoA, and detecting the expression of the marker molecule CD103 by cell flow cytometry.
[0019] Figure 4 This invention is used to detect the expression of Hobit protein. AB-WB experiments were conducted to detect CD4 expression in healthy individuals and RA patients. + Characteristic and statistical diagrams of Hobit protein expression in Trm cells; CD. Using OGDH enzyme inhibitors, OGDH enzyme activity was inhibited, blocking the accumulation of Succinyl-CoA, and CD4 was detected by Western blotting. + Characteristic and statistical graphs of Hobit protein expression in Trm cells.
[0020] Figure 5 This invention relates to the construction and treatment of a humanized mouse model of RA. A. PBMCs derived from healthy individuals and RA patients were injected into NSG-synovial mice, and transcriptomic analysis was performed on the inflammation in the synovial tissue. B and D. PBMCs derived from healthy individuals were injected into NSG-synovial mice, with the experimental group receiving sodium succinate (SS) treatment of PBMCs derived from healthy individuals and CD4+ administration. + T cell supplementation with additional Succinyl-CoA, transcriptomic analysis of inflammation in synovial tissue, and immunofluorescence staining analysis of CD4 + Trm cell infiltration; PBMCs derived from C and F RA patients were injected into NSG-synovial mice, with the experimental group using an OGDH enzyme inhibitor (SP) to reduce CD4+ in PBMCs derived from RA patients. + Succinyl-CoA levels in T cells, validation results in synovial tissue via transcriptome analysis, and CD4+ staining analysis using immunofluorescence. + Trm cell infiltration status. Detailed Implementation
[0021] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0022] Example 1. Detection of CD4 + Differentiation characteristics of Trm cells.
[0023] Separating CD4 from healthy individuals and RA patients + T cells were stimulated with anti-CD3 / CD28 beads and TGF-β was added. After 3 days of culture, the cell surface molecular marker CD103 was detected. The specific experimental steps are as follows:
[0024] 1.1 Experimental materials and reagents
[0025] (1) Cells: PBMC cells were all obtained from recruited volunteers.
[0026] (2) Reagent: EasySep™ Human CD4 + T Cell Isolation Kit (Stemcell); CD4 and CD103 flow cytometry antibodies (Biolegend); anti-CD3 / CD28 beads (Thermo); TGF-β cytokine (nearshore protein).
[0027] 1.2 Experimental Procedure
[0028] 1.2.1CD4 + T cell sorting
[0029] 1) Resuscitate PBMCs in a 37℃ water bath and wash once with complete culture medium;
[0030] 2) Based on each 1×10 7 Add 100 μl of sorting buffer (50 ml PBS + 2% fetal bovine serum + 1 mM EDTA) to each cell, resuspend the cells, and place them in a 5 ml flow cytometry tube;
[0031] 3) Based on EasySep™ Human CD4 + T Cell Isolation Kit instructions, per 1×10 7 Add 5 μl of antibody to each cell and incubate at room temperature for 5 min.
[0032] 4) Each 1×10 7 Add 5 μl of magnetic beads to each cell, insert the sorting tube into the magnetic rack and let it stand at room temperature for 5 min, carefully aspirate the cell fluid and place it into a new sorting tube, then reinsert the magnetic rack and let it stand at room temperature for 5 min.
[0033] 5) Carefully aspirate the cell sap and wash once with RPMI 1640 complete medium containing 10% fetal bovine serum. This yields CD4+. + T cells can be used in downstream experiments.
[0034] 1.2.2 Cell flow cytometry detection of surface molecules
[0035] 1) Remove CD4 cells that have been cultured for 3 days. + T cells were collected by centrifuging at 1700 rpm for 6 min in a 1.5 ml centrifuge tube;
[0036] 2) Fixation: Incubate 200 μl of 4% paraformaldehyde at room temperature for 15 min, then wash twice with PBS;
[0037] 3) Staining: Resuspend cells in 100 μl of PBS containing 2% fetal bovine serum, add 0.5 μl of CD4 / CD103 flow cytometry antibody, and stain at 4°C in the dark for 45 min;
[0038] 4) After removing the cells, wash them twice with PBS by centrifugation, and then resuspend the cells in 100 μl of PBS. If there are too many cells, adjust the resuspending volume.
[0039] 5) Turn on the machine in advance, prepare the samples, and then test them.
[0040] 1.3 Experimental Results
[0041] Based on the above experimental results, it was found that, compared with the healthy control group, CD4 from RA patients... + T-differentiation of CD4 + Increased Trm cells indicate that CD4+ cells are present in RA patients. + T cells exhibit a greater tendency to differentiate into Trm cells, as shown in the results. Figure 1 .
[0042] Example 2. Detection of intracellular accumulation of Succinyl-CoA
[0043] Separating CD4 from healthy individuals and RA patients + T cells were stimulated with anti-CD3 / CD28 beads and TGF-β was added. After culturing for 3 days, the Succinyl-CoA content was measured. The specific experimental steps are as follows:
[0044] 2.1 Experimental materials and reagents
[0045] (1) Cells: PBMC cells were all obtained from recruited volunteers.
[0046] (2) Reagents: Succinyl-CoA detection kit (Nanjing Jiancheng), EasySep™ Human CD4 + T Cell Isolation Kit (Stemcell); CD4 and CD103 flow cytometry antibodies (Biolegend); anti-CD3 / CD28 beads (Thermo); TGF-β cytokine (nearshore protein).
[0047] 2.2 Experimental Procedure
[0048] The Succinyl-CoA content was determined using an ELISA assay.
[0049] 1) Dilute the protein standard as required;
[0050] 2) Set up blank wells (blank control wells do not contain sample or enzyme-labeled reagent, all other steps are the same), standard wells, and sample wells. Accurately add 50 μl of standard to the enzyme-labeled plate. In the sample wells, first add 40 μl of sample diluent, then add 10 μl of sample to be tested (the final sample dilution is 5-fold). Add the sample to the bottom of the well, avoiding contact with the well walls, and gently shake to mix.
[0051] 3) After sealing the plate with sealing film, incubate at 37°C for 30 minutes;
[0052] 4) Dilute the 30X concentrated washing solution 30 times with distilled water and set aside;
[0053] 5) Carefully peel off the sealing film, discard the liquid, shake dry, fill each well with washing solution, let stand for 30 seconds and then discard, repeat this 5 times, and pat dry.
[0054] 6) Add 50 μl of enzyme-labeled reagent to each well, except for the blank wells;
[0055] 7) Follow the same procedure as 3, seal the plate with sealing film, and incubate at 37°C for 30 minutes;
[0056] 8) Same as 5, carefully peel off the sealing film, discard the liquid, shake dry, fill each well with washing solution, let stand for 30 seconds and then discard, repeat this 5 times, and pat dry.
[0057] 9) Add 50 μl of color developer A to each well, then add 50 μl of color developer B, gently shake to mix, and develop at 37°C in the dark for 10 minutes.
[0058] 10) Add 50 μl of stop solution to each well to stop the reaction (at this point, the blue color will immediately turn yellow);
[0059] 11) Zero the instrument using the blank well and measure the absorbance (OD value) of each well sequentially at a wavelength of 450 nm. The measurement should be performed within 15 minutes after adding the stop solution.
[0060] 2.3 Experimental Results
[0061] Our experimental results showed that, compared with the healthy control group, CD4+ derived from RA patients... + Succinyl-CoA levels were significantly increased in T cells, as shown in the results below. Figure 2 .
[0062] Example 3. Detection of Succinyl-CoA on CD4 + The role of abnormal differentiation of Trm cells
[0063] CD4 isolation in RA patients +T cells were stimulated with anti-CD3 / CD28 beads and TGF-β was added, along with an OGDH enzyme inhibitor to inhibit Succinyl-CoA accumulation. After 3 days of culture, CD4 counts were measured. + Trm differentiation index. The specific experimental steps are as follows:
[0064] 3.1 Experimental Materials and Reagents
[0065] (1) Cells: PBMC cells were all obtained from recruited volunteers.
[0066] (2) Reagents: OGDH enzyme inhibitor (Mce), Succinyl-CoA detection kit (Nanjing Jiancheng), EasySep™ Human CD4 + T Cell Isolation Kit (Stemcell); CD4 and CD103 flow cytometry antibodies (Biolegend); anti-CD3 / CD28 beads (Thermo); TGF-β cytokine (nearshore protein).
[0067] 3.2 Experimental Procedure
[0068] The flow cytometry method was used for the same detection as in Experiment 1.
[0069] 1) Remove CD4 cells that have been cultured for 3 days. + T cells were collected by centrifuging at 1700 rpm for 6 min in a 1.5 ml centrifuge tube;
[0070] 2) Fixation: Incubate 200 μl of 4% paraformaldehyde at room temperature for 15 min, then wash twice with PBS;
[0071] 3) Staining: Resuspend cells in 100 μl of PBS containing 2% fetal bovine serum, add 0.5 μl of CD4 / CD103 flow cytometry antibody, and stain at 4°C in the dark for 45 min;
[0072] 4) After removing the cells, wash them twice with PBS by centrifugation, and then resuspend the cells in 100 μl of PBS. If there are too many cells, adjust the resuspending volume accordingly.
[0073] 5) Turn on the machine in advance, prepare the samples, and then test them.
[0074] 3.3 Experimental Results
[0075] Our experimental results show that blocking the accumulation of Succinyl-CoA with OGDH enzyme inhibitors reduces CD4+ from RA patients. + Trm cell differentiation was significantly reduced, results are shown in Figure 3 .
[0076] Example 4. Investigating how Succinyl-CoA regulates CD4 + Trm cell abnormal differentiation
[0077] CD4 separation between healthy individuals and RA patients + T cells were stimulated with anti-CD3 / CD28 beads and TGF-β was added. After culturing for 3 days, Hobit protein expression was detected. CD4 cells were also isolated from RA patients. + T cells were stimulated with anti-CD3 / CD28 beads and TGF-β was added, along with an OGDH enzyme inhibitor to inhibit Succinyl-CoA accumulation. After 3 days of culture, Hobit protein expression was detected. The specific experimental steps are as follows:
[0078] 4.1 Experimental materials and reagents
[0079] (1) Cells: PBMC cells were all obtained from recruited volunteers.
[0080] (2) Reagents: Hobit antibody (Invitrogen); OGDH enzyme inhibitor (Mce); Succinyl-CoA detection kit (Nanjing Jiancheng); EasySep™ Human CD4 + T Cell Isolation Kit (Stemcell); CD4 and CD103 flow cytometry antibodies (Biolegend); anti-CD3 / CD28 beads (Thermo); TGF-β cytokine (nearshore protein).
[0081] 4.2 Experimental Procedure
[0082] Western blot assay was used to detect protein expression levels.
[0083] 1) Protein sample collection;
[0084] 2) Preparation of protein gel: Select the required gel concentration according to the molecular weight of the target protein;
[0085] 3) Gel electrophoresis: Add the sample to the upper well, first maintain a constant voltage of 80V until the bands run out of the stacking gel, then adjust the voltage to 120V until the sample reaches the bottom of the gel and then stop electrophoresis;
[0086] 4) Transfer: Activate the PVDF membrane in anhydrous methanol. Place the filter paper, transfer clamp, and sponge in the transfer solution. Carefully pry open the gel plate and cut off the separating gel. Place the gel in the transfer tank in the order of black side - sponge - filter paper - gel - PVDF membrane - filter paper - sponge - white side. Add sufficient transfer solution and transfer at 200mA for 2 hours (transfer on an ice-water mixture).
[0087] 5) Sealing: Remove the membrane and seal it with 5% milk at room temperature for 1 hour;
[0088] 6) Antibody incubation: Prepare Hobit / actin antibody according to the instructions using primary antibody dilution buffer. Incubate the PVDF membrane in the antibody cassette at 4°C overnight or at room temperature for 4 hours. Wash three times with PBST for 10 minutes each time. Prepare secondary antibody using antibody dilution buffer and incubate at room temperature for 1 hour. Wash three times with PBST for 10 minutes each time.
[0089] 7) Exposure: Mix equal volumes of ECL luminescent liquid A and liquid B to fully cover the PVDF film, and then expose.
[0090] 4.3 Experimental Results
[0091] Our experimental results showed that, compared with the healthy control group, CD4+ derived from RA patients... + Hobit protein expression is elevated in Trm cells; OGDH enzyme activity is inhibited by using OGDH enzyme inhibitors, blocking the accumulation of Succinyl-CoA and CD4. + Hobit protein expression is reduced in Trm cells, see Figure 4 .
[0092] Example 5. Exploring the clinical translational value of Succinyl-CoA based on a humanized RA disease model.
[0093] Synovial tissue from RA patients was implanted into the back of mice, followed by intravenous injection of PBMCs derived from healthy individuals and RA patients, or treated PBMCs derived from healthy individuals or treated PBMCs derived from RA patients. Synovial tissue inflammation and tissue CD4 counts were then assessed. + Trm cell infiltration. The specific experimental steps are as follows:
[0094] 5.1 Experimental Materials and Reagents
[0095] (1) Cells: PBMC cells were all obtained from recruited volunteers.
[0096] (2) Synovial tissue samples: all were obtained from recruited volunteers.
[0097] (3) Animals: SPF-grade wild-type NSG mice (Biocytok, Inc.) aged 6-8 weeks and weighing 18-22g were selected, and the 3R principle of experimental animal handling was followed. The experimental protocol was approved by the Experimental Animal Ethics Committee of Soochow University.
[0098] (4) Reagents: Sodium succinate (Sigma), anti-Human CD4, anti-Human CD103 fluorescent antibodies (Affinity), 18S RNA primer sequences (F: AGCCCTGCCCTTTGTACACA; R: GATCCGAGGGCCTCACTAAAC), IL-10 (F: GACTTTAAGGGTTACCTGGGTTG; R: TCACATGCGCCTTGATGTCTG), IL-6 (F: ACTCACCTCTTCAGAACGAATTG; R: CCATCTTTGGAAGGTTCAGGTTG); IL-17 primer sequence (F: TCC CACGAAATCCAGGATGC; R: GGATGTTCAGGTTGACCATCAC); TRB (F: CCTTCAACAACAGCATTATTCCAG; R: CGAGGGAGCACAGGCTGTCTT); TNFA (F: CCTCTCTCTAATCAGCCCTCTG; R: GAGGACCTGGGAGTAGATGAG); IFNG (F: TCGGTAACTGACTTGAATGTCCA; R: TCGCTTCCCTGTTTTAGCTGC).
[0099] 5.2 Experimental Procedure
[0100] 5.2.1 Establishment of a humanized RA mouse model
[0101] 1) Prepare surgical supplies, including instruments and tools such as alcohol, forceps, and medical tape;
[0102] 2) Obtain clinical joint synovial membrane samples, cut them into uniform and as regular a size as possible with surgical scissors, and number and store them;
[0103] 3) Take NSG mice that are about 6-8 weeks old, anesthetize them with gas, and after they are in a coma, make a small incision in the skin on their backs, but do not break the endothelium and try to avoid capillaries. Then take an appropriate size of synovial tissue sample from the patient's joint and implant it.
[0104] 4) After adjusting the position, remove the skin sutures to close the incision;
[0105] 5) Postoperative recovery: Inject the mice with saline and administer antibiotics to the exposed wound to prevent local infection. Place them on a 37°C heating pad to keep them warm and observe their pupils and respiratory rate. Once they are awake, ensure they have sufficient water and food and observe their postoperative recovery.
[0106] 6) After feeding for one week, human PBMCs (treated differently according to experimental needs) were injected into mice via the tail vein. After feeding for two weeks, immune cells infiltrated the synovial membrane samples of the joints in the mice.
[0107] 7) Mice were euthanized by cervical dislocation, and human synovial tissue from their backs was collected for subsequent experiments.
[0108] 5.2.2 Frozen Sections
[0109] 1) Take synovial tissue from the dorsal joints of humanized NSG-synovial mice and treat it with OTC to allow it to soak thoroughly;
[0110] 2) Perform frozen sectioning;
[0111] 3) Staining: The primary antibody was diluted 1:100, protected from light, and incubated overnight at 4°C; the secondary antibody was diluted 1:200 and stained at room temperature for 1 hour.
[0112] 4) Laser confocal microscopy observation of CD4 + Trm cell infiltration status.
[0113] 5.2.3 Detection of inflammatory factors
[0114] 1) Take human synovial tissue from the back, cut it into appropriately sized tissue blocks, place them in a grinding tube, add about 1 ml of Trizol, and grind;
[0115] 2) Extract RNA from tissues and perform reverse transcription;
[0116] 3) Based on the primer sequences, qPCR was performed to detect the expression of inflammatory factors.
[0117] 5.4 Experimental Results
[0118] Based on our experimental results, we found that: (1) after synovial tissue from RA patients was implanted into the backs of mice, compared with the control group injected with PBMC from healthy individuals, the synovial tissue inflammation was aggravated by PBMC from RA patients. Figure 5 A; (2) After synovial tissue from RA patients was implanted into the backs of mice, compared with untreated healthy human PBMCs, PBMCs treated with sodium succinate (SS) had significantly higher levels of CD4+ in their synovial tissue. + Trm cell infiltration increased, and the inflammatory response increased (see Figures B and D); (3) After synovial tissue from RA patients was implanted into the back of mice, compared with untreated PBMCs from RA patients, PBMCs treated with OGDH enzyme inhibitor (SP) had significantly higher levels of CD4+ in their synovial tissue. + The infiltration of Trm cells was significantly reduced, and the inflammatory response was significantly decreased, effectively alleviating the disease severity in humanized RA model mice.
[0119] In conclusion, targeted inhibition of Succinyl-CoA accumulation has good application value in the treatment of RA.
[0120] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.
[0121] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.
Claims
1. The use of a Succinyl-CoA-targeting OGDH enzyme inhibitor in the preparation of a medicament for treating rheumatoid arthritis, characterized in that, The OGDH enzyme inhibitor is SP, which is used to inhibit the accumulation of succinyl-CoA, thereby inhibiting CD4+. + Trm cell differentiation.
2. The use of the Succinyl-CoA-targeting OGDH enzyme inhibitor according to claim 1 in the preparation of a medicament for treating rheumatoid arthritis, characterized in that, The succinyl-CoA is derived from Trm cells in synovial tissue.
Citation Information
Patent Citations
Application of OGDH inhibitor to treatment of viral infectious diseases
CN110404074A