Cucumber CsGA20ox2 gene and its coding protein in improving cucumber adventitious root formation under waterlogging stress
By cloning and overexpressing the cucumber CsGA20ox2 gene, the problem of taproot aging in cucumbers under waterlogging stress was solved, adventitious root formation was significantly improved, and the waterlogging resistance of cucumbers was enhanced, providing genetic resources for cucumber breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YANGZHOU UNIV
- Filing Date
- 2024-06-03
- Publication Date
- 2026-06-23
Smart Images

Figure CN118531020B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a cucumber CsGA20ox2 gene and application of a coded protein thereof in improving formation of adventitious roots of cucumber under waterlogging stress. BACKGROUND
[0002] Cucumber (Cucumis sativus L.) has underdeveloped taproots, is a fibrous root system, and is strong in air affinity, and is extremely vulnerable to waterlogging stress. The Yangtze River Basin and regions south thereof in China are main cucumber cultivation regions, and frequent rainwaterlogging during the growth period seriously affects cucumber growth, and leads to yield and quality reduction. Under waterlogging stress, cucumber primary root systems rapidly age and die, and the leaves of the aboveground part lose green and wither, and turn yellow and die. Research shows that there is a significant difference in waterlogging tolerance among cucumber varieties, which provides a possibility for genetic improvement of cucumber waterlogging tolerance. Exploring waterlogging tolerance genes and then analyzing the molecular action mechanism thereof is a fundamental guarantee for innovative cucumber waterlogging tolerance germplasm and cultivation of strong waterlogging tolerance varieties. Cucumber forms adventitious roots to adapt to waterlogging environments when coping with waterlogging stress, replaces the primary root systems that die due to hypoxia, and alleviates hypoxia damage.
[0003] In addition, under waterlogging stress, treatment by exogenous application of an ethylene precursor ACC and an ethylene synthesis inhibitor AOA shows that, compared with a control that is only flooded, the flooding+ACC treatment significantly promotes an increase in the number of cucumber adventitious roots, and the flooding+AOA treatment has an opposite effect; under waterlogging stress, treatment by exogenous application of an auxin transport inhibitor NPA and a plant growth regulator NAA shows that, compared with the control that is only flooded, the flooding+NPA treatment significantly inhibits the emergence of cucumber adventitious roots under light conditions, and the flooding+NAA treatment enhances the emergence of adventitious roots under light conditions.
[0004] At present, there is less research on improvement of cucumber adventitious root formation under waterlogging stress through gene regulation, and therefore it is necessary to find new genes that regulate cucumber adventitious root formation and waterlogging tolerance mechanisms thereof for crop breeding promotion, and it has important significance and application prospect for innovative cucumber waterlogging tolerance germplasm and breeding of new waterlogging tolerance cucumber varieties in the future. SUMMARY
[0005] The application aims to provide a gene CsGA20ox2 that regulates formation of cucumber adventitious roots under waterlogging stress, a nucleotide sequence of the gene CsGA20ox2 is shown in SEQ ID NO. 1, the gene CsGA20ox2 has a significantly up-regulated expression amount in a hypocotyl under waterlogging stress, a CsGA20ox2 overexpression strain is obtained through Agrobacterium-mediated cucumber transgenesis, it is determined that the CsGA20ox2 regulates formation of cucumber hypocotyl adventitious roots under waterlogging stress and enhances waterlogging tolerance of cucumber, and it is found through a virus-induced gene silencing system that silencing of the CsGA20ox2 leads to a significant decrease in the number of cucumber hypocotyl adventitious roots formed under waterlogging stress and waterlogging tolerance of cucumber.
[0006] This invention also provides the application of the gene CsGA20ox2, which regulates the formation of adventitious roots in cucumbers under waterlogging stress.
[0007] Technical solution: In order to achieve the above objectives, the nucleotide sequence of the gene CsGA20ox2, which regulates the formation of adventitious roots in cucumbers under waterlogging stress, is shown in SEQ ID NO.1.
[0008] Furthermore, the primer pair used to amplify the gene CsGA20ox2 is...
[0009] CsGA20ox2-F: 5'-TTTGGAGAGAACACGGGGGACATGGAATCGACGACGACGG-3', CsGA20ox2-R: 5'-GGAAATTCGAGCTCACTAGTTTAAAATGGAATTTTTGGAG-3'.
[0010] The amino acid sequence of the gene CsGA20ox2, which improves the formation of adventitious roots in cucumbers under waterlogging stress, as described in this invention, is shown in SEQ ID NO.2.
[0011] The present invention describes a silencing gene vector pV190-CsGA20ox2 for CsGA20ox2, which regulates the formation of adventitious roots in cucumbers under waterlogging stress.
[0012] The method for constructing the vector pV190-CsGA20ox2 is as follows: primers for constructing the vector are designed based on the CsGA20ox2 (+149~+448bp) coding sequence region.
[0013] pV190-CsGA20ox2-F:5'-aggactttacttaatggatccACTTAGGGGGATTCAGGAGA-3', pV190-CsGA20ox2-R:5'-cctagacctataactggatccGAGAATCATCATTAGAATACTC-3'.
[0014] The gene was amplified, and the fragment was ligated into the pV190 vector to obtain the vector pV190-CsGA20ox2.
[0015] The present invention relates to the overexpression vector pCS4106-CsGA20ox2 of the gene CsGA20ox2 that regulates the formation of adventitious roots in cucumbers under waterlogging stress.
[0016] The overexpression vector pCS4106-CsGA20ox2 is constructed by inserting the CsGA20ox2 gene sequence shown in SEQ ID No.1 between the XbaI and SpeI restriction sites of the pCS4106 vector, thus obtaining the overexpression vector pCS4106-CsGA20ox2.
[0017] Furthermore, the pCS4106 overexpression vector containing the CsGA20ox2 gene shown in SEQ ID No. 1 was transformed into Agrobacterium EHA105, and the Agrobacterium-mediated genetic transformation method was used to infect waterlogging-intolerant cucumber materials to obtain transgenic T0 plants resistant to aada and to identify them by PCR.
[0018] Transgenic cucumber plants were self-pollinated in the T0 generation to obtain the T1 generation. The T1 generation was then self-pollinated and seed-separated to obtain homozygous, waterlogged-tolerant new cucumber materials.
[0019] The application of the gene CsGA20ox2, or its encoded protein, or biological materials containing its encoding gene, including expression cassettes, vectors, or transgenic cells, in regulating adventitious root formation and waterlogging tolerance in cucumbers under waterlogging stress, as described in this invention.
[0020] Specifically, silencing the CsGA20ox2 gene reduced the adventitious root formation ability of cucumber under waterlogging stress, while overexpressing the CsGA20ox2 gene improved the adventitious root formation ability of cucumber under waterlogging stress.
[0021] The present invention relates to the application of the gene CsGA20ox2, or its encoded protein, or biological materials containing its encoding gene, including expression cassettes, vectors, or transgenic cells, in the cultivation of homozygous waterlogged-tolerant cucumber plants.
[0022] This invention is the first to demonstrate that CsGA20ox2 participates in regulating adventitious root formation in cucumbers under waterlogging stress. Overexpression of CsGA20ox2 significantly increases the number of adventitious roots under waterlogging stress, while reducing the expression level of CsGA20ox2 leads to a significant decrease in the number of adventitious roots under waterlogging stress. The results of this invention provide important gene resources for the molecular genetic improvement of cucumber waterlogging tolerance and the breeding of new waterlogging-tolerant varieties, and have significant application prospects in the safe production of horticultural crops.
[0023] This invention uses the pCS4106 vector as a backbone to construct a CsGA20ox2 gene overexpression vector containing SEQ ID No.1; and uses Agrobacterium-mediated transformation to cultivate transgenic cucumber lines that overexpress the CsGA20ox2 gene. By enhancing the expression level of the CsGA20ox2 gene in cucumbers, the number of adventitious roots of the hypocotyl in cucumbers is increased and the waterlogging resistance of cucumbers is improved.
[0024] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:
[0025] This invention successfully cloned the cucumber waterlogging stress response gene CsGA20ox2 and introduced it into cucumbers using Agrobacterium-mediated transformation. Detailed comparative analysis between transgenic plants and wild-type plants revealed that transgenic plants overexpressing the CsGA20ox2 gene exhibited a significantly increased number of adventitious roots after waterlogging stress, thereby enhancing their waterlogging tolerance. Therefore, this invention provides technical support and a theoretical basis for cultivating new cucumber varieties capable of resisting abiotic stresses through genetic engineering. Attached Figure Description
[0026] Figure 1 The results of qRT-PCR detection of CsGA20ox2 overexpression lines and wild-type lines;
[0027] Figure 2 Phenotypic formation of adventitious roots after flooding treatment of CsGA20ox2 overexpressing lines and wild-type lines;
[0028] Figure 3 Statistics on the number of adventitious roots formed in CsGA20ox2 overexpressing lines and wild-type lines after flooding treatment;
[0029] Figure 4 The results of qRT-PCR detection in CsGA20ox2 silenced plants and controls;
[0030] Figure 5 Phenotypic formation of adventitious roots in CsGA20ox2 silent plants and control plants after flooding treatment;
[0031] Figure 6 The number of adventitious roots formed in CsGA20ox2 silent plants and the control after flooding treatment was statistically analyzed. Detailed Implementation
[0032] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0033] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.
[0034] All materials used in this invention are either known or commercially available.
[0035] Cucumber Zaoer-N: Deposited at Cucumber Germplasm Bank, Yangzhou University; Xu,X.,J.,Xu,Q.,Qi,X.,Weng,Y.,Chen,X.(2018) The major-effect quantitative trait locus CsARN6.1 encodes an AAAATPase domain-containing protein that is associated with waterlogging stress tolerance by promoting adventitious root formation. The Plant Journal,93(5):917-930.
[0036] Cucumber superina: preserved in the Cucumber Germplasm Bank of Yangzhou University; Dong, J., Xu, J., Xu, X., Xu, Q., Chen, X. (2019) Inheritance and Quantitative Trait Locus Mapping of Fusarium Wilt Resistance in Cucumber. Frontiers in Plant Science, 10: 1425.
[0037] Cucumber 9930: Preserved at the Cucumber Germplasm Resource Bank of Yangzhou University; Huang S, Li R, Zhang Z, Li L, Gu X, Fan W, et al. 2009. The genome of the cucumber, Cucumis sativus L. Nature Genetics. 41(12): 1275-1281.
[0038] pCS4106: Provided by Yangzhou University, Xu, PlantJournal,114(4):824-835.;
[0039] pV190 vector: provided by Yangzhou University, Liu, M., Liang, Z., Aranda, MA, Hong, N., Liu, L., Kang, B. et al. (2020) Acucumber green mottle mosaic virus vector for virus-induced genesilencing in cucurbitplants. Plant Methods, 16:9.;
[0040] CsPDS: Provided by Yangzhou University, Xu,X.,Liu,M.,Hu,Q.,Yan,W.,Pan,J.,Yan,Y.,Chen,X.(2023)ACsEIL3-CsARN6.1 module promotes waterlogging-triggered adventitious root formation in cucumber by activating the expression of CsPrx5.ThePlantJournal,114(4):824-835.
[0041] Example 1
[0042] Cloning and overexpression vector construction of cucumber CsGA20ox2
[0043] Based on homologous recombination, and referencing the genome sequence of the North China type cucumber 9930_V3, primers for amplifying the target gene CsGA20ox2 were designed using the first strand of cDNA synthesized by reverse transcription of total RNA from the hypocotyl of the waterlogging-tolerant cucumber variety Zaoer-N as a template. The full-length sequence of cucumber CsGA20ox2 was amplified by polymerase chain reaction (PCR). The reaction system consisted of: 25 μL of 2×PCR buffer, 1 μL of 2 mM dNTPs mixture, and 2 μL of CsGA20ox2-F primer (5'-TTTGGAGAGAACACGGGGGACATGGAATCGACGACGACGG-3').
[0044] The reaction mixture consisted of 2 μL of CsGA20ox2-R primer (5'-GGAAATTCGAGCTCACTAGTTTAAAATGGAATTTTTGGAG-3'), 2 μL of cDNA template, 1 μL of Super-Fidelity, and sterile distilled water to a final volume of 50 μL. The reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 45 sec, 35 cycles; 72℃ for 10 min; and incubation at 4℃. After the reaction, the PCR products were separated by 1.0% agarose gel electrophoresis and recovered using the Novizan DNA gel extraction kit. The products were sent to Qingke Biotechnology (Nanjing) Co., Ltd. for sequencing. Sequence alignment analysis revealed that the full-length nucleotide sequence was 996 bp, as shown in SEQ ID No. 1; the gene sequence encoding 331 amino acids is shown in SEQ ID No. 2.
[0045] The pCS4106 vector (containing the 35S promoter of cauliflower mosaic virus) and the sequenced PCR product were digested with XbaI and SpeI restriction endonucleases (purchased from Thermo Fisher Scientific). The digestion reaction volume was: 10 μL 10× buffer, 25 μL plasmid or PCR product, 2.5 μL XbaI restriction enzyme, 2.5 μL SpeI enzyme, and water to a final volume of 100 μL. The digestion conditions were 37°C for 1 hour. After digestion, the vector and PCR product were purified and recovered, and ligated using T4 DNA ligase (Takara). The ligation conditions were 25°C for 60 minutes. All ligation products were added to E. coli DH5α, plated on LB agar containing 50 mg / L Kamagra, and incubated overnight at 37°C. Ten single colonies were selected for colony PCR identification. After PCR identification, the positive bacterial culture was sent to Qingke Biotechnology (Nanjing) Co., Ltd. for sequencing. The plasmid was extracted from the correctly sequenced positive clones to obtain the pCS4106-CsGA20ox2 recombinant overexpression vector, which was stored at -80℃ for later use.
[0046] Example 2
[0047] Creation of CsGA20ox2 overexpression lines and identification of the number of adventitious roots formed after flooding
[0048] The recombinant overexpression vector pCS4106-CsGA20ox2 was transformed into Agrobacterium. EHA105 competent Agrobacterium cells were stored at -80℃. After thawing in hand, the cells were placed in ice in an ice-water mixture. 1000 ng of the constructed recombinant plasmid pCS4106-CsGA20ox2 was added to every 100 μL of competent cells. The cells were then incubated sequentially on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and on ice for 5 min. 700 μL of antibiotic-free LB medium was added, and the cells were incubated at 28℃ for 2-3 hours with shaking. After centrifugation at 6000 rpm for 1 min, most of the supernatant was removed, leaving approximately 100 μL. This was then pipetted onto LB solid medium containing Kana+Rif and incubated at 28℃ for 2-3 days. Positive bacteria were identified by PCR and screened, and gel sequencing was performed. Agrobacterium positive cells containing pCS4106-CsGA20ox2, with a sequence 100% identical to that shown in SEQ ID No. 1, were obtained.
[0049] Select plump 9930 cucumber seeds, peel off the seed coat, rinse 3-4 times with sterile water, then disinfect in 75% alcohol for 30 seconds, rinse 3-4 times with sterile water, then sterilize in 2% sodium hypochlorite solution for 10 minutes, rinse 3-4 times with sterile water, and sow on a culture medium. After the cotyledons germinate, remove the growing point with a knife, cut off the tail 1 / 3, cut the cotyledons along the suture, divide them into two even pieces, and place them on the OD. 600 The cotyledons were liquid-infected with 0.6% pCS4106-CsGA20ox2-positive Agrobacterium for 2 hours, keeping them moist. The cotyledons were then transferred to filter paper to absorb excess moisture, laid flat on the culture medium, sealed, wrapped in aluminum foil, and placed in an incubator. After 3 days of culture, the cotyledons were washed 3-4 times with sterile ddH2O, dried with filter paper, and placed on a selection medium containing AADA. When the resistant shoots reached approximately 1 cm (15-20 days), they were cut off and transferred to rooting medium to obtain resistant transgenic plants (T0). After the transgenic cucumber roots had developed well, they were transplanted into pots filled with nutrient soil, harvested under standard greenhouse management, and self-pollinated to obtain the T1 generation. The harvested seeds were sown, and the seedlings were identified again using the AADA primer pair (AADA-F2: TCCGACATCGATCTCCTGGT, AADA-R2: CAGGGTGAGGACCACATTCC). Positive plants were planted and harvested to obtain homozygous T2 generation transgenic families overexpressing CsGA20ox2.
[0050] Seeds of the T2 generation family OE-CsGA20ox2-1, OE-CsGA20ox2-2, OE-CsGA20ox2-3, OE-CsGA20ox2-4, OE-CsGA20ox2-5, OE-CsGA20ox2-6, and OE-CsGA20ox2-7 were sown. After 14 days of growth (i.e., at the 2-leaf-1-heart stage), the plants were subjected to waterlogging treatment. qRT-PCR was used for detection (CsGA20ox2_qPCR_F: ATTGCCGACGATGGTAGACAAGAAG, CsGA20ox2_qPCR). The expression of CsGA20ox2 in the hypocotyl of overexpressing lines was investigated. Control plants (WT) and CsGA20ox2 transgenic plants (OE-CsGA20ox2-1, OE-CsGA20ox2-2, OE-CsGA20ox2-3, OE-CsGA20ox2-4, OE-CsGA20ox2-5, OE-CsGA20ox2-6, OE-CsGA20ox2-7) were treated with waterlogging for 48 hours, followed by phenotypic observation of waterlogging stress. Figure 1 As shown, the expression level of CsGA20ox2 in the hypocotyl of the CsGA20ox2 overexpressing lines was significantly higher than that in the hypocotyl of the wild type. Statistical analysis of the number of adventitious roots after 7 days of flooding stress treatment in the overexpressing lines and wild type revealed that, as... Figure 2 , 3 As shown, the number of adventitious roots in the seven families of CsGA20ox2 gene-overexpressing plants were 35±2.40, 39.2±2.39, 37.8±2.53, 32±1.33, 30.6±1.43, 30.2±3.12, and 32.3±2.41, respectively; while the number of adventitious roots in wild-type WT plants was 18.2±3.88. Therefore, overexpression of the CsGA20ox2 gene significantly improved the adventitious root formation ability of cucumber under waterlogging stress.
[0051] Example 3
[0052] Construction of the VIGS vector for the cucumber CsGA20ox2 gene
[0053] To further verify the application of CsGA20ox2 in the waterlogging tolerance of cucumber, virus-induced gene silencing technology was used to verify the function of CsGA20ox2. Primers were designed to amplify the coding sequence of CsGA20ox2 (+149~+448bp) from the cucumber inbred line 'Zaoer-N', obtaining a 300bp fragment, as shown in SEQ ID NO.3. Homologous recombination was used to digest the pv190 vector and the sequenced PCR product with BamHI restriction endonuclease (purchased from Thermo Fisher Scientific). The digestion reaction system was: 10×buffer 10μL, plasmid or PCR product 25μL, BamHI enzyme 2.5μL, and water added to a final volume of 100μL. The digestion conditions were: 37℃, 1 hour. After digestion, the vector and PCR product were purified and recovered, and ligated using T4 DNA ligase (Takara). The ligation conditions were: 25℃, 60 min. All ligation products were added to *E. coli* DH5α and plated on LB agar containing 50 mg / L kanamycin. The mixture was incubated overnight at 37°C. Ten single clones were selected for colony PCR identification. Positive bacterial cultures identified by PCR were sent to Qingke Biotechnology (Nanjing) Co., Ltd. for sequencing. Plasmids were extracted from correctly sequenced positive clones to obtain the pV190-CsGA20ox2 recombinant overexpression vector, which was stored at -80°C for later use.
[0054] SEQ ID NO.3:
[0055] ACTTAGGGGGATTCAGGAGAGGGGAGGAAGAGGCGACGGCGGAGGCGGCGGCG
[0056] ATGGTGAGGATGGCATGTATGAAACATGGGGTGTTTCAGGTGACGAATCACGGAG
[0057] TGGAAGAGGAGCTGATAAAGGCGGCGTATGAAGAAGGGGAGGGGATATTTAAGAT
[0058] GCCATTAGTGAAGAAAATAAGCGTGGGGAAAAAACCGGGGAGAGTGTCGGGATAT
[0059] TCAGGAGCTCATGCAGATAGATTCTCTTCAAAACTTCCATGGAAAGAGACCTTTCTCTTTTGAGTATTCTAATGATGATTCTC;
[0060] The primer pairs used for amplification are
[0061] pV190-CsGA20ox2-F:5'-aggactttacttaatggatccACTTAGGGGGATTCAGGAGA-3', pV190-CsGA20ox2-R:5'-cctagacctataactggatccGAGAATCATCATTAGAATACTC-3'.
[0062] The recombinant vector pV190-CsGA20ox2, pV190 vector, and positive control pV190-CsPDS (CsGA20ox2 was replaced with CsPDS, constructed according to the above method) were transformed into Agrobacterium strain GV3101. Agrobacterium-positive colonies that had been verified by PCR to have been transformed into the recombinant vector were selected and activated in 5 mL LB liquid medium containing 5 μL Kana (50 mg / L) and 5 μL Rif (50 mg / L). After shaking culture at 28°C for 12–16 h, the bacterial suspension became turbid and orange-colored. 200 μL of the bacterial suspension was then placed in 100 mL LB liquid medium containing 100 μL Kana (50 mg / L) and 100 μL Rif (50 mg / L), and cultured at 28°C for 12–16 h. Finally, the bacterial suspension was centrifuged at 6000 rpm for 5 min to collect the bacteria, and the bacterial blocks were resuspended and their OD values were determined. 600 Set the temperature to 0.8 and let it stand in a dark environment at 28°C for 3 hours.
[0063] After the two cotyledons of the plant have fully expanded, make a wound on the underside of the cotyledon using a syringe needle. Using a syringe with the needle removed, inject bacterial suspensions containing recombinant vector pV190-CsGA20ox2, pV190 vector, and positive control PDS into the cotyledons of cucumber Superina, respectively, until the cotyledons are saturated (leaf dripping). Then place the infected plants in a dark incubator at 18℃ for 24 hours, and finally transfer them to normal growth conditions (28℃ / 18℃ day / night) for further cultivation.
[0064] Example 4
[0065] Identification of the number of adventitious roots formed on hypocotyls of cucumbers after flooding using silent CsGA20ox2
[0066] Leaves of plants encoding the CsPDS gene, which encodes cucumber phytoene dehydrogenase, showed leukoplakia (positive control) 14 days after inoculation, presumably indicating that the target gene in the injected bacterial solution had been silenced. The gene silencing efficiency of CsGA20ox2 in this system was detected using qRT-PCR (CsGA20ox2_qPCR_F: ATTGCCGACGATGGTAGACAAGAAG, CsGA20ox2_qPCR_R: TCTTCATACGCCGCCTTTATCAGC). The results are as follows. Figure 4 As shown, the expression level of the CsGA20ox2 gene in the hypocotyl of cucumber plants injected with pV190-CsGA20ox2 was significantly lower than that in the hypocotyl of plants injected with the pV190 empty vector. Subsequently, the phenotypes of the blank control and plants with the target gene silenced after 14 days of culture were observed under waterlogging stress, and the results are as follows. Figure 5 , 6 As shown, the number of adventitious roots was counted 7 days after waterlogging stress. Analysis revealed that the number of adventitious roots in plants with the CsGA20ox2 gene silenced was 13.4±2.11, while the number of adventitious roots in plants injected with the pV190 empty vector was 35.4±2.37. Therefore, silencing the CsGA20ox2 gene significantly reduced the adventitious root formation ability of cucumbers under waterlogging stress.
Claims
1. Genes CsGA20ox2 The application of gene silencing in regulating adventitious root formation and waterlogging tolerance in cucumbers, or their encoded proteins, or biological materials containing such genes, including expression cassettes, vectors, or transgenic cells, through gene silencing editing. CsGA20ox2 Genes that reduce the ability of cucumbers to form adventitious roots under waterlogging stress were expressed by overexpression. CsGA20ox2 The gene enhances the adventitious root formation ability of cucumbers under waterlogging stress; CsGA20ox2 The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence encoding the protein is shown in SEQ ID NO.
2.
2. The application according to claim 1, characterized in that, Used to amplify the gene CsGA20ox2 The primer pairs are: CsGA20ox2 -F:5'-TTTGGAGAGAACACGGGGGACATGGAATCGACGACGACGG-3'; CsGA20ox2 -R:5'-GGAAATTCGAGCTCACTAGTTTAAAATGGATTTTTTGGAG-3'。 3. The application according to claim 1, wherein the gene CsGA20ox2 The silencing gene vector is pV190- CsGA20ox2 The method for constructing the silenced gene vector is as follows: design primers to amplify the gene. CsGA20ox2 The fragment from +149 to +448 was ligated into the pV190 vector to obtain the silencing gene vector pV190-. CsGA20ox2 .
4. The application according to claim 1, wherein the gene CsGA20ox2 The overexpression vector is pCS4106- CsGA20ox2 The method for constructing the overexpression vector is as follows: ... CsGA20ox2 The gene sequence was inserted between the XbaI and SpeI restriction sites of the pCS4106 vector to obtain the overexpression vector pCS4106- CsGA20ox2 .
5. Genes CsGA20ox2 The application of gene silencing in the cultivation of homozygous, flood-tolerant cucumber plants, or its encoded protein, or biological materials containing the gene, including expression cassettes, vectors, or transgenic cells; and gene silencing editing. CsGA20ox2 Genes that reduce the ability of cucumbers to form adventitious roots under waterlogging stress were expressed by overexpression. CsGA20ox2 The gene enhances the adventitious root formation ability of cucumbers under waterlogging stress; CsGA20ox2 The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence encoding the protein is shown in SEQ ID NO.2.