A quality control method for time-of-flight mass spectrometry test

Abstract

The present invention provides a time-of-flight mass spectrometry test quality control method, which belongs to the field of biological detection technology. The method comprises: mixing a multi-component quality control substance with a target sample to be tested and simultaneously performing a nucleic acid mass spectrometry test to obtain a test result; the multi-component quality control substance comprises at least one of an amplification component, an extension component, and a detection component; determining the position of the mass spectrum peak generated by the multi-component quality control substance in the test result within the detection area and determining the quality control result. The present invention realizes the monitoring of the quality control data of the detection process such as sample nucleic acid processing, ionization efficiency, total product amount, purification efficiency, etc. during the time-of-flight mass spectrometry detection test, provides necessary quality supervision for the quality control of the time-of-flight nucleic acid mass spectrometry test, and ensures the validity and reliability of the detection results.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to a quality control method for a time-of-flight mass spectrometry test. Background Art

[0002] Time-of-flight nucleic acid mass spectrometry is an efficient, high-throughput, multi-gene, multi-site mass spectrometry detection technology. This technology has the advantages of high accuracy and high sensitivity by accurately detecting nucleotide polymorphisms in sample nucleic acids. In the field of biological detection, time-of-flight nucleic acid mass spectrometry has gradually become an important tool for researchers and clinical laboratories due to its powerful analytical capabilities and broad application prospects. Its applications include genomic research, disease diagnosis, and personalized medicine. However, although this technology has significant advantages in theory, it still faces some challenges in its practical application.

[0003] The process of existing time-of-flight nucleic acid mass spectrometry detection technology includes sample nucleic acid processing, nucleic acid purification and mass spectrometry detection. First, in the sample processing stage, the sample nucleic acid needs to be amplified and extended in order to obtain a sufficient sample volume. However, due to individual differences in sample concentration, the uncertainty factor of sample concentration during the processing is difficult to control. Subsequently, the nucleic acid is purified to remove residual salt ions during the processing to avoid interference with the mass spectrometry detection results. However, the difference in nucleic acid mass makes it impossible to accurately analyze its impact on the quality of the mass spectrometry test even if the adduct peak is detected. Finally, the purified nucleic acid sample is loaded onto a mass spectrometry chip for detection, but due to the differences in nucleic acid mass spectrometry chips and the stability of the time-of-flight mass spectrometry device, the results of each test are not ideal.

[0004] In the prior art, although standardized test operation procedures have been developed to ensure the effectiveness of the test, in actual operation, the necessary quality control means and data monitoring measures are lacking. This means that in the entire test process, the quality of each key link cannot be effectively monitored and controlled. For example, in the sample processing stage, due to the uncertainty of sample concentration, it is difficult to ensure the effectiveness of the amplification and extension process. Similarly, in the nucleic acid purification stage, due to the difference in nucleic acid quality, it is impossible to accurately evaluate the impact of the addition peak. In the mass spectrometry detection stage, due to the differences in chips and mass spectrometry devices, the results of each test may be affected by uncontrollable factors.

[0005] In summary, the existing time-of-flight nucleic acid mass spectrometry detection technology has obvious quality control deficiencies in multiple links. The sample processing link lacks effective monitoring methods and cannot ensure the effectiveness of sample processing; the nucleic acid purification link makes it difficult to accurately assess the impact of residues on the quality of mass spectrometry tests; the mass spectrometry detection link has unstable test results due to differences in devices and chips. All of these problems point to significant defects in the quality control of existing technologies, and further technical improvements and improved quality control measures are urgently needed to improve the effectiveness and reliability of time-of-flight nucleic acid mass spectrometry detection. Summary of the invention

[0006] In order to solve the above problems, the present invention provides a time-of-flight mass spectrometry test quality control method, comprising:

[0007] Mixing a multi-component quality control substance with a target sample to be tested, and simultaneously performing a nucleic acid mass spectrometry test to obtain a test result; the multi-component quality control substance includes at least one of an amplification component, an extension component, and a detection component;

[0008] Determine the position of the mass spectrum peak generated by the multi-component quality control substance in the test result within the detection area, and perform quality control combination analysis based on the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area to determine the quality control result.

[0009] Preferably, the detection area range includes the claimed mass range of the nucleic acid mass spectrometry testing equipment and the quality control range.

[0010] Preferably, the quality control range includes an extended mass range outside the declared mass range in the detection region.

[0011] Preferably, the extended mass range comprises at least one of a first extended mass range and a second extended mass range;

[0012] The first extended mass range is a mass-to-charge ratio interval with a low mass-to-charge ratio lower than the claimed mass range;

[0013] The second extended mass range is a mass-to-charge ratio interval with a high mass-to-charge ratio higher than the declared mass range.

[0014] Preferably, the quality control range also includes a third temporary quality range;

[0015] The third provisional mass range is within the mass-to-charge ratio interval of the declared mass range.

[0016] Preferably, performing quality control combined analysis based on the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area to determine the quality control result includes:

[0017] Determining whether the position of the mass spectrum peak generated by the multi-component quality control substance is within the quality control range within the detection region;

[0018] If so, the quality control result is that the nucleic acid mass spectrometry test meets the quality control conditions;

[0019] If not, the quality control result is that the nucleic acid mass spectrometry test does not meet the quality control conditions.

[0020] Preferably, the multi-component quality control substance is a substance prepared from artificially synthesized oligonucleotides;

[0021] The mass spectrum peaks generated by the multi-component quality control substance can be distributed in the quality control range, but the mass spectrum peaks do not overlap with each other;

[0022] The distance between the mass spectrum peaks generated by the multi-component quality control substance is not less than the minimum single base extension distance of each mass spectrum peak;

[0023] The oligonucleotide comprises at least one of a random sequence, a specific double-stranded oligonucleotide sequence and a single-stranded oligonucleotide sequence.

[0024] Preferably, the amplification components include:

[0025] A1.1, A1.2 ... A1.n chemically synthesized double-stranded oligonucleotide sequences are used as templates for amplification reactions, and A2.1, A2.2 ... A2.m single-stranded oligonucleotide sequences are used as paired primers for the amplification reaction of A1.n.

[0026] Preferably, the paired primers consist of an amplification primer segment and a weight primer;

[0027] The sequence length of the amplification primer segment ranges from 10nt to 35nt;

[0028] The sequence length of the weighted primer is not less than 5 nt;

[0029] The molecular weight of the paired primers exceeds the extended mass range and the declared mass range.

[0030] Preferably, the extension component comprises:

[0031] Using multiple single-stranded oligonucleotide sequences B1, B2, ...Bk as extension primers;

[0032] Wherein, the Bk extension target sequence is a part of the double-stranded sequence of A1.n in the amplification component; and the Bk extension target sequence is not the same as A1.n.

[0033] Preferably, the extension primer and the mass spectrum peak generated by the extension primer are within the quality control range;

[0034] The extension primer can be modified and / or weighted;

[0035] The sequence length of the weighted primer of the extension primer weight is not less than 5 nt.

[0036] The detection components include: C1, C2, ...Ch detection oligonucleotide sequences of one type and multiple random sequences;

[0037] Among them, Ch is different from A1.n, A2.m, and Bk, and does not constitute base matching and sequence matching.

[0038] Preferably, the mass spectrum peak generated by the detection oligonucleotide sequence in the detection component is within the quality control range;

[0039] The detection oligonucleotide sequence in the detection component can be modified and / or weighted;

[0040] The sequence length of the weighted primer weighted by the detection oligonucleotide sequence in the detection component is not less than 5 nt.

[0041] Preferably, the step of mixing the multi-component quality control substance with the target sample and simultaneously performing a nucleic acid mass spectrometry test comprises:

[0042] Adding A1.n and the paired primer A2.m, which are used as a template for amplification reaction, to the amplification reaction system together with the target sample to be tested during the amplification reaction to carry out the amplification reaction;

[0043] Adding the extension primer Bk in the extension component to the extension reaction system during the single base extension reaction to perform an extension reaction, wherein the number of mass spectrum peaks generated during nucleic acid mass spectrometry detection is no greater than 2×k;

[0044] The Ch quality control substance in the detection component is added to the reaction system at the end of the extension reaction, the nucleic acid sample is purified, and the nucleic acid mass spectrometry test is performed.

[0045] Preferably, the mass spectrometry peak generated by the extension primer Bk is labeled as Pk;

[0046] The peak generated by the extension reaction of the extension primer Bk is marked as Qk;

[0047] The h mass spectrum peaks generated by Ch quality control materials during nucleic acid mass spectrometry testing are marked as Rh;

[0048] The relative positions of the mass spectrum peaks Pk, Qk, and Rh in the quality control range do not overlap; and the mass spectrum peaks Pk and Qk differ by at least one nucleotide in molecular weight.

[0049] Preferably, the method of determining whether the position of the mass spectrum peak generated by the multi-component quality control substance within the detection region is within the quality control range further comprises:

[0050] Determining whether the mass spectrum peak generated by the multi-component quality control substance is a valid mass spectrum peak;

[0051] If the mass spectrum peak generated by the multi-component quality control substance is a valid mass spectrum peak, a step is performed to determine whether the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area is within the quality control range.

[0052] Preferably, the determination condition of the effective mass spectrum peak is:

[0053] If the mass spectrum peak generated by the multi-component quality control substance satisfies all of the following conditions at the same time, the mass spectrum peak is determined to be the valid mass spectrum peak:

[0054] A. The signal-to-noise ratio of the mass spectrum peak is not less than 3;

[0055] B. The resolution of the mass spectrum peak is not less than the ratio of the mass-to-charge ratio of each mass spectrum peak to the minimum single-base extension distance of each mass spectrum peak.

[0056] The present invention provides a time-of-flight mass spectrometry test quality control method, comprising: mixing a multi-component quality control substance with a target sample to be tested, and simultaneously performing a nucleic acid mass spectrometry test to obtain a test result; the multi-component quality control substance includes at least one of an amplification component, an extension component, and a detection component; determining the position of a mass spectrum peak generated by the multi-component quality control substance in the test result within the detection region, and performing a quality control combination analysis based on the position of the mass spectrum peak generated by the multi-component quality control substance within the detection region to determine the quality control result. The time-of-flight mass spectrometry test quality control method provided by the present invention, by mixing a multi-component quality control substance with a target sample to be tested during the time-of-flight mass spectrometry test and simultaneously performing a nucleic acid mass spectrometry test, and determining the quality control result based on the position of the mass spectrum peak generated by the multi-component quality control substance within the detection region, realizes the monitoring of the quality control data of the detection process such as sample nucleic acid processing, ionization efficiency, total product amount, purification efficiency, etc. during the time-of-flight mass spectrometry detection test, provides necessary quality supervision for the quality control of the time-of-flight nucleic acid mass spectrometry test, and ensures the validity and reliability of the detection results. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 It is a schematic diagram of the mass range of the time-of-flight nucleic acid mass spectrometry in the quality control method of the time-of-flight mass spectrometry test of the present invention;

[0058] Figure 2 It is a schematic diagram of the time-of-flight nucleic acid mass spectrometry test process in the time-of-flight mass spectrometry test quality control method of the present invention;

[0059] Figure 3 A schematic diagram of the results of an embodiment of a time-of-flight mass spectrometry test quality control method of the present invention;

[0060] Figure 4 This is a schematic diagram of the effectiveness analysis of sample nucleic acid treatment in an embodiment of the time-of-flight mass spectrometry test quality control method of the present invention;

[0061] Figure 5 This is a schematic diagram of ionization efficiency analysis in an embodiment of a time-of-flight mass spectrometry quality control method of the present invention;

[0062] Figure 6 Schematic diagram of purification efficiency analysis in an embodiment of the time-of-flight mass spectrometry quality control method of the present invention. DETAILED DESCRIPTION

[0063] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0064] The present application provides a time-of-flight mass spectrometry test quality control method, comprising:

[0065] Step S1, mixing a multi-component quality control substance with a target sample, and simultaneously performing a nucleic acid mass spectrometry test to obtain a test result; the multi-component quality control substance includes at least one of an amplification component, an extension component, and a detection component;

[0066] Step S2, determining the position of the mass spectrum peak generated by the multi-component quality control substance in the test result within the detection area, and performing quality control combination analysis according to the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area to determine the quality control result.

[0067] As mentioned above, when Time-of-Flight Mass Spectrometry (TOF-MS) analyzes a sample, it will output a spectrum with mass-to-charge ratio (m / z) as the horizontal axis and peak intensity (usually expressed as peak height or area) as the vertical axis. This spectrum can help analyze the molecular composition of a compound. By measuring the mass-to-charge ratio and corresponding abundance of different molecular ions, different components in the sample can be identified and quantified. Each peak represents a specific ion, and the height or area of ​​the peak reflects the relative abundance of the ion.

[0068] The detection region range mentioned above refers to the detection region within the entire mass-to-charge ratio range in the spectrum.

[0069] The target sample to be tested is a sample that needs to be tested using a time-of-flight mass spectrometer.

[0070] As described above, the multi-component quality control substance is mixed with the target sample to be tested and a nucleic acid mass spectrometry test is performed together. During the nucleic acid mass spectrometry test, the mass spectrum peak of the target sample to be tested and the mass spectrum peak generated by the multi-component quality control substance will appear in the detection area.

[0071] When preparing multi-component quality control substances, the concentration of the quality control substances should be determined according to the parameters of the time-of-flight nucleic acid mass spectrometer. The quality control substances should be as pure as possible to participate in the reaction system of nucleic acid sample processing. Generally, the purity of artificially synthesized oligonucleotide sequences is generally not less than 90%, 95%, 98%, and 99%; in a preferred embodiment, artificially synthesized oligonucleotides with a purity greater than 95% are used as quality control substances.

[0072] In the detection area, quality control combined analysis is performed through the specific positions of the mass spectrum peaks produced by the multi-component quality control substances to determine the quality control results.

[0073] In the process of nucleic acid analysis using time-of-flight mass spectrometry (TOF-MS), the integration of amplification components, extension components, and detection components as quality control substances is to improve the accuracy, reliability, and reproducibility of the experiment. Each component has its own unique function and purpose, ensuring that mass spectrometry analysis can comprehensively and accurately evaluate the quality and composition of the sample.

[0074] As mentioned above, the detection of the target sample may include but is not limited to the combined analysis of its mass-to-charge ratio, peak height, signal-to-noise ratio, and resolution data to report the quality control results of the time-of-flight nucleic acid mass spectrometry test.

[0075] As mentioned above, the quality control combined analysis of the nucleic acid mass spectrometry detection process may include but is not limited to manual calculation analysis based on mass spectrometry peaks, data and / or reports automatically calculated by software.

[0076] In the embodiment of the present application, the technical solution is that during the nucleic acid mass spectrometry test, it is necessary to monitor the nucleic acid mass spectrometry test process by adding quality control substances and performing the nucleic acid mass spectrometry test synchronously according to the test process. Specifically, during the time-of-flight mass spectrometry test, the multi-component quality control substances are mixed with the target sample to be tested and the nucleic acid mass spectrometry test is performed synchronously, and the quality control results are determined by the position of the mass spectrum peak generated by the multi-component quality control substances within the detection area, thereby realizing the monitoring of the quality control data of the detection process such as sample nucleic acid processing, ionization efficiency, total product amount, purification efficiency, etc. during the time-of-flight mass spectrometry detection test, providing necessary quality supervision for the quality control of the time-of-flight nucleic acid mass spectrometry test, and ensuring the validity and reliability of the detection results.

[0077] For further reference, Figure 1The detection area range includes the claimed quality range of the nucleic acid mass spectrometry testing equipment and the quality control range.

[0078] There are still some quality ranges outside the claimed quality range, e.g. Figure 1 The intervals shown in ① and ② can be detected by hardware and software but are not covered by the claimed quality range, which is called the extended quality range. The technical solution of the present invention is used for quality control monitoring.

[0079] It should be noted that the claimed mass range refers to the mass-to-charge ratio (m / z) range of ions that the mass spectrometer manufacturer or application instructions indicate the device can detect. This range describes the mass of the lightest and heaviest ions that the device can cover and is an important indicator of device performance.

[0080] In nucleic acid mass spectrometry testing, the claimed mass range is particularly important because it determines the size of nucleic acid molecules that the device can detect. Nucleic acid molecules (such as DNA and RNA fragments) may have a mass range from a few hundred to thousands or even tens of thousands of Daltons (Da), and different devices may be suitable for analyzing nucleic acids of different lengths. For example, some high-resolution mass spectrometry devices can accurately analyze long-chain nucleic acid molecules, while other devices may be more suitable for analyzing shorter fragments.

[0081] Therefore, the claimed mass range can help users select an instrument that is suitable for their specific application needs and ensure that the instrument will provide reliable and accurate results within its claimed mass range.

[0082] As mentioned above, the time-of-flight nucleic acid mass spectrometry device is continuous in the time domain space during detection because of the uninterrupted nature of the flight time, and its mass-to-charge ratio value is continuous within the mass range, and the claimed mass range is generally 3000 (m / z) to 7000 (m / z), 5000 (m / z) to 8000 (m / z), 5000 (m / z) to 10000 (m / z), 4000 (m / z) to 10000 (m / z). In the embodiments of the present application, the mass range is claimed to be 4000 (m / z) to 10000 (m / z).

[0083] The quality control range mentioned above is the range used to perform quality control on the test results, and its range may intersect, overlap, or be different from the claimed quality range.

[0084] Furthermore, the quality control range includes an extended mass range outside the claimed mass range in the detection area.

[0085] The above-mentioned quality control range includes an extended quality range, which is an area outside the claimed quality range. That is, the extended quality range does not overlap or intersect with the claimed quality range, and the extended quality range is an area different from the claimed quality range.

[0086] Further, the extended mass range includes at least one of a first extended mass range and a second extended mass range;

[0087] The first extended mass range is a mass-to-charge ratio interval with a low mass-to-charge ratio lower than the claimed mass range;

[0088] The second extended mass range is a mass-to-charge ratio interval with a high mass-to-charge ratio higher than the declared mass range.

[0089] The extended mass range may include at least one of a first extended mass range and a second extended mass range; for example, the extended mass range may include the following situations:

[0090] (1) The extended mass range only has the first extended mass range;

[0091] (2) The extended mass range only has the second extended mass range;

[0092] (3) The extended mass range includes a first extended mass range and a second extended mass range.

[0093] The first extended mass range is a mass-to-charge ratio interval with a low mass-to-charge ratio lower than the claimed mass range; and the second extended mass range is a mass-to-charge ratio interval with a high mass-to-charge ratio higher than the claimed mass range.

[0094] In the detection area range of a detection result, the horizontal axis may be a horizontal axis with a mass-to-charge ratio of 0 m / z as the base point and gradually extending to nm / z, and on the horizontal axis, a region ab m / z is set in the middle as the claimed mass range;

[0095] The maximum value of the first extended mass range is not greater than the minimum value a of the claimed mass range, and the minimum value of the second extended mass range is not less than the maximum value b of the claimed mass range. Therefore, in the spectrum, when the base point 0 is on the left, the first extended mass range is on the left side of the claimed mass range, and the second extended mass range is on the right side of the claimed mass range.

[0096] Further, the quality control range also includes a third temporary quality range;

[0097] The third provisional mass range is within the mass-to-charge ratio interval of the declared mass range.

[0098] As mentioned above, within the claimed mass range, part of the claimed mass range can be defined as the third temporary mass range according to different detected objects. The third temporary mass range is also applicable to the quality control combination analysis of multi-component quality control substances.

[0099] As mentioned above, the interval of the residual mass-to-charge ratio outside the claimed mass range according to the characteristics of different time-of-flight mass spectrometers is as follows Figure 1 As shown, ① the mass-to-charge ratio interval is called the first extended mass range, and ② the mass-to-charge ratio interval is called the second extended mass range. The mass-to-charge ratio width of the first extended mass range is generally from several hundred mass-to-charge ratios to two thousand mass-to-charge ratios, or even larger, and the mass-to-charge ratio width of the second extended mass range is generally from several hundred mass-to-charge ratios to two thousand mass-to-charge ratios, or even larger.

[0100] The first extended mass range and the second extended mass range can, but need not necessarily, be used as quality monitoring independent of a specific test application. Figure 1 In the mass-to-charge ratio range, ③ is within the claimed mass range and is generally used for testing the object being measured. However, when the mass spectrum peak of a specific object being measured does not use the mass-to-charge ratio of ③, a third temporary mass range can be added for specific applications for quality control monitoring of the specific object being measured.

[0101] In a specific embodiment, the time-of-flight nucleic acid mass spectrometry device has a claimed mass range of 3000 (m / z) to 7000 (m / z). 2000 (m / z) to 3000 (m / z) can be set as the first extended mass range, and 7000 (m / z) to 9000 (m / z) can be set as the second extended mass range. Because 3000 (m / z) to 7000 (m / z) is only 4000 (m / z) wide and relatively narrow, the third temporary mass range is not set in this embodiment.

[0102] In a specific embodiment, a time-of-flight nucleic acid mass spectrometer device has a claimed mass range of 4000 (m / z) to 10000 (m / z). 2000 (m / z) to 4000 (m / z) can be set as a first extended mass range, and 10000 (m / z) to 12000 (m / z) can be set as a second extended mass range. This is because 4000 (m / z) to 10000 (m / z) has a width of 6000 (m / z), which is relatively wide. Under specific experimental conditions, it was found that the region of 5500 (m / z) to 6500 (m / z) was not used in a specific experiment. In this embodiment, a third temporary mass range of 5500 (m / z) to 6500 (m / z) can be, but not necessarily, formulated based on the specific application.

[0103] Furthermore, the step S2, performing quality control combined analysis according to the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area to determine the quality control result, includes:

[0104] Step S21, determining whether the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area is within the quality control range;

[0105] Step S22: If yes, the quality control result is that the nucleic acid mass spectrometry test meets the quality control conditions;

[0106] Step S23: If not, the quality control result is that the nucleic acid mass spectrometry test does not meet the quality control conditions.

[0107] As mentioned above, the mass spectrum peaks generated by the multi-component quality control substance may be one or more. Each mass spectrum peak is required to be distributed within the quality control range.

[0108] When conducting a test, a quality control combination analysis is performed, and it is necessary to first determine whether the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area falls within the quality control range. If it falls within the quality control range, the quality control result is that the nucleic acid mass spectrometry test meets the quality control conditions; if it does not fall within the quality control range, but exceeds the quality control range, the quality control result is that the nucleic acid mass spectrometry test does not meet the quality control conditions.

[0109] Furthermore, the multi-component quality control substance is a substance prepared from artificially synthesized oligonucleotides.

[0110] As described above, in the embodiments of the present application, a synchronous quality detection method is provided in which a multi-component quality control material constructed by artificially synthesized oligonucleotides is mixed with a target sample to be tested and a nucleic acid mass spectrometry test is performed simultaneously. Quality control of the nucleic acid mass spectrometry detection process is performed based on the quality control material detection data, thereby revealing a method for synchronous quality control of time-of-flight nucleic acid mass spectrometry.

[0111] As mentioned above, the substances used for quality control are composed of artificially synthesized oligonucleotides. Oligonucleotides are shorter nucleotide chains, usually composed of a few to dozens of nucleotides. These oligonucleotides can be precisely synthesized to have a specific sequence and length, making them ideal standard substances or quality control samples.

[0112] In mass spectrometry analysis, especially in nucleic acid mass spectrometry analysis, using these synthetic oligonucleotides as quality control materials can help ensure the accuracy and repeatability of the experiment. By comparing the results of the test sample with the results of the oligonucleotide quality control material of known mass and composition, the experimenter can verify whether the performance of the mass spectrometry equipment meets the requirements and whether the analysis method is stable and reliable.

[0113] This practice of using artificially synthesized oligonucleotides is very common in fields such as bioanalysis, genetic research, and clinical testing because they provide a highly standardized and predictable way to monitor and verify the quality of analytical processes.

[0114] As mentioned above, the multi-component quality control material in the embodiment of the present application is artificially synthesized, which can effectively control the concentration, purity and sequence of the quality control material. The sequence adopts a random sequence and is compared with the NCBI human gene database to find no homology, so as to avoid reaction with biological nucleic acid samples.

[0115] The mass spectrum peaks generated by the multi-component quality control substance can be distributed in the quality control range, but the mass spectrum peaks do not overlap with each other;

[0116] The distance between the mass spectrum peaks generated by the multi-component quality control substance is not less than the minimum single base extension distance of each mass spectrum peak;

[0117] As mentioned above, it is critical that mass spectrometry peaks do not overlap, as overlapping peaks will affect peak resolution and quantitative analysis. If two or more mass spectrometry peaks overlap, their mass-to-charge ratios (m / z) and signal intensities will be mixed together, which will lead to uncertainty and inaccuracy in the analysis results. In order to ensure that each peak can be clearly identified and quantified, sufficient spacing must be maintained between peaks.

[0118] As mentioned above, the distance between mass spectrometry peaks is not less than the minimum single base extension distance: this requirement ensures that even substances with very close molecular weights can be effectively distinguished. Single base extension usually refers to the mass change caused by adding a base in a nucleic acid sequence. In mass spectrometry, this tiny mass difference requires sufficient resolution to accurately distinguish. If the distance between mass spectrometry peaks is too small, the resolution of the equipment may not be enough to distinguish multiple substances that are closely arranged, thus affecting the accuracy of the analysis.

[0119] By ensuring that there is sufficient spacing between mass spectrometry peaks and that each peak is clearly distinguishable, the reliability and reproducibility of the test can be improved. In addition, this strategy helps to monitor the accuracy of the entire mass spectrometry process using quality control materials, including sample handling, ionization efficiency, total product amount, and purification efficiency.

[0120] In addition, multi-component quality control materials constructed using oligonucleotides can provide dedicated reference standards for each specific test. These materials are designed to produce peaks at different positions in the mass range, thus providing comprehensive quality control coverage for the analysis. This approach not only increases the complexity of the experiment, but also improves the rigor and systematicity of quality control, ensuring that each experiment is carried out under precisely controlled conditions.

[0121] The oligonucleotide comprises at least one of a random sequence, a specific double-stranded oligonucleotide sequence and a single-stranded oligonucleotide sequence.

[0122] As mentioned above, the oligonucleotide may include but is not limited to: at least one of a random sequence, a double-stranded oligonucleotide sequence with a preset sequence, and a single-stranded oligonucleotide sequence.

[0123] Further, the amplification components include:

[0124] A1.1, A1.2 ... A1.n chemically synthesized double-stranded oligonucleotide sequences are used as templates for amplification reactions, and A2.1, A2.2 ... A2.m single-stranded oligonucleotide sequences are used as paired primers for the amplification reaction of A1.n.

[0125] Furthermore, the paired primers consist of an amplification primer segment and a weight primer;

[0126] The sequence length of the amplification primer segment ranges from 10nt to 35nt;

[0127] The sequence length of the weighted primer is not less than 5 nt;

[0128] The molecular weight of the paired primers exceeds the extended mass range and the declared mass range.

[0129] As mentioned above, the amplification components include chemically synthesized double-stranded oligonucleotide sequences as amplification reaction templates, using precisely synthesized double-stranded DNA as templates to ensure sequence accuracy and consistency. Chemical synthesis allows for precise control of the length and sequence of the template, which helps achieve highly reproducible experimental conditions and improves amplification efficiency and consistency.

[0130] The above amplification components also include single-stranded oligonucleotide sequences as paired primers, which are used to perform PCR amplification on specific double-stranded template sequences. The paired primers (forward and reverse) specifically recognize and bind to the complementary sequence of the template DNA, initiating the DNA replication process.

[0131] The paired primers consist of an amplification primer segment and a weighted primer segment. The amplification primer segment is responsible for specifically binding to the target DNA sequence, while the weighted primer segment is used to adjust the mass and physical properties of the entire primer molecule. The weighted portion can change the overall molecular weight of the primer to adapt it to specific mass spectrometry analysis requirements.

[0132] The sequence length of the amplification primer segment is 10nt-35nt. This length range is based on ensuring sufficient binding specificity and thermal stability while avoiding non-specific binding that may be caused by overly long sequences. Shorter primers (10nt) may be used for amplification of short sequences that require high specificity, while longer primers (35nt) provide stronger binding and higher thermal stability. For example, it can be 10 nt, 15 nt, 20 nt, 25 nt, 30 nt, 35 nt, and so on.

[0133] The sequence length of the weighted primer is no less than 5 nt, which helps ensure that the primer has sufficient molecular weight for effective detection in mass spectrometry. This design can make the primer behavior more stable and predictable during mass spectrometry analysis.

[0134] The molecular weight of the paired primers exceeds the extended mass range and the claimed mass range, that is, the mass of the primers is set to exceed the conventional analysis range, which is done to avoid overlap or confusion between the primers and other components in the sample in the mass spectrum. By designing the primers to have a larger or smaller molecular weight, it can be ensured that they are clearly distinguished in the mass spectrometry analysis, thereby not interfering with the mass spectrometry signal of the actual sample.

[0135] Together, these design features improve experimental accuracy and reproducibility, ensuring the quality and reliability of critical data in mass spectrometry analysis.

[0136] Further, the extension component includes:

[0137] Using multiple single-stranded oligonucleotide sequences B1, B2, ...Bk as extension primers;

[0138] Wherein, the Bk extension target sequence is a part of the double-stranded sequence of A1.n in the amplification component; and the Bk extension target sequence is not the same as A1.n.

[0139] Further, the extension primer and the mass spectrum peak generated by the extension primer are within the quality control range;

[0140] The extension primer can be modified and / or weighted;

[0141] The sequence length of the weighted primer of the extension primer weight is not less than 5 nt.

[0142] As mentioned above, the extension component contains specific single-stranded oligonucleotide sequences, which are used as extension primers, and the target is the double-stranded DNA produced in the amplification component. In the single base extension reaction, these primers will bind to the amplified DNA template and extend, generating DNA fragments containing new bases.

[0143] Extension reactions allow for more detailed analysis of specific nucleic acid sequences, enhancing the ability to identify genetic variations such as single base polymorphisms (SNPs). In addition, the specificity and accuracy of the reaction can be controlled by specific extension primers.

[0144] As mentioned above, the extension components include but are not limited to multiple single-stranded oligonucleotide sequences B1, B2, ... Bk as extension primers, and the Bk extension target sequence is a part of the double strand of A1.n, which is allowed to have partial sequence overlap with A2.m, but is not completely identical to A2.m;

[0145] As mentioned above, the mass spectrometry peaks generated by the extension primer and the extension product are limited to the extended mass range, and the extension primer can be but does not have to be modified, does not contain other chemical and biological modifications and / or weights, and the sequence length of the weighted primer is at least 5 nt.

[0146] Further, the detection components include: C1, C2, ...Ch detection oligonucleotide sequences of one type with multiple random sequences;

[0147] Among them, Ch is different from A1.n, A2.m, and Bk, and does not constitute base matching and sequence matching.

[0148] Further, the mass spectrum peak generated by the detection oligonucleotide sequence in the detection component is within the quality control range;

[0149] The detection oligonucleotide sequence in the detection component can be modified and / or weighted;

[0150] The sequence length of the weighted primer weighted by the detection oligonucleotide sequence in the detection component is not less than 5 nt.

[0151] As mentioned above, the detection components include but are not limited to a detection oligonucleotide sequence of multiple random sequences of one type, C1, C2, ...Ch, Cn is different from the aforementioned A1.n, A2.m, Bk, and does not constitute base mutual matching or sequence mutual matching; the mass spectrum peak generated by the detection oligonucleotide sequence is limited to the extended mass range, and can be but not necessarily modified or weighted, and the sequence length of the weighted primer is at least 5nt;

[0152] As mentioned above, the detection component includes a series of oligonucleotide sequences designed for direct detection in mass spectrometry analysis. These sequences can be specially labeled or modified to facilitate identification in mass spectrometry.

[0153] Providing a direct mass spectrometry target, enabling accurate quantification and analysis of specific nucleic acid fragments. By comparing the performance of the detected components in the mass spectrometer, the quality control standards of the samples can be effectively evaluated.

[0154] In a specific embodiment, one of the double-stranded DNA sequences of A1.n of amplification component A may be but need not be an A1.1 fragment; the A1.m paired primer may be but need not be A1.1-F / A1.1-R; wherein "ACGTTGGATG" is a primer weight sequence, which does not participate in the amplification reaction but can increase the molecular weight of the primer so that the mass spectrum peak of the primer is not displayed within the declared mass range and extended mass range of the nucleic acid mass spectrum.

[0155] Furthermore, the step S1, mixing the multi-component quality control substance with the target sample to be tested, and simultaneously performing a nucleic acid mass spectrometry test, includes:

[0156] Step S11, adding A1.n and the paired primer A2.m, which are used as a template for amplification reaction, to an amplification reaction system together with the target sample to be tested during the amplification reaction;

[0157] Step S12, adding the extension primer Bk in the extension component to the extension reaction system during the single base extension reaction to perform an extension reaction, and the number of mass spectrum peaks generated during nucleic acid mass spectrometry detection is no more than 2×k;

[0158] Step S13, adding the Ch quality control substance in the detection component to the reaction system at the end of the extension reaction, purifying the nucleic acid sample, and performing a nucleic acid mass spectrometry test.

[0159] As mentioned above, generally, when the A1.n and A2.m quality control substances are subjected to amplification reaction, they are added to the amplification reaction system for amplification reaction in the same manner as the samples, and when the Bk is subjected to single base extension reaction, it is added to the extension reaction system for extension reaction, and no more than 2×k mass spectrum peaks will be generated during nucleic acid mass spectrometry detection.

[0160] Further, the mass spectrum peak generated by the extension primer Bk is labeled as Pk;

[0161] The peak generated by the extension reaction of the extension primer Bk is marked as Qk;

[0162] The h mass spectrum peaks generated by Ch quality control materials during nucleic acid mass spectrometry testing are marked as Rh;

[0163] The relative positions of the mass spectrum peaks Pk, Qk, and Rh in the quality control range do not overlap; and the mass spectrum peaks Pk and Qk differ by at least one nucleotide in molecular weight.

[0164] The mass spectrometry peak generated by the Bk primer is marked as Pk, and the peak generated by the Bk extension reaction is marked as Qk. The Ch quality control substance is added to the reaction system at the end of the extension reaction to purify the nucleic acid sample. During the nucleic acid mass spectrometry detection, h mass spectrometry peaks are generated and marked as Rh. The quality control results of the time-of-flight nucleic acid mass spectrometry test are reported by combining and analyzing the mass-to-charge ratio, peak height, signal-to-noise ratio, and resolution data of the Pk, Qk, and Rh mass spectrometry peaks in the extended mass range without overlapping relative positions.

[0165] As mentioned above, there should be a molecular weight difference of at least one nucleotide between the mass spectrum peaks Pk and Qk. The greater the peak height of Pk, the less nucleic acid is present during the nucleic acid treatment, and the smaller the peak height of Pk, the more nucleic acid is present during the nucleic acid treatment.

[0166] As mentioned above, Qk generally has an opposite trend to Pk. The larger the peak height of Qk, the more sufficient the nucleic acid is during the nucleic acid treatment, and the smaller the peak height of Qk, the less nucleic acid is during the nucleic acid treatment. Qk / Pk or Pk / Qk can be but not necessarily used to illustrate the effectiveness of nucleic acid treatment.

[0167] As mentioned above, the peak height of Rh indicates the relative ionization efficiency during the time-of-flight mass spectrometry experiment, especially the weighted average of multiple Rh peak heights, which can better illustrate the relative ionization efficiency during the time-of-flight mass spectrometry experiment.

[0168] As mentioned above, the ratio of the peak height of Rh to the peak height of Qk and the peak height of Pk indicates the relative total amount of product, especially the weighted average of the peak height of Rh / (the weighted average of the peak height of Qk or / and the weighted average of the peak height of Pk) indicates the relative total amount of product.

[0169] It should be noted that the addition peak of metal cations sometimes appears on the right side of the mass-to-charge ratio of each mass spectral peak of Pk, Qk, and Rh. When the sample nucleic acid is purified, the better the purification effect, the lower the peak height of the addition peak, and vice versa. In particular, the weighted average of the peak heights of the addition peaks of each mass spectral peak can better illustrate the purification effect.

[0170] In addition, during the quality control process, step S21 determines whether the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area is within the quality control range; step S22, if yes, the quality control result is that the nucleic acid mass spectrometry test meets the quality control conditions; step S23, if no, the quality control result is that the nucleic acid mass spectrometry test does not meet the quality control conditions. Specifically, when the mass spectrum peaks generated by the multi-component quality control substance include Pk, Qk, Rh and other mass spectrum peaks, and the quality control range includes the first extended mass range, the second extended mass range, and the third temporary mass range, the mass spectrum peaks such as Pk, Qk, Rh can be analyzed separately as follows when judging:

[0171] (1) Each mass spectrum peak of Rh is preferably distributed in the first extended mass range, the second extended mass range, or one of the third temporary mass range; in a preferred technical solution, each mass spectrum peak of Rh has at least one mass spectrum peak distributed in the first extended mass range or the second extended mass range;

[0172] (2) The mass spectrum peaks of Pk and Qk are preferably distributed in the second extended mass range, the first extended mass range or the third temporary mass range.

[0173] Furthermore, the step S21, determining whether the position of the mass spectrum peak generated by the multi-component quality control substance within the detection region is before the quality control range, further includes:

[0174] Step S24, determining whether the mass spectrum peak generated by the multi-component quality control substance is a valid mass spectrum peak;

[0175] Step S25, if the mass spectrum peak generated by the multi-component quality control substance is a valid mass spectrum peak, proceed to step S21 to determine whether the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area is within the quality control range.

[0176] As mentioned above, before further quality control is performed, that is, before determining whether the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area is within the quality control range, it is first necessary to determine whether the mass spectrum peak is a valid mass spectrum peak.

[0177] First, determine whether it is a valid mass spectrum peak in order to avoid errors and misjudgments caused by invalid peaks, thereby ensuring the accuracy of quality control analysis results. The purpose of this is to eliminate the interference of noise and invalid peaks, improve the accuracy and reliability of quality control analysis, and enable subsequent steps to be analyzed based on more reliable basic data to ensure the authenticity and credibility of the final analysis data. Through this step, the reliability of quality control results can be significantly improved, analytical deviations caused by invalid peaks can be avoided, and the signal-to-noise ratio and resolution of the mass spectrum peak can be ensured to meet the predetermined standards, thereby achieving high-quality mass spectrometry analysis.

[0178] In the above steps, first determine whether the mass spectrum peaks generated by the multi-component quality control substances are valid. The validity of these mass spectrum peaks needs to be judged by predefined standards (such as signal-to-noise ratio and resolution, etc.). If the mass spectrum peak is valid, proceed to the next step, otherwise no subsequent processing is performed, thereby eliminating the interference of invalid peaks and ensuring the accuracy and reliability of quality control analysis.

[0179] Specifically, this can be achieved by setting thresholds of the signal-to-noise ratio and the resolution.

[0180] If the mass spectrum peak generated by the multi-component quality control substance is not a valid mass spectrum peak, further judgment can be stopped. At the system level, a prompt message can be generated to explain the specific error cause. At the practical operation level, the experiment can be repeated or stopped according to the analysis situation and results. The step of determining whether the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area is within the quality control range.

[0181] Furthermore, the determination condition of the effective mass spectrum peak is:

[0182] If the mass spectrum peak generated by the multi-component quality control substance satisfies all of the following conditions at the same time, the mass spectrum peak is determined to be the valid mass spectrum peak:

[0183] A. The signal-to-noise ratio of the mass spectrum peak is not less than 3;

[0184] B. The resolution of the mass spectrum peak is not less than the ratio of the mass-to-charge ratio of each mass spectrum peak to the minimum single-base extension distance of each mass spectrum peak.

[0185] As mentioned above, the mass spectrum peak signal-to-noise ratio is not less than 3, and the resolution is not less than the ratio of the mass-to-charge ratio of each mass spectrum peak to the minimum single-base extension spacing of each mass spectrum peak is a valid mass spectrum peak, and all valid mass spectrum peaks can but do not have to be subjected to time-of-flight nucleic acid mass spectrometry test combined analysis.

[0186] As mentioned above, the signal-to-noise ratio calculation can be calculated by the ratio of signal strength to noise strength. For example, if the signal strength is 100 and the noise strength is 20, then the signal-to-noise ratio = 100 / 20 = 5, which meets the condition.

[0187] As mentioned above, resolution calculation: the resolution can be calculated by the ratio of the mass-to-charge ratio (m / z) to the minimum single-base extension distance. For example: the mass-to-charge ratio is 500, and the minimum single-base extension distance is 25, then the resolution = 500 / 25 = 20, which meets the conditions.

[0188] The present invention is further described below by means of specific examples, but it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0189] Embodiment 1:

[0190] In this example, a gas chromatography method was established to obtain the content values ​​of the main components of the whiskey sample to be tested.

[0191] Experimental methods:

[0192] Amplification component A is added to the sample treatment reaction system together with the sample nucleic acid before the amplification reaction, such as Figure 2 The method is as follows:

[0193] (1) Synthesize a random sequence A1.1 fragment with no homology to the human genome and specific primers A1.1-F / A1.1-R that match it.

[0194] The random sequence A1.1 fragment having no homology to the human genome is specifically (the nucleotide sequence is shown in SEQ ID NO.1):

[0195] TCAAACACCTGCTTGTCAGTCGGACATGATCACACAAAAGATTTTCGCTATCTGCCGACCGTGTCGAGGGGTAACTACGGGCATTCTAGTCGTGGGGCAGTTGTGTCCGCCACATTCAGCTGAGTACACTTATTCTATGTTACGTCGGTTCCGAGTCCCAGTCTGCGAATCCATC TTTCCCCGACGTAAAGTACTGAGTCTCCCACGACGTGTTTTTCGTATAGTAGGCCCTAGAACAGTTCCCACTCAAAGCAGTACGCCGGATGCCAGGTAGTATCATCGCAAGTAGGGCACATATTTCTGGGACTGGAAAATATTATTGACGGGCGAGCTAGACTATGTTAATTAATGT AAGCTAAGAGTCGCAGTTTAT TGAA TGAATATGCTGCGGAGTTTTTCGA TTCGGCACTCCTAGAATGGG GGTAAACCCGTGTAGACTAGATGTAACCCGGCTTGGCCGTACCTGGACTTT CGTAATTGCCTACACACTATACTCC AGGT.

[0196] Table 1. Synthetic single oligonucleotide sequences

[0197]

[0198] (2) Prepare a solution of fragment A1.1 at a concentration of 10 ng / μL with a purity of OD260 / OD280 of 1.8. Add 2 ng of fragment A1.1 to each reaction.

[0199] (3) Prepare 100 μM stock solution of primers A1.1-F / A1.1-R. Then add 5 μL of A1.1-F / A1.1-R to 1000 μL of the system to prepare primer working solution. Add 1 μL of primer working solution to each amplification reaction.

[0200] Embodiment 2:

[0201] In this embodiment, the extension component B cooperates with a partial sequence of the amplification component A to produce an extension product through an extension reaction. The single-stranded primer can be but is not necessarily B1. The extension component B is added to the sample treatment reaction system before the extension reaction, such as Figure 2 As shown, this embodiment is as follows:

[0202] (1) Synthesize extension primer B1 so that it can specifically bind to and extend the A1.1 fragment. The extension primer B1, with a molecular weight of 3277.18 Da and a sequence of CGGCACTCCTA, is prepared into a 500 μM stock solution;

[0203] (2) Then, add the amount of B1 according to the molecular weight of the extension primer, and then prepare the extension primer working solution. The amount of extension primer added to the 1000μL system is: 1.5μL for molecular weights of 4000Da~6000Da, 2μL for molecular weights of 6000Da~7000Da, and 3μL for molecular weights of 7000Da~10000Da. Add 0.94μL of extension primer working solution to each extension reaction.

[0204] Embodiment 3:

[0205] In this embodiment, the randomly generated and synthesized Ch single-stranded oligonucleotide sequence is added to the sample treatment reaction system as the detection component C after the extension reaction is completed. Figure 2 As shown, this embodiment is as follows:

[0206] (1) Synthesize a random sequence C1 with a molecular weight of 3847.57 Da and a sequence of CCATCCACTACAA. The HPLC purity is not less than 98%, and prepare it into a mother solution of 10 μM;

[0207] (2) Add 3 μL to the extension product, the final concentration is 0.085 μM. When the sample is transferred to a 384-well microplate, the amount of purified water added is 13 μL.

[0208] Embodiment 4:

[0209] In this embodiment, the multi-component quality control substances prepared above are added to the test in sequence according to the time-of-flight nucleic acid mass spectrometry test process. After the nucleic acid mass spectrometry test is completed, the test data and quality control data are obtained as follows: Figure 3 , effective mass spectral peaks were screened according to the mass spectral peak signal-to-noise ratio of not less than 3 and the resolution of not less than the ratio of the mass-to-charge ratio of each mass spectral peak to the minimum single-base extension distance of each mass spectral peak, and the quality control data could be further analyzed. The expected mass spectral peaks and mass-to-charge ratios are shown in Table 2.

[0210] Table 2. Molecular weight of each mass spectrometry peak during mass spectrometry detection

[0211]

[0212] In this embodiment, Qk / Pk is the effectiveness of nucleic acid treatment. The effectiveness of nucleic acid treatment of a certain group or several groups of Qk / Pk can be analyzed separately. Preferably, the average value of all Qk / Pk is greater than 0.15, which is considered to be effective. Figure 4 , this embodiment is as follows:

[0213] The Pk peak height is 5, the Qk peak height is 20, and Qk / Pk is 4 greater than 0.15, which means that the nucleic acid treatment is effective.

[0214] In this embodiment, the weighted average value of the Rh peak height is an ionization efficiency index, which can be used to analyze the ionization efficiency or efficiency of different well positions or / and different nucleic acid mass spectrometry tests in nucleic acid mass spectrometry tests. Figure 5 , this embodiment is as follows:

[0215] The weighted average of the Rh peak height / (the weighted average of the Qk peak height and / or the weighted average of the Pk peak height) and the weighted average of the Rh effective mass spectrum peak height relative to the product concentration can be used to analyze the reproducibility of the overall nucleic acid mass spectrometry system.

[0216] Specifically, the results of this embodiment are as follows: the Rh peak height is 60, the Qk and Pk peak heights are 35 and 5 respectively, the relative product concentration is 60 / (35+5)=1.5, or the relative product concentration is 60 / 35, or the relative product concentration is 60 / 5, the relative product concentration parameter quality control parameter depends on the quality control focus, and the preferred relative product concentration is 60 / (35+5)=1.5.

[0217] In this embodiment, common metal cations in nucleic acid mass spectrometry experiments include but are not limited to Na + (23Da), K + (39Da), Mg 2+ (24Da), Mn2 + (55Da), Ca 2+ (40Da), Ba 2+ (137Da), Al3 + (27Da), Fe2 + (56Da), Fe3 + (56Da), Zn2 + (65Da), C u2 + (64Da), Ag +(108Da) metal cation (the metal cation in brackets is the approximate reference molecular weight), the mass spectrum peak position of the rightward molecular weight of the Rh mass spectrum peak plus the mass spectrum peak position of the metal cation molecular weight, the cumulative value of the peak height of the addition peak formed by the metal cation and Ch, which can be but not necessarily calculated according to the peak height of the addition peak formed by each metal cation separately or / and a common metal cation / Rh mass spectrum peak. If it is greater than 0.2, the sample purification is successful, otherwise it fails.

[0218] refer to Figure 6 , this embodiment is as follows: if the Rh peak height is 25, there is a Na + If the salt ion peak height is 10, then 10 / 25=0.4, and the sample purification failed. If the Rh peak height is 30, and there is a salt ion peak height of 5 at 23Da behind the Rh peak, then 5 / 30=0.167, and the sample purification was successful.

[0219] In the above-mentioned embodiments, the artificially synthesized sequences of each component of the multi-component quality control material are randomly generated, and the overlap with the natural biological sequence is extremely low, or even zero. If there is a base matching or sequence matching with the specific test object, the random sequence can be regenerated according to the present invention to avoid interference with the time-of-flight nucleic acid mass spectrometry quality control.

[0220] According to the specific time-of-flight nucleic acid mass spectrometry test object, adjusting the sequences of A1.1-F, A1.1-R, B1, C1, and C2 in the above-mentioned embodiments or increasing or decreasing the weight sequence can make the mass-to-charge ratio of the mass spectrum peaks of each Qk, Pk, and Rh fall into the third temporary mass range. The same technical effect can be obtained by implementing the same method as in the above-mentioned embodiments.

[0221] The above are preferred implementation modes and corresponding embodiments of the present invention. It should be pointed out that, for those skilled in the art, without departing from the creative concept of the present invention, several modifications and improvements may be made, including but not limited to the adjustment of proportions, processes, dosages and reaction vessels, which all fall within the scope of protection of the present invention.

Claims

1. A time-of-flight mass spectrometry test quality control method, characterized in that: include: Mix the multi-component quality control substance with the target sample, and simultaneously perform a nucleic acid mass spectrometry test to obtain a test result; The multi-component quality control material includes an amplification component, an extension component and a detection component; Determine the position of the mass spectrum peak generated by the multi-component quality control substance in the test result within the detection area, and determine whether the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area is within the quality control range; If so, the quality control result is that the nucleic acid mass spectrometry test meets the quality control conditions; If not, the quality control result is that the nucleic acid mass spectrometry test does not meet the quality control conditions; The detection area range includes the claimed mass range of the nucleic acid mass spectrometry test device and the quality control range; the quality control range includes an extended mass range outside the claimed mass range in the detection area range; the extended mass range includes at least one of a first extended mass range and a second extended mass range; the first extended mass range is a mass-to-charge ratio interval with a low mass-to-charge ratio lower than the claimed mass range; the second extended mass range is a mass-to-charge ratio interval with a high mass-to-charge ratio higher than the claimed mass range; The multi-component quality control substance is a substance prepared from artificially synthesized oligonucleotides; the mass spectrum peaks generated by the multi-component quality control substance can be distributed in the quality control range, but the mass spectrum peaks do not overlap each other; the distance between the mass spectrum peaks generated by the multi-component quality control substance is not less than the minimum single base extension distance of each mass spectrum peak; The oligonucleotide comprises: at least one of a random sequence, a specific double-stranded oligonucleotide sequence and a single-stranded oligonucleotide sequence; The amplification components include: double-stranded oligonucleotide sequences chemically synthesized with A1.1, A1.2 ... A1.n as templates for amplification reactions, and single-stranded oligonucleotide sequences with A2.1, A2.2 ... A2.m as paired primers for amplification reactions of A1.n; The detection components include: detection oligonucleotide sequences of multiple random sequences of C1, C2, ...Ch; Among them, Ch is different from A1.n, A2.m, and Bk, and does not constitute base matching and sequence matching; The extension component includes: multiple single-stranded oligonucleotide sequences B1, B2, ... Bk as extension primers; wherein the Bk extension target sequence is a part of the double-stranded sequence A1.n in the amplification component; and the Bk extension target sequence is not the same as A1.n; The mass spectrum peak generated by the detection oligonucleotide sequence in the detection component is within the quality control range; the detection oligonucleotide sequence in the detection component can be modified and / or weighted; the sequence length of the weighted primer of the detection oligonucleotide sequence in the detection component is not less than 5nt; The multi-component quality control substance is mixed with the target sample to be tested, and nucleic acid mass spectrometry is performed simultaneously, including: Adding A1.n and the paired primer A2.m, which are used as a template for amplification reaction, to the amplification reaction system together with the target sample to be tested during the amplification reaction to carry out the amplification reaction; Adding the extension primer Bk in the extension component to the extension reaction system during the single base extension reaction to perform an extension reaction, wherein the number of mass spectrum peaks generated during nucleic acid mass spectrometry detection is no greater than 2×k; The Ch quality control substance in the detection component is added to the reaction system at the end of the extension reaction, the nucleic acid sample is purified, and the nucleic acid mass spectrometry test is performed.

2. The time-of-flight mass spectrometry test quality control method according to claim 1, characterized in that: The quality control range also includes a third temporary quality range; The third provisional mass range is within the mass-to-charge ratio interval of the declared mass range.

3. The time-of-flight mass spectrometry test quality control method according to claim 1, characterized in that: The paired primers are composed of an amplification primer segment and a weight primer; The sequence length of the amplification primer segment ranges from 10nt to 35nt; The sequence length of the weighted primer is not less than 5 nt; The molecular weight of the paired primers exceeds the extended mass range and the declared mass range.

4. The time-of-flight mass spectrometry test quality control method according to claim 1, characterized in that: The extension primer and the mass spectrum peak generated by the extension primer are within the quality control range; The extension primer can be modified and / or weighted; The sequence length of the weighted primer of the extension primer weight is not less than 5 nt.

5. The time-of-flight mass spectrometry test quality control method according to claim 1, characterized in that: The mass spectrum peak generated by the extension primer Bk is marked as Pk; the peak generated by the extension reaction of the extension primer Bk is marked as Qk; the h mass spectrum peaks generated based on the Ch quality control substance during the nucleic acid mass spectrometry test are marked as Rh; The relative positions of the mass spectrum peaks Pk, Qk, and Rh in the quality control range do not overlap; and the mass spectrum peaks Pk and Qk differ by at least one nucleotide in molecular weight.

6. The time-of-flight mass spectrometry test quality control method according to claim 1, characterized in that: The step of determining whether the position of the mass spectrum peak generated by the multi-component quality control substance within the detection region is within the quality control range further includes: Determining whether the mass spectrum peak generated by the multi-component quality control substance is a valid mass spectrum peak; If the mass spectrum peak generated by the multi-component quality control substance is a valid mass spectrum peak, a step is performed to determine whether the position of the mass spectrum peak generated by the multi-component quality control substance within the detection area is within the quality control range.

7. The time-of-flight mass spectrometry test quality control method according to claim 6, characterized in that: The determination conditions of the effective mass spectrum peak are: If the mass spectrum peak generated by the multi-component quality control substance satisfies all of the following conditions at the same time, the mass spectrum peak is determined to be the valid mass spectrum peak: A. The signal-to-noise ratio of the mass spectrum peak is not less than 3; B. The resolution of the mass spectrum peak is not less than the ratio of the mass-to-charge ratio of each mass spectrum peak to the minimum single-base extension distance of each mass spectrum peak.

Images