A SNP molecular marker site linked to the quantitative trait of theanine content in fresh tea leaves and its application

Abstract

The present invention discloses a SNP molecular marker site linked to a quantitative trait of theanine content in fresh leaves of tea trees and its application. The present invention provides a SNP molecular marker site linked to a quantitative trait of theanine content in fresh leaves of tea trees, which is located in Chr14:95565645 of the tea tree genome, and its genotype is significantly correlated with theanine content. The theanine content in fresh leaves corresponding to the AA genotype is significantly different from that of the CC and CA types. Statistically speaking, when the genotype is wild-type CC or single mutation CA, it is highly likely that the theanine content level in fresh leaves of tea trees is low; when the genotype is double mutation AA, it is highly likely that the theanine content in fresh leaves of tea trees is high. The SNP molecular marker site is further used to establish a method for evaluating theanine content in fresh leaves of tea trees, which is further used for tea tree resource screening and molecular breeding. This is the basis for carrying out molecular marker-assisted selection breeding of tea trees, and has great research value.

Description

Technical Field

[0001] The present invention relates to the technical field of tea tree breeding, and more specifically, to a SNP molecular marker site linked to a quantitative trait of theanine content in fresh tea leaves and an application thereof. Background Art

[0002] Tea (Camellia sinensis (L.) O. Kuntze) belongs to the Camellia family, the tea group, and originated in southwest China, with a cultivation history of more than 5,000 years. Tea, coffee, and cocoa are known as the world's three major non-alcoholic beverages, with important economic value and a significant impact on society and culture.

[0003] Theanine is an amide compound, chemically named N-ethyl-L-glutamine. It is a non-protein amino acid in tea leaves, and its content in tea leaves is relatively high. Theanine improves the taste and aroma of tea leaves, and is strongly correlated with the quality of tea leaves.

[0004] In addition, theanine also has a relaxing and anti-stress effect. It increases the synthesis and release of gamma-aminobutyric acid (GABA) in the brain and improves the level of GABA in the brain, thereby producing a calming, relaxing and anti-anxiety effect. Drinking tea rich in theanine can help relieve tension and stress and improve mental state.

[0005] At present, tea tree breeding is mainly carried out through conventional methods, which selects excellent individual plants from wild populations and hybrid offspring for systematic breeding. This method is time-consuming and inefficient, resulting in slow replacement of new varieties and failure to quickly meet the public's demand for new products. Molecular marker-assisted breeding can significantly improve breeding efficiency because it can select breeding materials at the seedling stage.

[0006] Discovering molecular markers that are closely linked to the excellent traits of tea trees is the basis for conducting molecular marker-assisted selection breeding of tea trees. Currently, only Chinese patent CN110760603A discloses a molecular marker site linked to theanine content of tea trees and its application. Summary of the invention

[0007] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a SNP molecular marker site linked to the quantitative trait of theanine content in fresh tea leaves and its application.

[0008] The first object of the present invention is to provide a reagent for detecting the genotype of the SNP site located at Chr14:95565645 in the tea plant genome for use in evaluating the content of theanine in fresh tea leaves.

[0009] The second object of the present invention is to provide a reagent for detecting the genotype of the SNP site located at Chr14:95565645 of the tea plant genome for use in preparing a kit for evaluating theanine content in fresh tea leaves.

[0010] The third object of the present invention is to provide a method for evaluating theanine content in fresh tea leaves.

[0011] The fourth object of the present invention is to provide a kit for evaluating theanine content in fresh tea leaves.

[0012] The fifth object of the present invention is to provide the use of the reagent, any of the methods and / or any of the kits in molecular breeding of tea plants.

[0013] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0014] The present invention claims to protect the use of a reagent for detecting the genotype of a SNP site located at Chr14:95565645 of a tea plant genome in evaluating the content of theanine in fresh tea leaves, wherein the tea plant genome is a Tieguanyin genome.

[0015] And, use of a reagent for detecting the genotype of a SNP site located at Chr14:95565645 of a tea plant genome in preparing a kit for evaluating the content of theanine in fresh tea leaves, wherein the tea plant genome is a Tieguanyin genome.

[0016] That is, the SNP site is located at the 200th base of SEQ ID NO: 1. When the sample genotype is double mutation AA, the genotype of the sample whose theanine metabolite content in fresh tea leaves is most likely higher than the normal average level is wild type CC or single mutation CA.

[0017] Preferably, the reagent is a primer.

[0018] More preferably, the nucleotide sequence of the primer is as shown in SEQ ID NO: 2-3.

[0019] The present invention also claims a method for evaluating theanine content in fresh tea leaves, detecting the genotype of a SNP site located at Chr14:95565645 of the tea genome, wherein the tea genome is the Tieguanyin genome.

[0020] Preferably, primers with nucleotide sequences as shown in SEQ ID NOs: 2-3 are used to detect the genotype of the SNP site located at Chr14: 95565645 in the tea plant genome.

[0021] As a specific embodiment, the scheme comprises the following steps

[0022] (1) The total DNA of tea plant buds was extracted using the CTAB method;

[0023] (2) PCR amplification

[0024] The PCR system (10 μl) is as follows:

[0025] 2×Taq PCR Master Mix 5μl Primer (shown in SEQ ID NO: 2-3) 0.5 μl each DNA template 1μl <![CDATA[ddH2O]]> 3μl

[0026] The PCR amplification procedure is as follows:

[0027]

[0028] (3) Product purification

[0029] The PCR amplification product was subjected to gel electrophoresis and then recovered and purified using a commercially available gel electrophoresis DNA recovery kit.

[0030] (4) Sequencing and result interpretation

[0031] The recovered and purified products were sent to a sequencing company for Sanger sequencing. At the Chr14:95565645 site, when the genotype was double mutation AA, the theanine content in the fresh leaves of the tea tree was most likely higher than the normal average level of the wild type CC or the single mutation genotype CA.

[0032] The invention also claims protection for a kit for evaluating theanine content in fresh tea leaves, which contains a reagent for detecting the genotype of a SNP site located at Chr14:95565645 of the tea genome.

[0033] Preferably, the reagent is a primer with a nucleotide sequence as shown in SEQ ID NO: 2-3.

[0034] More preferably, it also contains a PCR amplification reagent.

[0035] As a specific example, the kit contains primers with nucleotide sequences as shown in SEQ ID NO: 2-3, 2×Taq PCR Master Mix, and ddH2O.

[0036] Its usage is the same as described above.

[0037] The present invention also claims the use of the reagent, any of the methods and / or any of the kits in tea tree molecular breeding, wherein the tea tree molecular breeding is the content of theanine in fresh leaves of tea trees.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] The present invention discovered a SNP molecular marker site linked to the quantitative trait of theanine content in fresh leaves of tea trees, which is located in the tea tree genome Chr14: 95565645. Its genotype is significantly correlated with theanine content, and the theanine content in fresh leaves corresponding to the AA genotype is significantly different from that of the CC and CA types. Statistically speaking, when the genotype is CC or CA, it is highly likely that the theanine content level in fresh leaves of tea trees is low; when the genotype is AA, it is highly likely that the theanine content in fresh leaves of tea trees is high. This SNP molecular marker site is further used to establish a method for evaluating theanine content in fresh leaves of tea trees, which can be further used in tea tree resource screening and molecular breeding. This is the basis for carrying out molecular marker-assisted selection breeding of tea trees, and has great research value. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Theanine content in 300 individuals from all populations was analyzed for genome-wide association study.

[0041] Figure 2 Schematic diagram of Chr14:95565645 site and primers. N (highlighted with a yellow background) represents the base to be tested at the Chr14:95565645 position, and the bold and underlined parts are the upstream and downstream primers.

[0042] Figure 3 In the association analysis population, the Chr14:95565645 genotype was significantly correlated with the content of secondary metabolites. Statistically speaking, when the genotype is wild-type CC or single mutation CA, the theanine content in the fresh leaves of the tea tree is likely to be low; when it is double mutation AA, the theanine content in the fresh leaves of the tea tree is likely to be high.

[0043] Figure 4 In the test population, the Chr14:95565645 genotype was also significantly correlated with the content of secondary metabolites. Statistically, when the genotype was wild-type CC or single mutation CA, the theanine content in the fresh leaves of the tea tree was likely to be low; when the genotype was double mutation AA, the theanine content in the fresh leaves of the tea tree was likely to be high. DETAILED DESCRIPTION

[0044] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0045] Example 1

[0046] 1. Experimental Sample

[0047] 300 tea tree materials were collected from the Tea Germplasm Resource Bank of the Tea Research Institute of Fujian Academy of Agricultural Sciences (Fu'an, Fujian, 27°N, 119°E), including 139 from Fujian, 36 from Zhejiang, 21 from Guizhou, 18 from Guangxi, 18 from Guangdong, 14 from Yunnan, 10 from Hunan, 9 from Anhui, 7 from Sichuan, 4 from Hubei, 3 from Taiwan, 2 from Shandong, 2 from Jiangxi, 2 from Chongqing, 1 from Shaanxi, 1 from Jiangsu, and 1 from Gansu. In addition, there are 5 from Vietnam, 2 from Myanmar, 1 from Sri Lanka, 1 from Kenya, 1 from Japan, 1 from India, and 1 from Georgia. The selected materials are widely representative.

[0048] The selected resources are randomly distributed in the resource pool. Double-row single-plant planting is adopted, with each row of 4 meters, row spacing of 1.5m, and plant spacing of 35cm. The resource pool carries out routine water and fertilizer management. At the end of 2022, the resources will be pruned and basal fertilizer will be applied in deep pits, with 4 tons of organic fertilizer, 0.75 tons of peanut bran and 10 kilograms of compound fertilizer per mu. After the spring and summer tea in 2023, pruning will be carried out and topdressing will be applied to the roots, with 30 kilograms of compound fertilizer and 60 kilograms of urea per mu.

[0049] 2. Experimental Methods

[0050] 1. Sample collection

[0051] In May 2023, pick the new shoots of tea trees with one bud and two leaves.

[0052] 2. Detection of theanine content

[0053] Theanine content of one bud and two leaves of the collected tea tree new shoots was determined. The theanine content in the fresh leaves of the tea tree was detected by high performance liquid chromatography, referring to Yu, X. et al. Metabolite signatures of diverse Camellia sinensis tea populations. Nat Commun 11, 5586 (2020).

[0054] 3. Experimental Results

[0055] Theanine content is shown in Table 1. Theanine content of the population is shown in Figure 1 .

[0056] Table 1 Determination results of relative content of theanine in 300 germplasms:

[0057]

[0058]

[0059]

[0060]

[0061] Example 2 Association analysis between genotypes of tea germplasm resources and their theanine content traits

[0062] 1. Experimental Methods

[0063] The total DNA of the 300 tea tree resource buds in Example 1 was extracted by CTAB method, and the A260 / A280 of each DNA sample was ensured to be between 1.8 and 2.0, and the concentration was greater than 100 μg / μL.

[0064] The extracted DNA samples were used to construct a sequencing library with a fragment length of 500bp, and double-end 150bp sequencing was performed using the DNBSEQ-T7 platform. The sequenced reads were aligned to the "Tieguanyin" CSS cultivated tea tree genome (http: / / tpia.teaplants.cn / ; Tieguanyin, TGY, PMID: 34267370) using bwa software. GATK (https: / / github.com / broadinstitute / gatk) was used to detect whole-genome single nucleotide variations (SNPs) in 300 germplasms, and rMVP was used to perform genome-wide association analysis (GWAS) of whole-genome SNPs and shape.

[0065] Among them, the genome of the "Tieguanyin" CSS cultivated tea tree is http: / / tpia.teaplants.cn / web / Download / Genomic_data / Tieguanyin.genome.fas.tar.gz.

[0066] 2. Experimental Results

[0067] The significance level of the association was determined by the P value. It was found that the genotype of the SNP locus located at Chr14:95565645 was significantly associated with theanine content, and the p value was less than 1.0E-06 for the significance level. The P value of the SNP locus and theanine association analysis was 1.26E-09, which was much less than 1.0E-06, indicating that the locus was extremely significantly associated with theanine content. Figure 3 As shown, from a statistical perspective, when the sample genotype is double mutation AA, the content of theanine metabolites in fresh tea leaves is more likely to be higher than the normal average level in samples with the genotype of wild type CC or single mutation CA.

[0068] Example 3 Correlation between the genotype of SNP site (Chr14: 95565645) and the content of theanine in fresh tea leaves

[0069] 1. Experimental Methods

[0070] Another sample group of 65 tea tree samples was selected, including 10 germplasms from Jiangbei tea industry area, 15 germplasms from Jiangnan tea industry area, 15 germplasms from South China tea industry area, 23 germplasms from Southwest tea industry area, and 2 foreign germplasms. All germplasms were uniformly planted at the Tea Research Institute of Guangdong Academy of Agricultural Sciences to detect the genotype of the SNP site located at Chr14:95565645 and the content of theanine in fresh leaves of tea trees, and correlation analysis was performed.

[0071] The method for detecting theanine content in the fresh leaves of each sample tea plant is the same as that in Example 1.

[0072] The genotype of the SNP site of Chr14:95565645 of each sample was detected using the Sanger sequencing technology platform. The specific detection method is as follows:

[0073] (1) Primer design

[0074] Primers were designed and synthesized based on the location of Chr14:95565645 in the genome. Among them, Chr14:95565645 derived 200bp upstream and extended 150bp downstream. Its nucleotide sequence is shown in SEQ ID NO:1 ( Figure 2 , Chr14: 95565645 is the 200th base, and N represents the base to be tested).

[0075] PCR Primers:

[0076] F: TAAACACAATGGACAAATTACACC (SEQ ID NO: 2);

[0077] R: AACCAAATCGATACAAAATTTAACATC (SEQ ID NO: 3).

[0078] (2) PCR amplification

[0079] The PCR system (10 μl) is as follows:

[0080] 2×Taq PCR Master Mix 5μl PrimerMix 1μl DNA template 1μl <![CDATA[ddH2O]]> 3μl

[0081] The PCR amplification procedure is as follows:

[0082]

[0083] (3) Gel electrophoresis verification and extraction of PCR products

[0084] The PCR amplification products are analyzed by gel electrophoresis to confirm whether the target fragment is successfully amplified. The size of the PCR product is determined by comparison with molecular weight markers. The PCR product is extracted from the gel for subsequent Sanger sequencing.

[0085] (4) Sanger sequencing

[0086] The PCR products were sequenced using Sanger sequencing technology. SEQ ID NO: 2 and 3 were selected for bidirectional sequencing, and two pairs of primers were used for reverse and forward sequencing respectively.

[0087] (5) Analysis of sequencing results

[0088] The sequence data obtained by sequencing is compared with the reference sequence (SEQ ID NO: 1), and the base difference of the target mutation site is checked. The genotype of the site to be tested is determined by analyzing the peak spectrum.

[0089] 2. Experimental Results

[0090] The theanine content of each sample and the genotype of the Chr14:95565645 SNP site are shown in Table 2.

[0091] Table 2 Relative content of theanine in the verified population (after Log10 treatment) and genotype:

[0092]

[0093]

[0094] The results of the significance analysis are as follows Figure 4 The results showed that the genotype of Chr14: 95565645 was significantly correlated with theanine content. Statistically, when the sample genotype was double mutation AA, the genotype with a high probability of theanine metabolite content in fresh tea leaves being higher than the normal average level was the wild type CC or single mutation CA sample. This result was consistent with the results in the association analysis population, indicating that Chr14: 95565645 can be used to evaluate theanine content of tea trees, and further used for high-theanine tea tree resource screening and molecular breeding, which has great research value.

[0095] Example 4 A method for evaluating theanine content of tea trees

[0096] 1. Use the CTAB method to extract total DNA from tea tree buds, and ensure that the A260 / A280 of each DNA sample is between 1.8 and 2.0, and the concentration is greater than 100 μg / μL;

[0097] 2. PCR amplification

[0098] The PCR system (10 μl) is as follows:

[0099] 2×Taq PCR Master Mix 5μl Primers 0.5 μl each DNA template 1μl <![CDATA[ddH2O]]> 3μl

[0100] The PCR amplification procedure is as follows:

[0101]

[0102]

[0103] 3. Product purification

[0104] The PCR amplification product was subjected to gel electrophoresis and then recovered and purified using a commercially available gel electrophoresis DNA recovery kit.

[0105] 4. Sequencing and result interpretation

[0106] The recovered purified product was sent to a sequencing company for Sanger sequencing, and the sequencing result was compared with the nucleotide sequence shown in SEQ ID NO: 1. Figure 2 As shown in the figure (the bold and underlined parts are the upstream and downstream primers, and N represents the base to be tested at the position of Chr14: 95565645), the Chr14: 95565645 site is located at the 70th base of the amplified product. Statistically speaking, when the genotype is the wild type CC or the single mutation CA, the theanine content in the fresh leaves of the tea tree is likely to be low; when the double mutation AA is performed, the theanine content in the fresh leaves of the tea tree is likely to be high.

[0107] Example 5 A kit for evaluating theanine content of tea trees

[0108] 1. Composition

[0109] The nucleotide sequence of the primers is shown in SEQ ID NO: 2-3, 2×Taq PCR Master Mix, and ddH2O.

[0110] Among them, primer F: TTAGAAATATCTAGCATCACTGTTTCG (SEQ ID NO: 2);

[0111] Primer R: AAGCATTTGACAGCGTGCTCA (SEQ ID NO: 3).

[0112] 2. Usage

[0113] Same as Example 4.

Claims

1. The use of a reagent for detecting the genotype of a SNP site in a tea plant genome in evaluating the content of theanine in fresh tea leaves, characterized in that: The tea tree genome is the Tieguanyin genome, the SNP site is located at the 200th base of SEQ ID NO: 1, and when the sample genotype is double mutation AA, the genotype of the sample whose theanine metabolite content in the fresh leaves of the tea tree is most likely higher than the normal average level is the wild type CC or single mutation CA.

2. Use of a reagent for detecting the genotype of a SNP site in a tea plant genome in the preparation of a kit for evaluating the content of theanine in fresh tea leaves, characterized in that: The tea tree genome is the Tieguanyin genome, the SNP site is located at the 200th base of SEQID NO: 1, and when the sample genotype is double mutation AA, the genotype of the sample whose theanine metabolite content in the fresh leaves of the tea tree is most likely higher than the normal average level is the wild type CC or single mutation CA.

3. The use according to claim 1 or 2, characterized in that: The reagent is a primer.

4. The use according to claim 3, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NOs: 2-3.

5. A method for evaluating theanine content in fresh tea leaves, characterized in that: The genotype of the SNP site of the tea tree genome is detected, the tea tree genome is the Tieguanyin genome, the SNP site is located at the 200th base of SEQ ID NO: 1, and when the sample genotype is double mutation AA, the genotype of the content of theanine metabolites in the fresh leaves of the tea tree is most likely higher than the normal average level, which is the wild type CC or single mutation CA sample.

6. The method according to claim 5, characterized in that The genotype of the SNP site is detected using primers with nucleotide sequences as shown in SEQ ID NOs: 2-3.

7. Use of the reagent described in claim 1 or 2 in tea plant molecular breeding, characterized in that: The tea tree molecular breeding is the molecular breeding of theanine content in fresh tea tree leaves.

8. Application of the method according to any one of claims 5 to 6 in molecular breeding of tea plants.

Images