A strain of Trichoderma citriodora producing multiple furanone substances and its screening and cultivation method and application

Abstract

The present invention relates to a strain of Trichoderma citriodora ( Trichoderma citrinoviride ) strain and its screening and cultivation method and application. The Trichoderma citriodora strain producing multiple furanones is named JSY-F003 strain, and the preservation unit is China Center for Type Culture Collection (CCTCC). The preservation time is March 20, 2024, and the preservation number is CCTCC No. M 2024534. Through headspace solid phase microextraction combined with comprehensive two-dimensional gas chromatography-time of flight mass spectrometry (HS-SPME-GC×GC-TOFMS) detection and analysis, the strain can produce nearly 11 kinds of furanones after high temperature culture on wheat / barley / pea raw material culture medium, showing good flavor characteristics, and is used in the process of liquor koji making or related fermented food brewing, solving the problem of insufficient functional flavor strain resources in the field of liquor koji making and traditional fermented food brewing.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial fermentation, and specifically relates to a strain of Trichoderma citriodora ( Trichoderma citrinoviride ) strains and their screening, culture methods and applications. Background Art

[0002] Furanone substances are compounds consisting of a five-membered ring and a ketone group. The oxygen atom in the five-membered ring is connected to the carbon atom on the ketone group through a covalent bond to form a stable furanone structure. It is an extremely important class of heterocyclic aromatic furan homologous derivatives. It is a safe edible flavor recognized by the American Flavor Manufacturers Association (FEMA) and also complies with my country's "National Food Safety Standard for the Use of Food Additives". It has the reputation of "the king of spices".

[0003] Furanone substances are widely present in traditional fermented foods such as soy sauce, koji, liquor, beer, etc., and are an important class of volatile flavor components. During the soy sauce brewing process, the content and types of furanone substances increase significantly during the fermentation stage of the mash. Among them, 4-hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF) and 4-hydroxy-2(5)-ethyl-5(2)-methyl-3(2H)-furanone (HEMF) are the main components of the soy sauce flavor substances, which can produce obvious caramel aroma, sweet fruit aroma, and soy sauce aroma. Many beer malt aromas are mainly composed of furanones such as 5 (or 2) -ethyl-2 (or 5) -methyl-4-hydroxy-3 (2H) -furanone (EMHF), 5-methyl-4-hydroxy-3 (2H) furanone (MHF) and 2,5-dimethyl-4-hydroxy-3 (2H) -furanone (DMHF), which have a broth flavor, sweetness and caramel flavor. In the process of liquor brewing, furanones include 4,5-dihydro-2-methyl-3 (2H) -furanone, 4-phenyldihydrofuran-2-one, dihydro-2-methyl-3 (2H) furanone, 2,5-dimethyl furanone, 4-phenyl-tetrahydro-2-furanone, etc.

[0004] At the same time, a class of furanones, also known as lactones, have a low threshold and are characterized by fruity, sweet, buttery, and other aromas. 2(5H)-furanone (γ-crotonyl lactone), whose structure is commonly found in bioactive molecules such as antibiotics, antibacterials, antitumor, and antiviral drugs. 4,5-dihydro-5-methyl-2(3H)-furanone (γ-valerolactone), is often used as a food additive and can also be converted into liquid olefins for use as transportation fuels; 5-methyl-2(3H)-furanone (angelica lactone), naturally found in cranberries, raisins, heated blackberries, bread, hydrolyzed soy protein, and licorice; dihydro-5-pentyl-2(3H)-furanone (coconut aldehyde), found in peaches, apricots, tomatoes, rum, and roasted barley.

[0005] Although furanones play an important role in improving taste and enhancing aroma, and improving product quality, the content of furanones in natural products is very low and cannot meet daily needs. The cost of extraction and purification is high, and the chemical synthesis method also has problems such as many steps, low yield, and solvent residue. In addition, the "Terms of the Liquor Industry" stipulates that liquor shall not directly or indirectly add color, aroma, and flavor substances that are not produced by its own fermentation.

[0006] Therefore, it is of great significance to screen microorganisms that produce furanones and strengthen their application in the brewing process of liquor koji or related fermented foods, regulate the growth and metabolism of microorganisms towards the synthesis of furanone products, increase the content of furanones in the product, and improve the flavor quality. Summary of the invention

[0007] The purpose of the present invention is to provide a strain of Trichoderma citriodora that produces multiple furanone substances, and a screening and cultivation method and application thereof. The Trichoderma citriodora strain can produce nearly 11 furanone substances after high-temperature cultivation on a wheat / barley / pea raw material culture medium, thereby solving the problem of insufficient functional flavor strain resources in the field of liquor koji making and traditional fermented food brewing.

[0008] In order to achieve the purpose of the present invention, the following technical scheme is adopted: a strain of Trichoderma citriodora ( Trichoderma citrinoviride ) strain, named JSY-F003 strain, deposited by China Center for Type Culture Collection (CCTCC), with accession number CCTCC No. M 2024534, deposit date March 20, 2024, and deposit address: Wuhan University Collection Center, Wuhan, China.

[0009] Wherein, the furanone substance is: 5-methyl- 2(5H)-furanone, 3-methyl-2(5H)-furanone, 2(5H)-furanone (γ-crotonyl lactone), 4,5-dihydro-5-methyl-2(3H)-furanone (γ-valerolactone), 4-methyldihydrofuran-2(3H)-one (4-methyl-GAMMA-butyrolactone), 4,5-dimethyldihydrofuran-2(3H)-one, 2,3-dihydro-3,5-dihydroxy-6-methyl-4(H)-pyran-4-one, 5-methyl-2(3H)-furanone (angelica lactone), G-caprolactone, 5-vinyl-5-methyltetrahydrofuran-2-one (4-methyl-4-hydroxy-5-hexenoic acid-γ-lactone), dihydro-3-hydroxy-4,4-dimethyl-2(3H) furanone (pantolactone).

[0010] Among them, a method for screening and culturing a strain of Trichoderma viridis that produces multiple furanone substances comprises the following steps:

[0011] (1) Mix the Daqu sample with sterile physiological saline to obtain a bacterial suspension;

[0012] (2) diluting the bacterial suspension obtained in step (1) in a gradient manner and applying the dilution on a sterile solid culture medium for culturing to obtain colonies;

[0013] (3) Pick the hyphae at the edge of the colony in step (2), separate and purify them on a sterile solid culture medium to obtain a single pure colony, and then screen out the Trichoderma viridis strains that produce multiple furanone substances.

[0014] Preferably, the Daqu sample is high-temperature Daqu produced by Jiangsu Jinshiyuan Wine Co., Ltd.

[0015] Preferably, in step (2) and step (3), the solid culture medium is BM solid culture medium; it comprises 2.5 g / L lignin, 10 g / L yeast extract, 20 g / L glucose, 15 g / L agar, the solvent is water, and the pH value is 7.0.

[0016] Preferably, in step (3), the separation and purification method is: picking hyphae at the edge of the colony in step (2), and performing streak culture on a sterile solid culture medium for 6-8 times to achieve separation and purification.

[0017] Preferably, in step (3), the screening includes furanone-producing species determination and molecular biological identification.

[0018] Preferably, the method for determining the type of furanone-producing substances is: picking a single colony for liquid culture, preparing a seed solution, inoculating it on a wheat / barley / pea raw material culture medium, and after high-temperature culture at 60° C., detecting and analyzing the product by HS-SPME-GC×GC-TOFMS.

[0019] Preferably, the molecular biological identification method is: identification using an ITS rDNA sequence method, and the primer sequences of the Trichoderma citrinovolgensis strain are: ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3').

[0020] The advantages of the present invention are:

[0021] 1. The strain JSY-F003 was screened from the Jinshiyuan Daqu sample, which showed good flavor characteristics. After high-temperature culture on wheat / barley / pea raw material culture medium, it metabolized and produced nearly 11 furanones, including 5-methyl-2(5H)-furanone, 3-methyl-2(5H)-furanone, 2(5H)-furanone (γ-crotonyl lactone), 4,5-dihydro-5-methyl-2(3H)-furanone (γ-valerolactone), 4-methyldihydrofuran-2(3H)-one (4-methyl-GAMMA-butyrolactone), 4,5-dimethyldihydrofuran-2(3H)-one, 2,3-dihydro-3,5-dihydroxy-6-methyl-4 The products of the three enzymes were (H)-pyran-4-one, 5-methyl-2(3H)-furanone (angelica lactone), G-caprolactone, 5-vinyl-5-methyltetrahydrofuran-2-one (4-methyl-4-hydroxy-5-hexenoic acid-γ-lactone), and dihydro-3-hydroxy-4,4-dimethyl-2(3H)furanone (pantolactone). The products had a prominent aroma, indicating that the strain had good research and application potential in food fermentation and liquor brewing.

[0022] 2. It can also produce flavor factors such as 2,3,5,6-tetramethylpyrazine, 2,3,5-trimethylpyrazine, ethyl acetate, acetoin, etc., which have great application value in improving the flavor quality of products in the process of liquor koji making or related fermented food brewing.

[0023] 3. The screening and culturing method of the Trichoderma citriviride strain of the present invention is simple in process and suitable for industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 : Colony morphology of JSY-F003 strain;

[0025] Figure 2 : Phylogenetic tree of JSY-F003 strain;

[0026] Figure 3 : Radar chart of sensory evaluation of fermentation products of JSY-F003 strain;

[0027] Figure 4 : Chromatogram of flavor substances produced by JSY-F003 strain.

[0028] Biomaterial deposit information: The strain JSY-F003 of the present invention belongs to Trichoderma citriodora ( Trichoderma citrinoviride ), the preservation unit is China Center for Type Culture Collection (CCTCC), the preservation date is March 20, 2024, the preservation number is CCTCC No. M 2024534, and the preservation address is: Wuhan University Collection Center, Wuhan, China. DETAILED DESCRIPTION

[0029] The technical scheme of the present invention is further illustrated by specific examples below. Those skilled in the art should understand that the examples are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0030] The Daqu used in the following examples comes from the high-temperature Daqu produced by Jiangsu Jinshiyuan Wine Industry Co., Ltd.

[0031] Example 1: Screening and culturing a strain of Trichoderma citriodora that produces multiple furanone substances using the following steps

[0032] (1) Grinding the high-temperature Daqu into powder using a pulverizer;

[0033] (2) Weigh 10 g of the Daqu powder obtained in step (1) and mix it with 90 mL of sterile saline to obtain a bacterial suspension; incubate in a 30°C constant temperature shaker at 150 r / min for 30 min; the sterile saline is prepared by weighing 9 g of sodium chloride and adding it to 1000 mL of distilled water, and sterilizing at 121°C for 15 min;

[0034] (3) Dilute the bacterial suspension after incubation in step (2) to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 and 10 -6 Gradient, 100 μL of each gradient dilution was spread on a sterile solid culture medium, and cultured in a constant temperature incubator at 30°C for 48 hours to obtain colonies; the solid culture medium was BM solid culture medium, including 2.5 g / L lignin, 10 g / L yeast extract, 20 g / L glucose, 15 g / L agar, and the solvent was water, with a pH of 7.0;

[0035] (4) picking up hyphae at the edge of the colony in step (3), isolating and purifying them on BM solid medium, and obtaining a single pure colony by streaking 6-8 times;

[0036] (5) The pure strain colony obtained in step (4) was selected and inoculated into 50 mL of PDA liquid culture medium, and the culture was carried out in a constant temperature shaker at 30°C and 150 r / min for 48 h to prepare seed liquid; 50 mL of seed liquid was inoculated into 1000 g of wheat / barley / pea raw material culture medium, and the culture was carried out at a constant temperature of 30°C for 24 h and then at a high temperature of 60°C for 72 h, and the product was subjected to furanone species detection and molecular biological identification, and finally the citrus viridis JSY-F003 strain producing multiple furanone substances was obtained; the PDA liquid culture medium comprises: 30% potato extract powder and 2% glucose; the raw material culture medium comprises 1000 g of crushed raw material (passed through a 40-mesh sieve, and the proportion of the sieve material is in the range of 18-23%), and the water content is 35%; the raw material combination and ratio are: pure wheat, pure barley, pure pea, wheat and barley (7:2), wheat and pea (7:1), and wheat and barley and pea (7:2:1).

[0037] Example 2: Colony morphology observation and molecular biological identification of the Trichoderma citriodora JSY-F003 strain screened in Example 1

[0038] 1. Morphological observation: Inoculate the JSY-F003 strain into PDA solid culture medium and observe the morphological characteristics of the colonies after 72 h of culture. Figure 1 As shown, JSY-F003 hyphae grow rapidly, initially white cotton-like, later tea green, with yellow-green on the back, conidiophores clusters arranged in a ring near the edge of the plate, and conidia in a light green oval shape.

[0039] 2. Molecular Biology Identification:

[0040] (1) Use the 10 Mmol NaOH alkaline solution lysis method. Pipette 100 μL of NaOH alkaline solution into a PCR tube, then use a sterile white gun tip (toothpick) to pick up a few pure colonies into the above tube, cover the lid, mark it, and put it into the PCR instrument for lysis.

[0041] (2) PCR amplification and sequencing: The rDNA sequence of JSY-F003 strain was amplified using the universal primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3'). The PCR product was detected by 1% agarose gel electrophoresis and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The phylogenetic tree is shown in Figure 2 shown.

[0042] The PCR amplification system was as follows: 0.5 µL each of ITS1 and ITS4 primers, 12.5 µL 2 × premix Taq mix, 10.5 µL ddH2O, and 1 µL genomic DNA template.

[0043] PCR amplification program: 94 ℃ pre-denaturation for 4 min, 35 cycles including 94 ℃ denaturation for 40 s, 55 ℃ annealing for 50 s, 72 ℃ extension for 40 s, and finally 72 ℃ extension for 4 min; NCBI sequence alignment: alignment found that JSY-F003 and Trichoderma citrinodiflora ( Trichoderma citrinoviride ) had the highest similarity; combined with morphological and molecular biological characteristics, JSY-F003 was identified as Trichoderma citrinovil.

[0044] The sequence of the JSY-F003 strain is:

[0045] >TTTGGCATTCTACCTGATCCGAGGTCACATTTCAGAGTTTGGGGTGTTTTACGGCTGTGGCCGCGCCGCGCTCCCGGTGCGAGTGTGCAAACTACTGCGCAGGAGAGGCTGCGGCGAGACCGCCACTGTATTTCGGGGGCGGCCCGGTGAG GGGCCGATCCCCAACGCCGACCCCCCGGAGGGGTTCGAGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTC GCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTCGAGACGCCCGCTAGGGTCGCCGAGAAAGGCTCAGAGCAAAAATAAAACAGAGCCGCGACGTAGGCCGCGACGGAGAGAAAAAAGAGTTTG AGTTGGTCCTCCCGGCGGGCGCCATGGGATCCGGGGCTGCGACGCGCCCGGGGCAGAGAATCCCGCCGAGGCAACAGATTGGTAACGTTCACATTGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCAGGCACCCCTCAGACAGAATA

[0046] (3) Preservation: The JSY-F003 strain was submitted to the China Center for Type Culture Collection (CCTCC) for preservation on March 20, 2024, with the accession number CCTCC No. M 2024534. The deposit address is: Wuhan University Collection Center, Wuhan, China.

[0047] Example 3: Aroma evaluation of the fermentation product of the JSY-F003 strain screened in Example 1 and identified in Example 2

[0048] The JSY-F003 strain was inoculated on a wheat / barley / pea raw material culture medium and cultured at 60°C. The detailed culture method is shown in Example 1. A total of 7 professional wine tasters and technical R&D personnel of the company were invited to conduct aroma evaluation to examine the grain aroma, baking aroma, aromatic, herbal aroma, sauce aroma, and sweet aroma index of the fermentation product (score 0-10 points).

[0049] The scoring results are shown in Table 1, and the radar comparison chart is shown in Figure 3 As shown, the fermentation product of the strain of the present invention has obvious sweet and herbal aromas and has a baking aroma and fragrance, which fully reflects the potential of the strain of the present invention in improving the flavor and aroma of the fermentation product.

[0050] Table 1 Aroma evaluation of fermentation products of JSY-F003 strain

[0051]

[0052] Example 4: Analysis of flavor substances produced by the JSY-F003 strain screened in Example 1 and identified in Example 2

[0053] The JSY-F003 strain was inoculated on a wheat / barley / pea raw material culture medium and cultured at 60°C. The detailed culture method is shown in Example 1. 2 g of the product was placed in a 20 mL headspace sample bottle and the sample bottle was tightened. The extraction head was aged at 210°C for 30 min and then inserted into the sample bottle, equilibrated at 50°C for 10 min, extracted for 45 min, and the extraction head was desorbed at 210°C at the GC injection port for 5 min.

[0054] SPME extraction tip: Supelco, 50 / 30um DVB / CAR / PDMS, Stableflex (2 cm).

[0055] Chromatographic conditions: The chromatographic column was a DB-WAX elastic quartz fiber capillary column (60 m×0.25 mm, 0.25 μm); the temperature program was: 50 ℃ for 4 min, increased to 80 ℃ at 4 ℃ / min, maintained for 0 min, increased to 210 ℃ at 8 ℃ / min, maintained for 15 min; the carrier gas (He, 99.999%) flow rate was 1.0 mL / min, and the injection was non-split.

[0056] Mass spectrometry conditions: electron bombardment ion source; electron bombardment energy 70 eV; transfer line temperature 250 °C; ion source temperature 200 °C; mass scan range m / z 35-500.

[0057] After GC-MS flavor analysis, the JSY-F003 strain produced a large amount of flavor substances ( Figure 4 ), which contains many furanones (Table 2) and other flavor factors (Table 3); among them, furanones have sweet, roasted, bready, cooking, fruity and caramel aromas; lactone furanones have fruity, sweet, buttery and other aroma characteristics, such as γ-crotonyl lactone, whose structure is common in biologically active molecules, such as antibiotics, antibacterials, antitumor and antiviral drugs; G-caprolactone is a natural flavor found in ripe fruits; γ-valerolactone has herbal, sweet, tobacco and woody aromas; angelica lactone has coumarin It has a plain smell and tobacco flavor and is a flavor enhancer for candies, puddings, gel products, meat products, soups, and cereal products. Other flavor factors, such as tetramethylpyrazine and trimethylpyrazine, characterize the flavors of baked potatoes, fried peanuts, walnuts, and nuts, and also have chocolate and cocoa flavors. Ethyl acetate is a clear, slightly fruity wine aroma and is an indispensable flavor component in liquor. It is also the main raw material for fruit flavors such as pineapple and strawberry and spices such as cream. Ethyl caproate is the main aroma of China's strong-flavor liquor, and its content plays a decisive role in the quality of liquor. It has a strong fruity and cellar aroma, giving the strong-flavor liquor a unique flavor. Isoamyl acetate is also an edible spice allowed for use in my country, which gives a fresh floral and fruity top aroma and the effect of enhancing the aroma. It is also commonly used in wine and tobacco flavors.

[0058] Table 2 Statistics of furanones produced by JSY-F003 strain

[0059]

[0060] Table 3 Statistics of other flavor factors produced by JSY-F003 strain

[0061]

[0062] It can be seen that after high-temperature culture on wheat / barley / pea raw material culture medium, the strain of the present invention not only produces nearly 11 furanone substances, but also produces flavor factors such as 2,3,5,6-tetramethylpyrazine, 2,3,5-trimethylpyrazine, ethyl acetate, acetoin, etc., showing good flavor characteristics, and has great application value in the process of liquor koji making or related fermented food brewing, thereby improving the flavor quality of the product.

Claims

1. A strain of Trichoderma citrinoviride producing multiple furanones, characterized in that: The Trichoderma virens strain producing multiple furanone substances is named JSY-F003 strain, and the preservation unit is China Center for Type Culture Collection (CCTCC), the preservation time is March 20, 2024, and the preservation number is CCTCC No. M 2024534.

2. The Trichoderma citriodora strain producing multiple furanones according to claim 1, characterized in that: The furanone substances are: 5-methyl-2(5H)-furanone, 3-methyl-2(5H)-furanone, 2(5H)-furanone (γ-crotonyl lactone), 4,5-dihydro-5-methyl-2(3H)-furanone (γ-valerolactone), 4-methyldihydrofuran-2(3H)-one (4-methyl-GAMMA-butyrolactone), 4,5-dimethyldihydrofuran-2(3H)-one, 2,3-dihydro-3,5-dihydroxy-6-methyl-4(H)-pyran-4-one, 5-methyl-2(3H)-furanone (angelica lactone), G-caprolactone, 5-vinyl-5-methyltetrahydrofuran-2-one (4-methyl-4-hydroxy-5-hexenoic acid-γ-lactone), dihydro-3-hydroxy-4,4-dimethyl-2(3H) furanone (pantolactone).

3. The use of a Trichoderma citriodora strain producing multiple furanone substances as claimed in claim 1, characterized in that: The Trichoderma virens strain producing multiple furanone substances is used in the process of making liquor koji or brewing related fermented foods.

Images