Function of the fluoride ion channel protein synthesis gene crcB in amino acid synthesis

Abstract

The present invention discloses the effect of the fluoride ion channel protein synthesis gene crcB on amino acid synthesis. The present invention provides a recombinant bacterium capable of expressing L-amino acids, in which the activity of the fluoride ion channel protein system encoded by the crcB gene is enhanced. The enhancement of the activity of the fluoride ion channel protein system is caused by the enhancement of the activity of the polypeptide encoded by the crcB gene. The experiments of the present invention demonstrate that overexpressing the fluoride ion channel protein gene crcB in Escherichia coli can improve the ability of Escherichia coli to produce L-amino acids.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to the effect of the synthetic gene crcB of fluoride ion channel protein on amino acid synthesis. Background Art

[0002] Fluoride ions in the environment can accumulate in bacterial cells through the weak acid accumulation effect, causing toxic effects. Microorganisms transport F - through the F - membrane transporter to the outside of the cell to inhibit its toxic effects.

[0003] The Fluc-Ec1 protein from the Fluc (fluoride channel) family is an ion channel composed of about 130 amino acids, with a unique dual-topology dimer structure and highly selective for fluoride ions.

[0004] The fluoride ion channel protein gene crcB, the main function of this protein is to allow fluoride ions to pass through the cell membrane, thus participating in various physiological processes. The opening and closing of the fluoride ion channel can regulate the concentration difference of fluoride ions inside and outside the cell, thereby affecting the ion balance and potential inside the cell. In bacteria, the crcB protein usually participates in the absorption and efflux of fluoride ions together with other proteins to help bacteria adapt to different environmental conditions.

[0005] Currently, the methods for synthesizing amino acids can be divided into two types: chemical synthesis and biological synthesis. Chemical synthesis: Chemical synthesis involves synthesizing amino acids through a series of organic synthesis reactions. The advantages of this method are that it can synthesize a variety of amino acids and the synthesis process is relatively simple. However, the disadvantages of chemical synthesis include: (1) complex synthesis routes and multiple-step reactions, resulting in high synthesis costs; (2) the need to use a large amount of organic reagents and solvents, causing environmental pollution; (3) various by-products may be generated during the synthesis process, requiring complex purification steps. Biological synthesis: Biological synthesis utilizes microbial or plant cell engineering to synthesize amino acids. The advantages of this method are that it can utilize the metabolic pathways of organisms themselves to synthesize amino acids, with better selectivity and efficiency. However, the disadvantages of biological synthesis include: (1) the need to construct engineered strains or transgenic plants, involving genetic engineering and biotechnology operations; (2) a large amount of substrates and energy may be required during the synthesis process, increasing production costs; (3) the biological synthesis pathways of some amino acids are complex and require further research and optimization. The key points for the need of new proteins or methods to synthesize amino acids include: (1) improving synthesis efficiency: developing more efficient synthesis routes and reaction conditions to increase the yield and purity of amino acids; (2) reducing costs: finding more economical substrates and catalysts, reducing by-products and waste during the synthesis process; (3) environmental friendliness: developing green synthesis methods, reducing the use of organic reagents and solvents, and reducing the impact on the environment; (4) optimizing biological synthesis: deeply studying the biological synthesis pathways of amino acids, optimizing metabolic pathways and regulatory mechanisms, and improving the efficiency and yield of biological synthesis.

[0006] Therefore, there are some challenges and disadvantages in the methods for synthesizing amino acids, and further research and development of new proteins or methods are needed to improve synthesis efficiency, reduce costs, be environmentally friendly, and optimize biological synthesis pathways. Summary of the Invention

[0007] The technical problem solved by the present invention is how to improve the ability of Escherichia coli to produce L-amino acids.

[0008] To solve the above technical problem, in the first aspect, the present invention provides a recombinant bacterium capable of expressing L-amino acids, in which the activity of the fluoride ion channel protein system encoded by the crcB gene in the recombinant bacterium is enhanced.

[0009] In the above-mentioned recombinant bacterium, the crcB gene is any one of the following:

[0010] A1) a cDNA molecule or DNA molecule whose coding sequence contains SEQ ID No.1;

[0011] A2) a coding cDNA molecule or coding DNA molecule whose coding sequence contains a protein with an amino acid sequence of SEQ ID No.2;

[0012] A3) The coding sequence contains the DNA molecule at positions 1065 - 1448 of SEQ ID No. 3;

[0013] A4) A cDNA molecule or DNA molecule that hybridizes with the cDNA or DNA molecule defined by A1), A2), or A3) and encodes a protein with the same function.

[0014] In the recombinant bacterium described above, the enhancement of the activity of the fluoride ion channel protein system is caused by the enhanced activity of the polypeptide encoded by the crcB gene.

[0015] In the recombinant bacterium described above, the polypeptide encoded by the crcB gene includes the protein shown in SEQ ID NO: 2;

[0016] or the polypeptide encoded by the crcB gene includes a protein that has 80% or more identity with the amino acid sequence of SEQ ID NO: 2 and has the same biological function.

[0017] In the recombinant bacterium described above, the 80% or more identity with SEQ ID NO: 2 can be an amino acid sequence that has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% homology or identity with SEQ ID NO: 2. In addition, it is obvious that any crcB protein with an amino acid sequence in which part of the sequence is deleted, modified, substituted, conservatively substituted, or added can also fall within the scope of this application, as long as the amino acid sequence has such homology or identity and exhibits the function corresponding to the crcB protein.

[0018] As used herein, although described as "a polypeptide or protein comprising an amino acid sequence described by a specific sequence number", "a polypeptide or protein consisting of an amino acid sequence described by a specific sequence number", or "a polypeptide or protein having an amino acid sequence described by a specific sequence number", it is obvious that in this application, any protein with an amino acid sequence in which part of the sequence is deleted, modified, substituted, conservatively substituted, or added can be used, even if it has the same or corresponding activity as the polypeptide consisting of the amino acid sequence of the corresponding sequence number. For example, it can be the case where sequences that do not change the protein function are added to the N-terminus and / or C-terminus of the amino acid sequence, natural mutations, their potential mutations (silent mutations), or conservative substitutions.

[0019] For example, sequences, naturally occurring mutations, their potential mutations (silent mutations), or conservative substitutions that do not change the function of the crcB protein of the present application can be added or deleted at the N-terminus, C-terminus, and / or internally of the amino acid sequence.

[0020] As used herein, the term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structure and / or chemical properties. Such amino acid substitutions generally occur based on the similarity of the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilicity of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; aromatic amino acids include phenylalanine, tryptophan, and tyrosine; hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan. In addition, amino acids can be divided into amino acids with charged side chains and amino acids with uncharged side chains. Examples of amino acids with charged side chains include aspartic acid, glutamic acid, lysine, arginine, and histidine. Amino acids with uncharged side chains can be further divided into non-polar amino acids or polar amino acids. Examples of non-polar amino acids are glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, and examples of polar amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Generally, conservative substitutions have little or no effect on the activity of the resulting polypeptide. Generally, conservative substitutions can have little or no effect on the activity of a protein or polypeptide.

[0021] In addition, the crcB protein can also include deletions or additions of amino acids that have minimal effects on the properties and secondary structure of the polypeptide. For example, the polypeptide can be conjugated to an N-terminal signal (or leader) sequence involved in co-translational or post-translational transfer of the protein. In addition, the polypeptide can also be conjugated to another sequence or linker to identify, purify, or synthesize the polypeptide.

[0022] The recombinant bacterium described above is Escherichia coli.

[0023] In a second aspect, the present invention provides a method for constructing the recombinant bacterium described in the first aspect, including the following steps: by regulating the expression of the crcB gene described in the first aspect in the target microorganism, or regulating the activity or content of the polypeptide encoded by the crcB gene described in the first aspect in the target microorganism, to regulate the L-amino acid production of the microorganism, and obtaining a microorganism with a changed L-amino acid production, which is the target recombinant bacterium.

[0024] In the method described above, the method for regulating the expression of the crcB gene in the target microorganism or regulating the activity or content of the polypeptide encoded by the crcB gene in the target microorganism is any one of the following:

[0025] B1) Introduce the crcB gene into the target microorganism;

[0026] B2) Introduce the coding gene of the protein crcB with the amino acid sequence of SEQ ID NO.2 into the target microorganism.

[0027] In the above text, the target microorganism is Escherichia coli.

[0028] In the above method, the introduced crcB gene or the coding gene of the protein crcB includes the crcB gene shown at positions 1065 - 1448 of SEQ ID No.3.

[0029] Furthermore, the introduced crcB gene or the coding gene of the protein crcB includes PcrcB - crcB shown at positions 904 - 1448 of SEQ ID No.3.

[0030] Furthermore, the crcB gene or the coding gene of the protein crcB is introduced in the form of a crcB overexpression integration homologous arm DNA fragment shown in SEQ ID No.3.

[0031] In the above text, the introduction is to integrate into the genome of the target microorganism.

[0032] Furthermore, the position of integration into the genome of the target microorganism is to integrate into the htpG gene of the target microorganism.

[0033] Even further, the integration into the htpG gene of the target microorganism specifically means replacing the nucleotide residues other than the first 1 - 5 bases in the gene nucleotide sequence of the target microorganism genome with the crcB overexpression integration homologous arm DNA fragment shown in SEQ ID No.3. htpG The method of integrating into the genome of the target microorganism described above is CRISPR / Cas9 gene editing;

[0034] The target sequence of the sgRNA used in the CRISPR / Cas9 gene editing is SEQ ID No.6;

[0035] The CRISPR / Cas9 gene editing includes the recombinant plasmid pGRB - sgRNA -

[0036] expressing sgRNA, Cas9 protein or mRNA or the plasmid expressing it, and the crcB overexpression integration homologous arm DNA fragment; htpG The nucleotide sequence of the crcB overexpression integration homologous arm DNA fragment is SEQ ID No.3.

[0037] The nucleotide sequence of the crcB overexpression integration homologous arm DNA fragment is SEQ ID No.3.

[0038] In the above text, the plasmid expressing Cas9 may be the pREDCas9 plasmid.

[0039] In the method described above, the target microorganism is Escherichia coli.

[0040] Furthermore, the target microorganism may be wild-type Escherichia coli or Escherichia coli with high yield of L-amino acid.

[0041] Furthermore, the Escherichia coli with high yield of L-amino acid is Escherichia coli with high yield of L-arginine, Escherichia coli with high yield of L-threonine, Escherichia coli with high yield of L-tryptophan or Escherichia coli with high yield of L-valine.

[0042] In the examples of the present invention, Escherichia coli with high yield of L-arginine CGMCC NO.25402, Escherichia coli with high yield of L-threonine CGMCC NO.25404, Escherichia coli with high yield of L-tryptophan CGMCC NO.25403, and Escherichia coli with high yield of L-valine CGMCC NO.22721 are taken as examples.

[0043] The above high yields are all strains with increased yields of the corresponding L-amino acids compared with wild-type Escherichia coli.

[0044] The microorganisms with the above changes in L-amino acid yields are recombinant bacteria with increased L-amino acid yields compared with the target microorganisms.

[0045] In the third aspect, the present invention provides a recombinant bacterium prepared by the method described in the second aspect.

[0046] In the fourth aspect, the present invention provides the application of the recombinant bacterium described in the first or fourth aspect or the method described in the second aspect in any of the following:

[0047] C1) Regulating the yield of L-amino acids in microorganisms;

[0048] C2) Preparing L-amino acids;

[0049] C3) Constructing genetically engineered microorganisms for producing L-amino acids.

[0050] In the above text, the L-amino acids may specifically include any one or more of L-threonine, L-valine, L-tryptophan, L-arginine, L-isoleucine, L-leucine, L-lysine, and L-tyrosine.

[0051] In the fifth aspect, the present invention provides the application of the protein crcB with the amino acid sequence of SEQ ID NO.2 in any of the following:

[0052] D1) Regulating the yield of L-amino acids in microorganisms;

[0053] D2) Preparation of L - amino acids;

[0054] D3) Construction of genetically engineered microorganisms for producing L - amino acids.

[0055] In the above text, the L - amino acids may specifically include any one or more of L - threonine, L - valine, L - tryptophan, L - arginine, L - isoleucine, L - leucine, L - lysine, and L - tyrosine.

[0056] In a sixth aspect, the present invention provides a method for producing L - amino acids, comprising the following steps: fermenting the recombinant bacteria of the first or fourth aspect or the recombinant bacteria prepared by the method described in the second aspect, and collecting the fermentation product to obtain L - amino acids.

[0057] The above fermentation conditions are selected according to different types of L - amino acids, and specific details can be found in the examples.

[0058] The experiments of the present invention prove that overexpressing the fluoride ion channel protein gene crcB in Escherichia coli can improve the ability of Escherichia coli to produce L - amino acids.

[0059] Depositing Instructions

[0060] Taxonomic name: Escherichia coli Escherichia coli

[0061] Strain number: YP004 - 8

[0062] Name of the depositary institution: China General Microbiological Culture Collection Center

[0063] Abbreviation of the depositary institution: CGMCC

[0064] Address of the depositary institution: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postcode: 100101

[0065] Date of deposit: July 25, 2022

[0066] Registration number in the deposit center: CGMCC No. 25402

[0067] Depositing Instructions

[0068] Taxonomic name: Escherichia coli Escherichia coli

[0069] Strain number: YP0158

[0070] Name of the depositary institution: China General Microbiological Culture Collection Center

[0071] Abbreviation of the depositary institution: CGMCC

[0072] Depository institution address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing 100101

[0073] Deposited date: July 25, 2022

[0074] Registration number in the depository center: CGMCC No. 25404

[0075] Depositing Instructions

[0076] Taxonomic name: Escherichia coli Escherichia coli

[0077] Strain number: YP006D

[0078] Depository institution name: General Microbiology Center, China Committee for Culture Collection of Microorganisms

[0079] Abbreviation of depository institution: CGMCC

[0080] Depository institution address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing 100101

[0081] Deposited date: July 25, 2022

[0082] Registration number in the depository center: CGMCC No. 25403

[0083] Depositing Instructions

[0084] Taxonomic name: Escherichia coli Escherichia coli

[0085] Strain number: YP045

[0086] Depository institution name: General Microbiology Center, China Committee for Culture Collection of Microorganisms

[0087] Abbreviation of depository institution: CGMCC

[0088] Depository institution address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing 100101

[0089] Deposited date: June 15, 2021

[0090] Registration number in the depository center: CGMCC No.22721 Description of the drawings

[0091] Figure 1 For htpG Results of gene knockout RT-qPCR detection

[0092] Figure 2 This is the detection result of RT-qPCR for the overexpression of the crcB gene. Specific implementation manners

[0093] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0094] Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels.

[0095] Example 1: Construction of a recombinant bacterium containing the fluoride ion channel protein crcB

[0096] According to the genome sequence of Escherichia coli W3110 published by NCBI, using the CRISPR / Cas9 gene editing technology, the fluoride ion channel protein crcB gene from Escherichia coli was overexpressed in the genomes of W3110 and the high L-amino acid-producing strain respectively, so as to more deeply study the effect of the crcB gene on the L-amino acid yield in the high-producing strain.

[0097] The nucleotide sequence of the coding gene crcB of the Escherichia coli fluoride ion channel protein crcB is SEQ ID No.1, and the amino acid sequence of the crcB protein it encodes is SEQ ID No.2.

[0098] In the present invention, it is necessary to knockout the Escherichia coli htpG gene (the corresponding sgRNA is named sgRNA- htpG ) and insert the PcrcB-crcB gene at the same time. That is, insert the gene from Escherichia coli ( htpG ) W3110 at the Escherichia coli site of the wild-type Escherichia coli W3110. crcB gene.

[0099] According to the genome sequence of Escherichia coli ( Escherichia coli ) W3110 published by NCBI, use CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ) to design the sgRNA target sequence. After selecting the appropriate sgRNA target sequence, add the linearized pGRB cloning vector terminal sequence at the 5' and 3' most ends of the target sequence, so as to form a complete plasmid expressing sgRNA through recombination.

[0100] I. Preparation of the plasmid expressing sgRNA

[0101] 1. Preparation of the coding DNA of sgRNA

[0102] The primers used in this experiment were designed as follows (synthesized by Invitrogen, Shanghai). The underlined bases are the homologous arm sequences of the pGRB cloning vector, and the lowercase bases are the target sequences of the sgRNA:

[0103] sgRNA- htpG- F: 5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT aaatcattcctcgaatccct GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG -3' (SEQ ID No.8)

[0104] sgRNA- htpG- R: 5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC AGGGATTCGA GGAATGATTT ACTAGTATTATACCTAGGACTGAGCTA GCTG TC A -3' (SEQ ID No.9)

[0105] Anneal the above sgRNA- htpG- F and sgRNA- htpG- R to obtain a DNA molecule with sticky ends at both ends.

[0106] The annealing system and procedure are as follows: PCR reaction system: sgRNA- htpG- F 10 μL, sgRNA- htpG- R 10 μL; the above annealing reaction procedure: denature at 95°C for 5 min, anneal at 50°C for 1 min. After annealing, use a DNA purification kit to recover the target fragment, measure the concentration of the DNA molecule with sticky ends at both ends, and dilute the concentration to 100 ng / μL.

[0107] 2. Construction of recombinant plasmid

[0108] Take the pGRB plasmid (purchased from addgene, catalog number #71539) and digest it with Spe I and dephosphorylate it to prevent self-ligation of the pGRB plasmid.

[0109] Digestion system: 10xBuffer 5 μL, Spe I 2.5 μL, pGRB plasmid DNA 3000 - 5000 ng, supplement ddH2O to 50 μL. Digest at 37°C for 3 h, and recover the linearized pGRB plasmid DNA by agarose gel electrophoresis and gel extraction.

[0110] Dephosphorylation system: 10xBuffer 5 μL, linearized pGRB plasmid DNA 1000 - 2000 ng, CIAP 2.5 μL, supplement ddH2O to 50 μL. After treatment at 37°C for 1 h, recover it using a DNA purification kit to obtain the linear pGRB plasmid.

[0111] The DNA molecules with sticky ends obtained above 1 and the linear pGRB plasmid were recombinantly ligated using the Gibson Assembly kit (New England) to obtain a recombinant plasmid.

[0112] The above recombinant ligation system: 2.5 μL of NEB assembly enzyme, 2 μL of linear pGRB plasmid, and 0.5 μL of DNA molecule with sticky ends at both ends. After assembly at 50 °C for 30 min, the product was transformed into DH5α competent cells, the plasmid was extracted, and sequenced and identified using the sequencing primers sgRNA-PF / sgRNA-PR. The constructed plasmid was named pGRB-sgRNA- htpG .

[0113] sgRNA-PF: 5'- GTCTCATGAGCGGATACATATTTG-3' (SEQ ID No.10)

[0114] sgRNA-PR: 5'-ATGAGAAAGCGCCACGCT-3' (SEQ ID No.11)

[0115] The recombinant plasmid pGRB-sgRNA- htpG is a recombinant plasmid obtained by inserting a DNA molecule with sticky ends at both ends into the Spe I site of the pGRB plasmid. The DNA molecule with sticky ends at both ends and a partial fragment of the pGRB plasmid constitute the sgRNA-encoding nucleic acid, and this plasmid expresses Δ htpG- sgRNA.

[0116] The target sequence of sgRNA is aaatcattcctcgaatccct (SEQ ID No.6) (19 - 20 bp).

[0117] The nucleotide sequence of the sgRNA-encoding nucleic acid is as shown in SEQ ID No.7, and positions 36 - 55 are the sgRNA target sequence.

[0118] II. Preparation of the crcB overexpression integration homologous arm DNA fragment

[0119] Using the W3110 genomic DNA as a template, PCR amplifications were carried out with primers P1 / P2, P3 / P4, and P5 / P6 respectively using KAPA HiFi HotStart to obtain three fragments with sizes of 920 bp, 643 bp, and 943 bp of Δ htpG upstream homologous arm (Δ htpG -UP), PcrcB-crcB, and Δ htpG downstream homologous arm (Δ htpG-DOWN) DNA fragment. After the PCR reaction, agarose gel electrophoresis was used to recover Δ, respectively, using a column-type DNA gel recovery kit. htpG -UP, PcrcB-crcB, and Δ htpG -DOWN. The recovered DNA was subjected to overlap PCR with primers P1 / P6 to obtain a 2424-bp crcB overexpression integration homologous arm DNA fragment Up-PcrcB-crcB-Down (SEQ ID No. 3).

[0120] Among them, positions 1-903 of SEQ ID No. 3 are the Δ htpG upstream homologous arm, positions 904-1064 of SEQ ID No. 3 are the promoter PcrcB, positions 1065-1448 of SEQ ID No. 3 are the crcB gene, and positions 1502-2424 of SEQ ID No. 3 are the Δ htpG downstream homologous arm.

[0121] PCR amplification system: 5× HiFi with Mg 2+ Buffer 10 μL, dNTP Mixture (10 mM) 1.5 μL, primers (10 pM) 1.6 μL each, KAPA HiFi HotStart (1 U / μL) 0.5 μL, supplemented with ddH2O to a total volume of 50 μL.

[0122] PCR amplification program: Pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0123] Primers were designed as follows (synthesized by Invitrogen, Shanghai), and the sequences underlined with a yellow background are the pBJ23119 sequences:

[0124] P1: 5'- ACACAACTGC CGTCGCGTAG-3' (SEQ ID No. 12),

[0125] P2: 5'- GAGATTTGTG CCTCGTTGAT GTAGGTCTAC CTCAATAATG-3' (SEQ ID No. 13),

[0126] P3: 5'-CA TTATTGAGGT AGACCTAC AT CAACGAGGCA CAAATCTC -3' (SEQ ID No. 14),

[0127] P4: 5'-GAAGGTCATC CGGCATTACA GATACGTCAG CAAGAATTCA-3' (SEQ ID No.15),

[0128] P5: 5'-TGAATTCTT GCTGACGTAT CTGTAATGCC GGATGACCTT C-3' (SEQ ID No.16),

[0129] P6: 5'-GCCTGAGATT GCTGATAAGT-3' (SEQ ID No.17),

[0130] P7: 5'-GAAGAGATCG CGCAGCTGGA -3' (SEQ ID No.18),

[0131] P8: 5'-CTGCCGAAAA TGTTGAGAAG-3' (SEQ ID No.19),

[0132] P9: 5'-GGCAACCAGC ATTGCCACCT C -3' (SEQ ID No.20),

[0133] P10: 5'-TCAGAAAAAG GAATAGCGCA G-3' (SEQ ID No.21).

[0134] III. Preparation and transformation of competent cells

[0135] W3110-Cas9 is a recombinant bacterium obtained by introducing the pREDCas9 plasmid (addgene catalog number: #71541) into W3110.

[0136] The L-arginine-producing bacterium CGMCC 25402-Cas9 is a recombinant bacterium obtained by introducing the pREDCas9 plasmid into CGMCC NO.25402.

[0137] The L-threonine-producing bacterium CGMCC 25404-Cas9 is a recombinant bacterium obtained by introducing the pREDCas9 plasmid into CGMCC NO.25404.

[0138] The L-tryptophan-producing bacterium CGMCC 25403-Cas9 is a recombinant bacterium obtained by introducing the pREDCas9 plasmid into CGMCC NO.25403.

[0139] The L-valine-producing bacterium CGMCC 22721-Cas9 is a recombinant bacterium obtained by introducing the pREDCas9 plasmid into CGMCC NO.22721.

[0140] Prepare competent cells of W3110-Cas9, L-arginine CGMCC 25402-Cas9, L-threonine CGMCC 25404-Cas9, L-tryptophan CGMCC 25403-Cas9 and L-valine CGMCC 22721-Cas9 respectively. When the cell density reaches OD 600 = 0.1, add IPTG with a final concentration of 0.1 mM for induction culture to induce λ-Red-mediated homologous recombination. When the induction culture reaches OD 600 = 0.6, collect the cells to prepare competent cells, and obtain competent cells of W3110-Cas9, L-arginine CGMCC 25402-Cas9, L-threonine CGMCC 25404-Cas9, L-tryptophan CGMCC 25403-Cas9 and L-valine CGMCC 22721-Cas9.

[0141] Transform 800 ng of the above-prepared pGRB-sgRNA- htpG plasmid and 1000 ng of the above-prepared crcB overexpression integrated homologous arm DNA fragment Up-PcrcB-crcB-Down into 100 μL of each of the above competent cells, and spread them on a 2-YT agar plate containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) for culture at 32°C. Identify the single colonies generated by culture by rTaq PCR using primers P7 / P8 respectively. The positive transformants are those with a PCR-amplified fragment of 1392 bp (SEQ ID No.4), and the original bacteria are those without amplified fragments.

[0142] Then inoculate the positive transformants into 2-YT medium containing spectinomycin (100 mg / L) and arabinose with a final concentration of 0.2% to eliminate the plasmid pGRB-sgRNA- htpG , select the colonies that grow on spectinomycin (100 mg / L) but do not grow on ampicillin (100 mg / L), and then transfer these colonies to 2-YT medium for culture at 42°C to eliminate the pREDCas9 plasmid. Select the colonies that do not grow on spectinomycin (100 mg / L) but grow on antibiotic-free 2-YT, and identify them by rTaq PCR using primers P9 / P10 respectively. The positive recombinant bacteria are those with a PCR-amplified fragment of 1520 bp (SEQ ID No.5), and the original bacteria are those without amplified fragments.

[0143] The above-mentioned positive recombinant bacteria are respectively recombinant bacteria overexpressing PcrcB-crcB in the genome of Escherichia coli wild-type W3110 (named W3110 / PcrcB-crcB), recombinant bacteria overexpressing PcrcB-crcB in the genome of L-arginine-producing bacterium CGMCC No. 25402 (named YPR / PcrcB-crcB), recombinant bacteria overexpressing PcrcB-crcB in L-threonine-producing bacterium CGMCC No. 25404 (named YPT / PcrcB-crcB), recombinant bacteria overexpressing PcrcB-crcB in L-tryptophan-producing bacterium CGMCC No. 25403 (named YPW / PcrcB-crcB), and recombinant bacteria overexpressing PcrcB-crcB in L-valine-producing bacterium CGMCC No. 22721 (named YPV / PcrcB-crcB).

[0144] The recombinant bacterium W3110 / PcrcB-crcB is obtained by replacing the htpG gene (NC_000913.3, 2-May-2024) with other nucleotide residues except the first to fifth bases in the nucleotide sequence of the Escherichia coli W3110 genome, while keeping other nucleotides in its genome unchanged.

[0145] The recombinant bacterium YPR / PcrcB-crcB is obtained by replacing the htpG gene in the genome of Escherichia coli CGMCC No. 25402 with PcrcB-crcB (positions 904 - 1448 of SEQ ID No. 3), while keeping other nucleotides in its genome unchanged.

[0146] The recombinant bacterium YPT / PcrcB-crcB is obtained by replacing the htpG gene with other nucleotide residues except the first to fifth bases in the nucleotide sequence of the Escherichia coli CGMCC No. 25404 genome, while keeping other nucleotides in its genome unchanged.

[0147] The recombinant bacterium YPW / PcrcB-crcB is obtained by replacing the htpG gene with other nucleotide residues except the first to fifth bases in the nucleotide sequence of the Escherichia coli CGMCC No. 25403 genome, while keeping other nucleotides in its genome unchanged.

[0148] The recombinant bacterium YPV / PcrcB-crcB is obtained by replacing the nucleotide residues other than the first to fifth bases in the gene nucleotide sequence of htpG in the genome of Escherichia coli CGMCC No. 22721, while keeping the other nucleotides in its genome unchanged. htpG The recombinant bacterium is obtained by removing the first to fifth bases in the gene nucleotide sequence and keeping the other nucleotides in its genome unchanged.

[0149] Each of the above recombinant bacteria contains a double copy of the crcB gene shown in SEQ ID No. 1, namely the crcB gene of the strain itself and the exogenously introduced crcB gene.

[0150] IV. RT-qPCR Detection of Recombinant Strains

[0151] The recombinant bacteria YPR / PcrcB-crcB, YPT / PcrcB-crcB, YPW / PcrcB-crcB, YPV / PcrcB-crcB, W3110 / PcrcB-crcB and Escherichia coli W3110 were cultured for 24 h respectively, and then the cells were collected by centrifugation at 4 °C. RNA was extracted using an RNA extraction kit (purchased from Takara, Code No: 9108), and reverse transcribed into cDNA using a Premix reverse transcription kit (purchased from Takara, Code No.: RR036Q). The transcriptional levels of genes P crcB - crcB and htpG were detected using a qPCR kit (purchased from Takara, Code No.: RR42LR). The internal reference gene was selected as 16S RNA, and the primers were designed as follows:

[0152] P crcB - crcB -F: 5'- CGTTACACTT ATCACTCA -3' (SEQ ID No. 22)

[0153] P crcB - crcB -R: 5'-GTAACAAAAA CACCACTT-3' (SEQ ID No. 23)

[0154] ΔhtpG -F: 5'- GATGGCGAAC TACGCGTTC-3' (SEQ ID No. 24)

[0155] ΔhtpG -R: 5'- ATTTCAGTAC CACGATCTT-3' (SEQ ID No. 25)

[0156] The results are asFigure 1 and Figure 2 As shown in Figure 2 , it can be seen that, compared with Escherichia coli W3110, in the recombinant strains YPR / PcrcB–crcB ( Figure 1 denoted as YPR / ΔhtpG in Figure 1 ), YPT / PcrcB-crcB ( Figure 1 denoted as YPT / ΔhtpG in Figure 1 ), YPW / PcrcB-crcB ( Figure 1 denoted as YPW / ΔhtpG in htpG ), YPV / PcrcB-crcB ( Figure 1 denoted as YPV / ΔhtpG in Figure 1 ), and W3110 / PcrcB-crcB ( htpG denoted as W3110 / ΔhtpG in htpG ), the gene expression levels are significantly decreased, while the PcrcB-crcB gene expression level is significantly increased. This proves that the gene

[0157] Example 2. Fermentation Experiment

[0158] I. L-Threonine Fermentation Experiment

[0159] The Escherichia coli W3110 strain, Escherichia coli W3110 / PcrcB-crcB, YPT / PcrcB-crcB, and Escherichia coli the CGMCC No.25404 strain were respectively inoculated into a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) for fermentation experiments with an L-threonine fermentation medium and culture conditions. Each strain was repeated three times, and the results were averaged over the three fermentations. After fermentation, the fermentation product was centrifuged at 8000g for 5 min, and the supernatant was collected. The L-threonine and its content in the supernatant were detected by high performance liquid chromatography (HPLC), and the results were averaged over three replicates, as shown in Table 1.

[0160] L-Threonine fermentation medium: The solvent is water, and the solutes and their concentrations are glucose 13 g / L, (NH4)2SO4 1 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4•7H2O 0.8 g / L, FeSO4•7H2O 0.01 g / L, MnSO4•H2O 0.01 g / L, FM902 yeast powder 1.5 g / L, corn steep liquor 5 g / L, molasses 17 g / L, and ammonia was introduced to adjust the pH to 7.0.

[0161] L-Threonine fermentation culture conditions:

[0162] Calibrate DO to 100%: Temperature 37°C, ventilation ratio 1 vvm, rotation speed 800 rpm, tank pressure 0 Mpa, calibrated after 5 min;

[0163] Inoculum size: 10%;

[0164] Initial conditions: pH 7.0, culture temperature 37°C, tank pressure 0 Mpa, ventilation ratio 0.5 vvm, rotation speed 400 rpm;

[0165] Process control: pH 7.0, temperature 37°C, DO 30 - 50%, tank pressure 0 - 0.05 Mpa, ventilation ratio 0.5 - 1 vvm, rotation speed 400 - 800 rpm, glucose content in the fermentation broth: 0.1 - 0.5%.

[0166] Fermentation cycle: 30 h.

[0167]

[0168] As shown by the above fermentation results, compared with the non - overexpressed strains, the overexpression of the crcB gene can increase the threonine yield.

[0169] II. L - Tryptophan Fermentation Experiment

[0170] Take Escherichia coli Strain W3110, Escherichia coli W3110 / PcrcB - crcB, YPW / PcrcB - crcB and Escherichia coli Strain CGMCC No.25403 were respectively inoculated into a 5L fermenter of model BLBIO - 5GC - 4 - H (Shanghai Bailun Biotechnology Co., Ltd.) for fermentation experiments with L - tryptophan fermentation medium and culture conditions. Each strain was repeated three times, and the results were the average of the three repetitions. After fermentation, the fermentation product was centrifuged at 8000 g for 5 min, and the supernatant was collected. The L - tryptophan and its content in the supernatant were detected by high - performance liquid chromatography (HPLC), and the results were the average of the three repetitions, as shown in Table 2.

[0171] L - Tryptophan fermentation medium: The solvent is water, and the solutes and their concentrations are glucose 7 g / L, FM902 yeast powder 1 g / L, (NH4)2SO4 1.2 g / L, citric acid 1.2 g / L, MgSO4•7H2O 1.5 g / L, K2HPO4•3H2O 5.5 g / L, antifoaming agent 0.2 mL / L, and the pH is adjusted to 7.0 by passing ammonia.

[0172] L - Tryptophan culture conditions:

[0173] Calibrate DO to 100%: Temperature 35°C, rotation speed 800 rpm, ventilation ratio 1 vvm, tank pressure 0 Mpa, calibrated after 5 min;

[0174] Inoculum size: 10%;

[0175] Initial conditions: culture temperature 35°C, pH 7.0, aeration ratio 0.5 vvm, rotation speed 350 rpm;

[0176] Process control: pH 7.0, temperature 35°C, DO 15 - 30%, tank pressure 0 - 0.05 Mpa, aeration ratio 0.5 - 1 vvm, rotation speed 400 - 800 rpm, glucose content in the fermentation broth: 0.1 - 0.2%.

[0177] Fermentation cycle: 34 h.

[0178]

[0179] As shown by the above fermentation results, overexpression of the crcB gene can increase the yield of tryptophan compared with the strain without overexpression.

[0180] III. L-arginine fermentation experiment

[0181] The Escherichia coli W3110 strain, Escherichia coli W3110 / PcrcB-crcB, YPR / PcrcB-crcB and Escherichia coli CGMCC No.25402 were respectively inoculated into a 5L fermenter of model BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.) for fermentation experiments with L-arginine fermentation medium and culture conditions. Each strain was repeated three times and the average value of the three repetitions was taken. After fermentation, the fermentation product was centrifuged at 8000 g for 5 min, and the supernatant was collected. The L-arginine and its content in the supernatant were detected by high performance liquid chromatography (HPLC), and the average value of the three repetitions was taken. The results are shown in Table 3.

[0182] L-arginine fermentation medium: The solvent is water, and the solutes and their concentrations are glucose 8 g / L, FM902 yeast powder 3 g / L, K2HPO4•3H2O 6 g / L, MgSO4•7H2O 1 g / L, FeSO4•7H2O 0.05 g / L, betaine 0.5 g / L, VB 12 0.005 g / L, antifoaming agent 0.3 mL / L, ammonium sulfate 3 g / L, pH 7.2.

[0183] L-arginine fermentation culture conditions:

[0184] Calibrate DO 100%: temperature 35°C, rotation speed 1000 rpm, aeration ratio 0.8 vvm, tank pressure 0 Mpa, calibrated after 5 min;

[0185] Inoculation amount 15%;

[0186] Initial conditions: temperature 35°C, pH 7.2, tank pressure 0 mpa, ventilation ratio 0.3 vvm, rotation speed 350 rpm;

[0187] Process control: pH 7.2, temperature 35°C, DO 20 - 30%, tank pressure 0 - 0.05 Mpa, ventilation ratio 0.3 - 0.8 vvm, rotation speed 400 - 1000 rpm, glucose content in the fermentation broth: 0.05 - 0.1%.

[0188] Fermentation cycle: 50 h.

[0189]

[0190] As shown by the above fermentation results, overexpression of the crcB gene can increase the production of arginine compared with the non - overexpressed strains.

[0191] IV. L - valine fermentation experiment

[0192] Take Escherichia coli Strain W3110, Escherichia coli W3110 / PcrcB - crcB, YPV / PcrcB - crcB and Escherichia coli CGMCC No.22721 were respectively inoculated into a 5L fermenter of model BLBIO - 5GC - 4 - H (Shanghai Bailun Biotechnology Co., Ltd.) and fermented with L - valine fermentation medium and culture conditions. Each strain was repeated three times, and the results were the average of the three repetitions. After fermentation, the fermentation product was centrifuged at 8000g for 5 min, and the supernatant was collected. The L - valine and its content in the supernatant were detected by high - performance liquid chromatography (HPLC), and the results were the average of the three repetitions, as shown in Table 4.

[0193] L - valine fermentation medium: The solvent is water, and the solutes and their concentrations are yeast extract powder 4 g / L, corn steep liquor dry powder 2 g / L, peptone 4 g / L, methionine 2 g / L, KH2PO4•3H2O 7 g / L, MgSO4•7H2O 2 g / L, CoCl2 20 mg / L, (NH4)2SO4 3 g / L, citric acid 2 g / L, FeSO4•7H2O 50 mg / L, MnSO4•7H2O 30 mg / L, VH 20 mg / L, VB1 1.5 mg / L, VB3 1.5 mg / L VB 12 1.5 g / L, antifoaming agent 0.3 mL / L, (NH4)2SO4 3 g / L, pH value 7.0.

[0194] L - valine fermentation culture conditions:

[0195] Method for calibrating the dissolved oxygen electrode: Calibrate the zero point in saturated sodium sulfite solution and the full scale in air;

[0196] L-valine fermentation involves two-stage aerobic-oxygen-limited fermentation. First, the cells are cultured under aerobic fermentation. In the early stage, the air volume, rotation speed, and sugar feeding rate are adjusted to control the dissolved oxygen at about 25%. When the OD 600 value reaches 50 - 60, the rotation speed is reduced to 400 rpm, and the ventilation ratio is controlled at 0.3 vvm; and the aerobic fermentation is converted to oxygen-limited fermentation.

[0197]

[0198] As shown by the above fermentation results, compared with the non-overexpressing strain, the overexpression of the crcB gene can increase the yield of arginine.

[0199] As can be seen from the above fermentation results, for both high-yield L-amino acid strains and the model strain W3110, the overexpression of the crcB gene contributes to the increase in the yields of L-threonine, L-tryptophan, L-arginine, and L-valine.

[0200] The above has detailed the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modification, use, or improvement of the present invention, including changes made using conventional techniques known in the art that depart from the scope disclosed in this application. Some basic features can be applied according to the scope of the appended claims below.

Claims

1. Use of recombinant Escherichia coli in any one of the following: C1) Regulating the production of L - amino acids in Escherichia coli; C2) Preparing L - amino acids; C3) Constructing genetically engineered Escherichia coli for producing L - amino acids; The recombinant Escherichia coli is Escherichia coli with enhanced activity of the fluoride ion channel protein system encoded by the crcB gene; The enhanced activity of the fluoride ion channel protein system is caused by overexpressing the crcB gene to enhance the activity of the polypeptide encoded thereby; The polypeptide encoded by the crcB gene is the protein shown in SEQ ID NO:

2.

2. The use according to claim 1, wherein: The crcB gene is any one of the following: A1) A cDNA molecule or DNA molecule whose coding sequence contains SEQ ID No.1; A2) A coding cDNA molecule or coding DNA molecule whose coding sequence contains a protein with an amino acid sequence of SEQ ID No.2; A3) A DNA molecule at positions 1065 - 1448 of SEQ ID No.

3.

3. Use of the recombinant Escherichia coli prepared by the following method or the following method in any one of the following: C1) Regulating the production of L - amino acids in Escherichia coli; C2) Preparing L - amino acids; C3) Constructing genetically engineered Escherichia coli for producing L - amino acids; The following method comprises the steps of: regulating the production of L - amino acids in Escherichia coli by regulating the expression of the crcB gene described in any one of claims 1 - 2 in the target Escherichia coli, or regulating the activity or content of the polypeptide encoded by the crcB gene described in any one of claims 1 - 2 in the target Escherichia coli, to obtain Escherichia coli with a changed production of L - amino acids, which is the target recombinant Escherichia coli; The method for regulating the expression of the crcB gene in the target Escherichia coli or regulating the activity or content of the polypeptide encoded by the crcB gene in the target Escherichia coli comprises any one of the following: B1) Introducing the crcB gene into the target Escherichia coli; B2) Introducing the coding gene of the protein crcB with an amino acid sequence of SEQ ID NO.2 into the target Escherichia coli.

4. Use of the protein crcB with an amino acid sequence of SEQ ID NO.2 in any one of the following: D1) Regulating the production of L - amino acids in Escherichia coli; D2) Constructing genetically engineered Escherichia coli for producing L - amino acids.

5. A method for producing L - amino acids, comprising the steps of: fermenting the recombinant Escherichia coli described in any one of claims 1 - 3, collecting the fermentation product, and obtaining L - amino acids.

Images