An antifungal hydrolase and its application

Abstract

The present invention provides a hydrolase and its application. The hydrolase is isolated from Lysobacter enzymogenes LeYC36 and has antifungal activity. The amino acid sequence of the hydrolase provided by the present invention is SEQ ID NO:1. The present invention also provides the encoding gene of the hydrolase, and a specific nucleotide sequence thereof is SEQ ID NO:2 。 The present invention also provides a use of the hydrolase, which is an application in antagonizing fungi or preparing products for antagonizing fungi. The hydrolase screened by the present invention has significant fungicidal activity, causing the rupture of the fungal cell wall, resulting in the leakage of cell contents and the rupture of the cell membrane, and ultimately leading to the death of fungal cells.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to an antifungal hydrolase and its application. Background Art

[0002] Fungi are key components of the earth's ecosystem cycle, playing important roles in manufacturing and biomedical research, and affecting humans through their impacts on global health, agriculture, and biodiversity. Fungal pathogens are ubiquitous and pose a serious threat to public health, agriculture, and wildlife. It is estimated that fungal infections cause more than 1.5 million deaths annually and result in a 30% reduction in global crop yields. Fungi survive through parasitism and saprophytism, etc., and can cause diseases in their parasitic hosts. With the large-scale circulation of people and various items in the era of globalization, fungal infections that were originally limited to a certain area are more likely to spread, and the trend shows signs of intensification. Currently, in some cash crops, such as food crops like rice, wheat, corn, potatoes, and soybeans, fungal diseases have emerged, such as rice blast, soybean rust, wheat stem rust, maize head smut, and potato late blight, causing serious harm and significant economic losses. Fungal diseases not only affect food security but also threaten biodiversity. Therefore, scientific research in this field should be strengthened to control fungal diseases.

[0003] Currently, the methods for controlling fungal diseases in agriculture mainly rely on chemical pesticides. Fungicides such as methoxyacrylates, triazoles, and benzimidazoles are often used to control fungal diseases in crops. The control effect of chemical control is limited, and single use cannot meet the control requirements for diseases. Some systemic fungicides will also affect the physiological indicators of crops to a certain extent while inhibiting the growth and invasion of pathogenic bacteria. At the same time, the long-term application of chemical agents further causes problems such as the enhancement of pathogen resistance, pesticide residues, and environmental pollution. Summary of the Invention

[0004] The object of the present invention is to provide an antifungal hydrolase and its application. The hydrolase is isolated from Lysobacter enzymogenes LeYC36 and has antifungal activity.

[0005] The hydrolase provided by the present invention has an amino acid sequence of SEQ ID NO:1;

[0006] MVTRRTFLGASAAALAVPLLPRGALAATPARFNLALLNASGQNTAYAYVTGFDNGRPVFVRADGSAYYPPSPSAPVTPLGADCAIPLGANGSTVRVSVPRMYGARIYLVTGSKLNFYVNPGPAVVHPSFLNTSDTNFNKNWTFAEFTFNEYELFSNISYVDFVAAPLGLSLRSLSGRVETIPGLPAASLDPICYSLQQQATQEGSAWNSLIQRGPDGRNLRAMSAHYQAARFQNYLTGYIDACWNKYRGTTLTVDTQSGFGVLTARVGGDNLLRFNNGEAFAKPSTADVLSCDSGPFSLGGASDVRKAIIPRLAAALNRTTLLDNANQPNGEVASRFYRNAQTNHYARLVHERLPDNRGYAFPYDDVTASGGPDFSGAARSGDPDTLTVTLRALR;

[0007] The present invention also provides the encoding gene of the provided hydrolase, and a specific nucleotide sequence thereof is SEQ ID NO: 2;

[0008]

[0009] The present invention also provides a use of the hydrolase, which is an application in antagonizing fungi or preparing products for antagonizing fungi.

[0010] Another aspect of the present invention also provides a product for antagonizing fungi, which contains the above hydrolase or an engineered strain capable of recombinantly expressing the hydrolase.

[0011] The hydrolase screened and obtained by the present invention has significant fungicidal activity, causing the rupture of the fungal cell wall, resulting in the leakage of cell contents and the rupture of the cell membrane, and ultimately leading to the death of fungal cells. In addition, the fungicidal activity of the hydrolase of the present invention may also affect the physiological activities of fungi, including nutrient absorption, metabolism and growth. By destroying the cell wall, this enzyme may hinder the absorption and utilization of external nutrients by fungi, and have a negative impact on the survival and reproduction of fungi. Description of the Drawings

[0012] Figure 1 : SDS-PAGE analysis diagram of different concentration imidazole elution solutions for purifying GluB, where M: Protein Marker; 1: E. coli BL21 bacterial solution; 2-8: 10 mM, 20 mM, 50 mM, 75 mM, 100 mM, 250 mM, 500 mM imidazole elution solutions; 9: Supernatant of broken BL21-pET28a-gluB after nickel column chromatography.

[0013] Figure 2 : Diagram of the inhibitory effect of GluB on the growth of fungi under four dialysis solutions, where CG is the Control Group, the blank group. Figure A: Inhibitory activity of GluB on Penicillium sp.; Figure B: Inhibitory activity of GluB on Rhizopus sp.; Figure C: Inhibitory zone radius of GluB dialyzed with DTT buffer solution on Penicillium sp.; Figure D: Inhibitory zone radius of GluB dialyzed with DTT buffer solution on Rhizopus sp.

[0014] Figure 3 : Diagram of the inhibitory effect of GluB on the germination of different fungal spores under four dialysis solutions.

[0015] Figure 4 : Diagram of co-culturing of enzyme-producing Lysobacter LeYC36 and ΔgluB strain with fungi. Detailed Embodiments

[0016] Lysobacter enzymogenes LeYC36 is a Gram-negative bacterium belonging to the family Xanthomonadaceae, order Xanthomonadales, and genus Lysobacter. This bacterium can secrete a variety of extracellular hydrolases and secondary metabolites, such as glucanase, chitinase, protease, heat-stable antifungal factor HSAF (HeatStable Antifungal Factor), etc., which endows LeYC36 with the ability to antagonize various pathogenic microorganisms such as fungi, bacteria, and nematodes.

[0017] By analyzing the genome of LeYC36 strain and database alignment, a novel hydrolase in LeYC36 was discovered. The sequence of this enzyme was analyzed through the SMART database (https: / / smart.embl.de / ), and it was determined that it has a domain belonging to the glycoside hydrolase G64 family. It was speculated that it has the activity of β-1,3-glucanase and was named GluB. It was also found that the GluB enzyme has the effect of antagonizing fungi.

[0018] The present invention will be described in detail below in conjunction with examples and drawings.

[0019] Example 1: Determination of the amino acid sequence of the hydrolase

[0020] The genome of LeYC36 was analyzed, and the protease of the present invention was found. The sequence of this enzyme was analyzed through the SMART database (https: / / smart.embl.de / ), and it was determined that it has a domain belonging to the glycoside hydrolase G64 family. It was speculated that it has the activity of β-1,3-glucanase and was named GluB. The similarity of this protease to the studied β-1,3-glucanase is up to 32.28%, and the coverage rate is 85%. The nucleotide sequence of its encoding gene is SEQ ID NO:2, and the amino acid sequence of the encoded protein is SEQ ID NO:1.

[0021] Example 2: Preparation of recombinant expression vector and recombinant expression hydrolase

[0022] The gluB gene was PCR amplified in the genome of Lysobacter enzymogenes LeYC36. Appropriate restriction enzyme sites were added to the upstream and downstream primers. After purifying the PCR product, it was double-digested with the pET28a plasmid and ligated to construct the pET28a-gluB ligation product. The upstream and downstream primers are respectively:

[0023] GluB-F:CGCGGATCCGCCACCCCGGCGCGCTTCAACCTC gluB-R:CCCAAGCTTTCAGCGCAACGCCCGCAGCGTCAC

[0024] The ligation product of pET28a-gluB was transformed into competent cells BL21 by heat shock transformation method, and the positive strain BL21-pET28a-gluB recombinant strain was screened and obtained.

[0025] The BL21-pET28a-gluB recombinant strain was cultured in LB medium containing 100 μg / mL kanamycin. When it was cultured to the logarithmic phase (OD600 = 0.6 - 0.8), IPTG with a final concentration of 0.1 mM was added, and the protein expression was induced by culturing at 16 °C for 16 h. The cells were collected, centrifuged at 12,000 rpm for 15 min at 4 °C, the supernatant was discarded, the cells were resuspended with Binding Buffer, vortexed for 1 min, and then broken by an ultrasonic cell disruptor, centrifuged at 12,000 rpm for 10 min at 4 °C, and the supernatant was taken. The supernatant was the crude enzyme solution. After filtering the crude enzyme solution with a 0.22 μm filter, nickel affinity chromatography was carried out. First, Binding Buffer was added to pre-treat the nickel affinity column. Then the crude enzyme solution was loaded onto the column and passed through the column 3 times repeatedly. Then, elution was carried out with imidazole at different concentrations, which were 10, 50, 75, 100, 250, and 500 mM in sequence from low to high concentration, and the elution fractions were collected. The separation and purification results of GluB were analyzed by SDS-PAGE protein gel electrophoresis. Most of GluB had been separated from the broken supernatant of BL21-pET28a-gluB, and it was mainly in the elution fractions of 75 mM and 100 mM imidazole, and the band size was consistent with the predicted molecular weight of the target protein, 39.75 KDa ( Figure 1 )

[0026] Example 3: Antifungal effect of hydrolase

[0027] gluB was inserted into the pET-28a plasmid and transferred into BL21(DE3) competent cells to construct a heterologous protein expression vector. The protein was expressed in bacteria by induction with isopropyl-β-D-thiogalactoside (IPTG) and nickel column chromatography technology, and GluB was purified using four different dialysis buffers. The dialysis buffer formulations are shown in Table 1.

[0028] Table 1: Formulations of four dialysis buffers

[0029]

[0030] Take 200 μL of spore concentration of 1x10 5The spore suspensions of Rhizopus sp. and Penicillium sp. at [X] CFU / mL were spread on plates. Filter paper disks soaked with GluB enzyme solution were placed on the plates and incubated at 28 °C. We found that the GluB enzyme solution dialyzed with a dialysis solution containing dithiothreitol (DTT) could effectively inhibit the mycelial growth of Rhizopus sp. and Penicillium sp. Figure 2 ).

[0031] The GluB enzyme solutions under the four spore suspensions and the four dialysis solutions were mixed according to Table 2 and reacted at 45 °C for 12 h. Then, 10 μL was taken and placed on a PDA plate. The results showed that GluB in the DTT dialysis solution was active and could inhibit the spore germination of four fungi, namely Penicillium sp., Candida krusei, Rhizopus sp., and Aspergillus niger. Figure 3 ).

[0032] Table 2: Reaction system for GluB to inhibit fungal spore germination

[0033]

[0034] Example 4: Antifungal effect of hydrolase knockout strains

[0035] Using gene insertion inactivation technology, the whole genome DNA of Lysobacter enzymogenes LeYC36 was used as a template to amplify the homologous fragment of gluB, and a recombinant plasmid was constructed with pEX18 and heat-shock transformed into competent cells of S17-1λpir. The Lysobacter enzymogenes LeYC36 strain after secondary activation and the S17-1-pEX18-gluB strain were transferred to 40% TSB medium and LB liquid medium containing 25 μg / mL gentamicin according to an inoculation amount of 1%, the former was placed at 28°C, and the latter was placed at 37°C, and all were cultured with shaking at 180 rpm until the logarithmic phase; 1 mL of the Lysobacter enzymogenes and S17-1-pEX18-gluB bacterial solutions were taken, centrifuged at 5000 rpm at room temperature for 5 min, the supernatant was discarded, the cells were retained, 1 mL of 40% TSB medium was added to resuspend the cells and centrifuged again, and this was repeated twice. Finally, 60 μL of 40% TSB medium was added to resuspend the cells, and the cells were mixed according to the volume ratio of LeYC36 to S17-1-pEX18-gluB of 1:4. The mixed bacterial solution was left standing at 28°C for 24 h, taken out and spread on an LB solid medium containing both 35 μg / mL gentamicin and 100 μg / mL kana, and cultured at 28°C until single colonies formed. Single colonies were picked and transferred to 40% TSB medium containing both 35 μg / mL gentamicin and 100 μg / mL kana, and cultured with shaking at 28°C and 180 rpm. The genome in the gluB deletion mutant was extracted by the boiling method, and a forward primer gluB-2F and a reverse primer gluB-2R were designed on the gluB sequence and the pEX18 plasmid vector respectively to verify whether the gluB mutant was successfully constructed. The primers related to the insertion inactivation experiment are shown in Table 3:

[0036] Table 3: Primers used for gluB deletion mutation

[0037]

[0038] In the present invention, gluB in LeYC36 was knocked out by the above method, and the mutant strain and the wild type were cultured to OD 600 When it was 1, the bacterial solution and the spore solution with a concentration of 1×10 6 per mL were mixed according to a volume ratio of 2:1, and left standing at 28°C. After 24 h, 20 μL of the mixed solution was taken out and spotted on a PDA plate, and then put back into culture at 28°C. According to Figure 4 It can be seen that ΔgluB could not inhibit the spore germination of the four fungi, while the wild type LeYC36 could still effectively exert its antifungal activity, which verified again that the GluB protein screened in the present invention has the ability to antagonize fungi.

Claims

Use of the dialysate of the protease with the amino acid sequence of SEQ ID NO:1 in the preparation of a product for antagonizing fungi, said fungi being Penicillium, Rhizopus, Candida krusei, Aspergillus niger, and said dialysate containing dithiothreitol.

2. The application according to claim 1, wherein The nucleic acid sequence encoding the protease with the amino acid sequence of SEQ ID NO:1 is SEQ ID NO:2.

Images