dsRNA Targeting the Key Synthetic Gene RTB-JHAMT of Dendroctonus valens and Its Preparation Method and Application

Abstract

The present invention belongs to the field of forestry biotechnology, and provides a dsRNA targeting the key synthetic gene RTB-JHAMT of Dendroctonus valens, and a preparation method and application thereof. By using the RNA interference technology and interfering with the expression of the key synthetic gene RTB-JHAMT of pests, the present invention can affect the growth and development of pests, thereby achieving the control of pest populations. Compared with traditional chemical pesticides, it has higher precision and environmental friendliness, and has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of forestry biotechnology, and in particular relates to a dsRNA targeting the key synthetic gene RTB-JHAMT of juvenile hormone of Dendroctonus rubrum and a preparation method and application thereof. Background Art

[0002] The Red Turpentine Beetle (Dendroctonus valens LeConte), also known as the powerful beetle, belongs to the genus Dendroctonus, family Curculionidae, subfamily Scolytinae, order Coleoptera. Its larvae and adults feed on the phloem at the base of the trunk and roots of infested trees, causing the host plant to die due to nutrient loss caused by the ring feeding. In its native habitat, the Red Turpentine Beetle is a harmless secondary pest, but in newly invaded areas, it is extremely harmful to Chinese pine trees and is the most destructive Chinese pine pest, posing a serious threat to the country's forest ecosystem.

[0003] RNA interference (RNAi) technology is a gene silencing method that studies the function of specific genes by inhibiting their expression. The basic principle is to use double-stranded RNA (dsRNA) to complementarily bind to specific mRNA sequences and mediate their degradation or inhibit their translation, thereby inhibiting the expression of target genes. In forest pest control, RNAi technology can be used to create insect-resistant tree species or directly applied to pest management. By designing specific RNA molecules, pest genes can be silenced in a targeted manner, thereby interfering with the normal physiological processes of pests or increasing their sensitivity to pesticides. RNAi technology has higher specificity and environmental friendliness, can reduce the impact on non-target organisms, and is expected to reduce the excessive use of pesticides. Therefore, RNAi technology has great potential in forest pest control and provides a new solution for achieving sustainable forestry development. Summary of the Invention

[0004] The present invention aims to provide a dsRNA targeting the key synthetic gene RTB-JHAMT of juvenile hormone of Dendroctonus rubrum and a preparation method and application thereof.

[0005] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides a dsRNA targeting the key synthesis gene RTB-JHAMT of juvenile hormone of Dendroctonus rubrum (the sequence of gene RTB-JHAMT is shown in SEQ ID NO: 6), and the nucleotide sequence encoding the dsRNA is shown in SEQ ID NO: 9.

[0006] In a second aspect, the present invention provides biological materials containing the dsRNA or a nucleotide sequence encoding the dsRNA, wherein the biological materials include but are not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria or transgenic cell lines.

[0007] In a third aspect, the present invention provides a method for preparing the dsRNA, comprising the following steps:

[0008] 1) Extract total RNA from Dendroctonus rubrum and reverse transcribe it into cDNA;

[0009] 2) Using the cDNA as a template, PCR amplification was performed using the primers shown in SEQ ID NOs: 1-2 and 3-4, respectively;

[0010] 3) The two amplified products obtained in 2) were used as forward templates and reverse templates to synthesize dsRNA in vitro.

[0011] In a fourth aspect, the present invention provides use of the dsRNA or a nucleotide sequence encoding the dsRNA or a biological material containing them in preparing a preparation for controlling Dendroctonus rubrum.

[0012] In a fifth aspect, the present invention provides a preparation or kit for controlling Dendroctonus rubrum, wherein the preparation or kit comprises the dsRNA or a nucleotide sequence encoding the dsRNA or a biological material containing the same.

[0013] In a sixth aspect, the present invention provides a method for controlling Dendroctonus rubrum, which uses the dsRNA or the nucleotide sequence encoding the dsRNA or the biological material containing them to control Dendroctonus rubrum by injection, spraying or feeding.

[0014] Furthermore, the effective dose of the dsRNA is ≥2.5 μg per mouse.

[0015] In the present invention, the objects of prevention and control include the larvae of Dendroctonus rubrum.

[0016] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0017] (1) The present invention can affect the growth and development of pests by interfering with the expression of RTB-JHAMT, a key synthetic gene for juvenile hormone in pests, thereby achieving control of pest populations. Compared with traditional pesticides, it has lower non-target effects.

[0018] (2) Due to the high specificity of the present invention, the pollution and impact of chemical pesticides on the environment and non-target organisms can be reduced, which helps to protect the health of the ecological environment.

[0019] (3) The present invention may cause long-term growth and reproduction stunting of pest populations through gene interference, which may have a more lasting effect than chemical pesticides, reduce the need for frequent application of pesticides, save costs, and reduce potential risks to the environment and human health.

[0020] (4) dsRNA is highly targeted and can accurately act on juvenile hormone-related genes or signaling pathways in the target organism, achieving precise biological regulation and thus improving the regulatory effect.

[0021] (5) Since the dsRNA of the present invention can be prepared by biosynthesis, its production process may be sustainable, reducing dependence on chemical synthesis raw materials, which is conducive to the goal of sustainable development. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the expression level of the RTB-JHAMT gene in Dendroctonus rubrum injected with dsRNA in a preferred embodiment of the present invention.

[0023] Figure 2 This is the expression level of the RTB-JHAMT gene in Dendroctonus rubrum sprayed with dsRNA in a preferred embodiment of the present invention.

[0024] Figure 3 This is the RTB-JHAMT gene expression level of Dendroctonus rubrum fed with dsRNA in a preferred embodiment of the present invention.

[0025] Figure 4 This is the eclosion deformity of Dendroctonus rubrum after application of the dsRNA of the present invention.

[0026] In the figures, ns represents P>0.05, * represents P≤0.05, ** represents P≤0.01, *** represents P≤0.001, and **** represents P≤0.0001. DETAILED DESCRIPTION

[0027] The invention provides a new method for improving the control effect of Dendroctonus rubrum.

[0028] The present invention adopts the following technical solutions:

[0029] The invention provides a dsRNA targeting a juvenile hormone key synthesis gene RTB-JHAMT of a Dendroctonus rubrum gene. The dsRNA consists of a first RNA molecule and a second RNA molecule that are complementary and paired.

[0030] The present invention provides a primer set (dsJHAMT primer set) for preparing the dsRNA, wherein the primer set comprises a first primer pair and a second primer pair;

[0031] The nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO: 1, and is specifically as follows: 5′-GGATCCTAATACGACTCACTATAGGGGACGAAGGGCGATAATCAAA-3′;

[0032] The nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO: 2, and is as follows: 5′-AGACGTCGTAAATCGGGTTG-3′;

[0033] The nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO: 3, and is as follows: 5′-GACGAAGGGCGATAATCAAA-3′;

[0034] The nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO: 4, and is specifically as follows: 5′-GGATCCTAATACGACTCACTATAGGGAGACGTCGTAAATCGGGTTG-3′.

[0035] Among them, GGATCCTAATACGACTCACTATAGGG (SEQ ID NO: 5) is the T7 promoter.

[0036] The present invention provides a method for preparing the dsRNA, comprising the following steps:

[0037] (1) using the cDNA of Dendroctonus rubrum as a template, performing a first PCR amplification using the first primer pair to obtain a first synthetic template;

[0038] (2) using the cDNA of Dendroctonus rubrum as a template, performing a second PCR amplification using the second primer pair to obtain a second synthetic template;

[0039] (3) using the first synthetic template and the second synthetic template to obtain the first RNA molecule and the second RNA molecule; (4) renaturing the first RNA molecule and the second RNA molecule to obtain the RTB-JHAMTdsRNA.

[0040] In the present invention, the reaction procedures of the first PCR amplification and the second PCR amplification preferably include: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, 35 cycles; and extension at 72°C for 10 min.

[0041] The present invention has no special requirements for the method of synthesizing the dsRNA, and methods well known to those skilled in the art can be used. In the embodiment of the present invention, the Vazyme T7 RNAi Transcription Kit is preferably used for dsRNA synthesis.

[0042] The present invention also provides use of the dsRNA or the primer set or the dsRNA prepared according to the method in preventing and controlling Dendroctonus rubrum.

[0043] The dsRNA provided by the present invention can effectively silence the RTB-JHAMT gene of Dendroctonus rubrum. The relative expression of the RTB-JHAMT gene decreased by 98.00% 48 hours after injection of dsJHAMT, by 98.23% 24 hours after feeding dsJHAMT, and by 97.40% 24 hours after spraying dsJHAMT. The silencing effect persists over time, restricting the growth and development of Dendroctonus rubrum, affecting the further life activities of larvae, and ultimately achieving effective control. This provides a new approach to green control of forest pests.

[0044] The present invention also provides use of the dsRNA or the primer set or the dsRNA prepared according to the method in preparing a preparation for preventing and controlling Dendroctonus rubrum.

[0045] The present invention provides a formulation for controlling Dendroctonus rubrum. The formulation comprises the dsRNA, or a dsRNA prepared using the primer combination, or a dsRNA prepared using the method. In the present invention, the recommended effective dose of the dsRNA is ≥2.5 μg per beetle.

[0046] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0047] Example 1 RTB-JHAMT cloning and dsRNA synthesis

[0048] Based on the RTB-JHAMT gene sequence of Dendroctonus rubrum (SEQ ID NO: 6), a forward primer (SEQ ID NO: 7) and a reverse primer (SEQ ID NO: 8) of RTB-JHAMT of Dendroctonus rubrum were designed and synthesized. A target sequence with a fragment length of 365 bp (SEQ ID NO: 9) was amplified, and dsRNA of the RTB-JHAMT gene was obtained using an in vitro dsRNA synthesis kit.

[0049] The specific synthesis steps are as follows: a T7 promoter sequence (SEQ ID NO: 5) is added to the 5′ end of each specific primer, and two amplification products are obtained by cross-pairing PCR amplification with primers containing T7 and primers without T7 (i.e., PCR amplification is performed separately with two pairs of primers shown in SEQ ID NOs: 1 to 4); the template for PCR amplification is total RNA extracted from Dendroctonus rubrum larvae using the Yeasen total RNA extraction kit (refer to the reagent instructions of the cell / tissue total RNA extraction kit), and then the RNA is extracted using the Yeasen total RNA extraction kit. cDNA was reverse transcribed using the II First Strand cDNA Synthesis Kit. PCR amplification was performed using the following system: 25 μl of PCR 2× Phanta Max Buffer (Novagen), 2 μl each of forward and reverse transcriptase (10 μM concentration), 1 μl of cDNA template, and ddH₂O to a volume of 50 μl. The reaction procedure was as follows: initial denaturation at 95°C for 3 min, followed by 35 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 1 min, followed by extension at 72°C for 5 min. The two amplified products were confirmed by electrophoresis and used as forward and reverse templates for dsRNA synthesis, respectively (refer to the instructions for the Novagen T7 RNAi Transcription Kit). dsRNA concentration was determined using a microspectrophotometer, and 1 μl of dsRNA was confirmed by electrophoresis on a 1% agarose gel. The dsRNA was then stored at -80°C until further use.

[0050] The control used dsRNA of the EGFP gene, and the synthesis method was similar to that of the dsRNA of the JHAMT gene. The template was a plasmid containing the EGFP gene fragment. The forward primer of the first primer set was: 5′-GGATCCTAATACGACTCACTATAGGGATGGTGAGCAAGGGCGAGG-3′ (SEQ ID NO: 10),

[0051] The reverse primer is: 5′-CTTGTACAGCTCGTCCATGC-3′ (SEQ ID NO: 11).

[0052] The forward primer of the second primer set is: 5'-ATGGTGAGCAAGGGCGAGG-3' (SEQ ID NO: 12)

[0053] The reverse primer is: 5′-GGATCCTAATACGACTCACTATAGGGCTTGTACAGCTCGTCCATGC-3′ (SEQ ID NO: 13)

[0054] Example 2 Detection of the Silencing Effect of the RTB-JHAMT Gene in Dendroctonus rubrum

[0055] The RTB-JHAMT gene dsRNA synthesized in Example 1 (denoted as dsJHAMT, 2.5 μg / individual), the EGFP gene dsRNA synthesized in Example 1 (denoted as dsEGFP, 2.5 μg / individual), and ddH2O (1.5 μL / individual) were sprayed and fed to Dendroctonus rubrum larvae, and microinjected into the second intersegmental membrane of the abdomen of different Dendroctonus rubrum larvae. 12 h, 24 h, and 48 h after spraying, feeding, and injection, the whole larvae were quick-frozen in liquid nitrogen and placed at -80°C for later use.

[0056] The total RNA of Dendroctonus rubrum larvae was extracted using Yeasen total RNA extraction reagent (refer to the instructions of the cell / tissue total RNA extraction kit), and then the total RNA of Dendroctonus rubrum larvae was extracted using Yeasen's total RNA extraction reagent. cDNA was reverse transcribed using the II First Strand cDNA Synthesis Kit and used as a template for quantitative RT-PCR to detect RTB-JHAMT gene expression after injection. The RTB-JHAMT primer sequences used in qRT-PCR were F: 5′-GCAGTTATGATAGGGCGAC-3′ (SEQ ID NO: 14) and R: 5′-TGAGACTTGCCACAGGATT-3′ (SEQ ID NO: 15). The amplification protocol was as follows: 95°C initial denaturation for 1 minute, followed by 94°C denaturation for 100 seconds and 60°C annealing for 20 seconds for 35 cycles.

[0057] The expression level of JHAMT gene in Dendroctonus rubrum injected with dsRNA is as follows Figure 1 shown.

[0058] The expression level of JHAMT gene in Dendroctonus rubrum sprayed with dsRNA is as follows Figure 2 shown.

[0059] The expression level of JHAMT gene in Dendroctonus rubrum fed with dsRNA is as follows Figure 3 shown.

[0060] The eclosion deformity of Dendroctonus rubrum after using dsJHAM is shown in the figure. Figure 4 shown.

[0061] The mortality rate of Dendroctonus rubrum after injection of dsRNA is shown in Table 1.

[0062] The mortality rate of Dendroctonus rubrum after spraying dsRNA is shown in Table 2.

[0063] The mortality rate of Dendroctonus rubrum after feeding dsRNA is shown in Table 3.

[0064] Table 1 Mortality of Dendroctonus rubrum after dsRNA injection

[0065] Group Name Number of injected worms Number of dead insects mortality rate Inject dsJHAMT 25 25 100.00％ Injection of dsEGFP 25 9 36.00％ <![CDATA[Inject ddH2O]]> 25 7 28.00％

[0066] Table 2 Mortality of Dendroctonus rubrum after spraying dsRNA

[0067] Group Name Number of insects sprayed (individuals) Number of dead insects mortality rate Spray dsJHAMT 25 19 76.00％ Spraying dsEGFP 25 5 20.00％ <![CDATA[Spray ddH2O]]> 25 6 24.00％

[0068] Table 3 Mortality of Dendroctonus rubrum after feeding dsRNA

[0069] Group Name Number of injected worms Number of dead insects mortality rate Feeding dsJHEH 25 8 32.00％ Feeding dsEGFP 25 4 16.00％ <![CDATA[Feed ddH2O]]> 25 2 8.00％

[0070] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. dsRNA targeting the key synthetic gene of juvenile hormone in Dendroctonus valens RTB-JHAMT , characterized in that The nucleotide sequence encoding the dsRNA is as shown in SEQ ID NO:

9.

2. A biological material containing the dsRNA as described in claim 1 or a nucleotide sequence encoding the dsRNA, characterized in that, The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacterium or transgenic cell line.

3. The preparation method of the dsRNA according to claim 1, characterized in that, It includes the following steps: 1) Extract the total RNA of Dendroctonus valens, and reverse transcribe it into cDNA; 2) Using the cDNA as a template, perform PCR amplification with the primers shown in SEQ ID NO: 1-2 and the primers shown in SEQ ID NO: 3-4 respectively; 3) Use the two amplification products obtained in 2) as the forward template and the reverse template respectively to synthesize dsRNA in vitro.

4. Use of the dsRNA according to claim 1, or the nucleotide sequence encoding the dsRNA, or the biological material according to claim 2 in the preparation of a preparation for controlling Dendroctonus valens.

5. A preparation or kit for preventing and controlling Dendroctonus valens, characterized in that, The preparation or kit contains the dsRNA according to claim 1, or the nucleotide sequence encoding the dsRNA, or the biological material according to claim 2.

6. A method for controlling Dendroctonus valens, characterized in that, Use the dsRNA according to claim 1, or the nucleotide sequence encoding the dsRNA, or the biological material according to claim 2, and use the injection method, spraying method or feeding method to control Dendroctonus valens.

7. The method according to claim 6, characterized in that, The effective dose of the dsRNA is ≥ 2.5 μg per insect.

8. The method according to claim 6 or 7, characterized in that The control target includes the larvae of Dendroctonus valens.

Images