Use of AtTRM8A gene or its encoded protein in regulating plant growth and development

Abstract

The present invention discloses AtTRM8A The present invention observes the phenotypes of Arabidopsis thaliana with different methylation modifications and finds a gene with m 7 G modification-related genes AtTRM8A , by filtering AtTRM8A Homozygous mutant materials were used for phenotypic observation, and it was found that the flowering time of mutant plants was significantly later than that of wild-type plants. 7 The methylation content of G was identified by LC‑MS / MS. AtTRM8A Mutant m 7 The G content is significantly lower than that of the wild type; TRM8A In vitro methylation experiments of genes revealed that TRM8A has good methylase activity in vitro, proving AtTRM8A Genes regulate m 7 G modification affects the growth and development of Arabidopsis thaliana.

Description

Technical Field

[0001] The present invention relates to AtTRM8A New uses of genes or their encoded proteins, especially AtTRM8A Use of a gene or its encoded protein in regulating plant growth and development, belonging to AtTRM8A New areas of use for genes or their encoded proteins. Background Art

[0002] RNA modification is one of the important epigenetic modifications. Currently, more than 170 types of RNA modifications have been identified, which exist on various types of RNA, including tRNA, rRNA, mRNA, lncRNA and miRNA. They can affect the processing, metabolism and function of RNA, thereby regulating the expression of RNA and protein. Common RNA modifications include N 7 -methylguanosine (N 7 -methylguanosine,m 7 G), N6-methyladenosine (N 6 -methyladenosine,m 6 A) N 1 -methyladenosine (N 1 -methyladenosine,m 1 A), 5-methylcytosine (5-methylcytosine, m 5 C) etc.

[0003] AtTRM8A (At5g24840) is a 7 G methyltransferase. 7 G is guanine N 7 Methylation modification at the site is one of the most common RNA modifications, mainly present in the 5' cap region of mRNA, tRNA, rRNA, and also present in mRNA and miRNA. 7 G modification is produced by different enzymes. 7 G methyltransferases in humans include RNMT, METTL1 / WDR4, and WBSCR22 / TRMT122. RNMT mediates m 7 G cap modifies and increases mRNA stability. METTL1 / WDR4 controls internal mRNA, miRNA and tRNA m 7 G expression to regulate mRNA translation. 7 G expression, with potential effects on ribosome biogenesis. In the model plant Arabidopsis, m 7The G content was significantly downregulated under cold and salt stress. Methyltransferase TRM8B can catalyze tRNA to produce m 7 G modification. Therefore, understanding m 7 Effects of G modification on Arabidopsis growth and identification of the regulatory m 7 The genes modified by G are of great significance. Summary of the invention

[0004] One aspect of the present invention is to isolate from Arabidopsis AtTRM8A Gene (or At5g24840 Genes) and their encoded proteins are used to regulate plant growth and development.

[0005] In a preferred embodiment of the present invention, the regulation of plant growth and development is to AtTRM8A Gene deletion or mutation AtTRM8A Functional defects of the gene or its encoded protein result in late flowering phenotype or increased number of rosette leaves.

[0006] Another aspect of the present invention provides a method for delaying flowering or increasing the number of rosette leaves in Arabidopsis thaliana, comprising: interfering AtTRM8A Normal expression or normal function of genes in Arabidopsis AtTRM8A The decreased expression of the gene may cause defects in the normal function of the AtTRM8A protein.

[0007] Those skilled in the art can use conventional methods such as RNA interference technology or gene editing technology to inhibit AtTRM8A The expression of the gene may cause defects in the normal function of AtTRM8A protein, such as by using RNA interference technology to construct AtTRM8A The RNA interference vector of the gene, preferably the Gateway interference vector, inhibits the AtTRM8A The expression level of the gene may cause defects in the normal function of the AtTRM8A protein; wherein, RNA interference technology is a conventional technology in the field, which specifically binds to the mRNA homologous region expressed by the target gene through a 21-23bp short-chain double-stranded RNA (siRNA) or a long-chain double-stranded RNA (dsRNA; double-strand RNA), thereby degrading the mRNA to achieve the effect of inhibiting gene expression.

[0008] Those skilled in the art can also use conventional methods such as conventional gene knockout or gene editing technology to modify the gene in plants. AtTRM8A Gene loss-of-function mutations, such as those created using gene editing techniques AtTRM8A CRISPR / Cas9 gene editing vectors, etc., can be used to edit genes in plants AtTRM8AThe methods for performing loss-of-function mutation on genes are well known to those skilled in the art.

[0009] Those skilled in the art know that the main principle of the CRISPR / Cas 9 gene editing system or gene editing method is to find the location of gene editing in the host genome through a nucleic acid fragment called guide RNA (gRNA), that is, the targeted DNA sequence, and then cut the DNA through the Cas protein. In this application, the Cas protein includes but is not limited to Cas9, Cas12, Cas12a, Cas12j, Cas12e, Cas13 and / or Cas14.

[0010] The present invention AtTRM8A Gene( At5g24840 The nucleotide sequence of the gene is shown in SEQ ID No.1:

[0011] (SEQ ID No.1).

[0012] The present invention observed the phenotypes of Arabidopsis thaliana with different methylation modifications and found a 7 G modification-related genes AtTRM8A . By filtering AtTRM8A Homozygous mutant materials were used for phenotypic observation, and it was found that the flowering time of mutant plants was significantly later than that of wild-type plants (WT); the present invention also quantified the mRNA expression of plants. 7 The methylation content of G was identified by LC-MS / MS, and the results showed that the mutant m 7The G content was significantly lower than that of the wild type (WT); in vitro methylation experiments were performed on TRM8A, and it was found that TRM8A had good methylation activity in vitro, proving that AtTRM8A Genes regulate m 7 G modification affects the growth and development of Arabidopsis thaliana.

[0013] Definitions of terms used in this invention

[0014] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0015] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless specifically limited otherwise, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs (phosphorothioates, phosphoramidates, etc.) used in antisense technology. Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences. Specifically, degenerate codon substitutions can be achieved by generating a sequence in which the 3rd position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues.

[0016] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. That is, descriptions directed to polypeptides apply equally to describing peptides and describing proteins, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the terms encompass amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0017] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0018] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0019] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 shows Arabidopsis thaliana At5g24840Homozygous materials of gene T-DNA mutants; A, Arabidopsis thaliana At5g24840 Sequencing alignment of gene T-DNA insertion mutants; B, Arabidopsis thaliana At5g24840 Schematic diagram of the structure of gene T-DNA insertion mutants; C, the principle of Arabidopsis mutant screening; D, Attrm8a Homozygous mutant screening.

[0021] Figure 2 shows Arabidopsis thaliana Attrm8a Mutant phenotype identification; A, Arabidopsis thaliana Attrm8a Phenotypic analysis of mutants and wild-type Arabidopsis (WT); B, Analysis of the number of rosette leaves at flowering time, n = 24, ****<0.0001.

[0022] Figure 3 shows Arabidopsis thaliana Attrm8a The mRNA expression in mutants and wild-type Arabidopsis thaliana (WT) 7 G content identification.

[0023] Figure 4 shows the identification of ATTRM8A in vitro methyltransferase; A, pET28a-TRM8A-His recombinant plasmid PCR detection agarose gel electrophoresis B; SDS-PEGA before and after His-TRM8A induction; C, SDS-PEGA after His-TRM8A ultrafiltration; D, partial sequence of human MPZL1 5′UTR; E, in vitro methylation of MPZL1 5′UTR by His-TRM8A.

[0024] Figure 5 Arabidopsis mutants Attrm8a of Attrm8a Gene expression levels compared with wild-type Arabidopsis Attrm8a Comparison results of gene expression levels of (WT) and (WT). DETAILED DESCRIPTION

[0025] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0026] Example 1 Screening of homozygous mutants of AtTRM8A T-DNA insertion

[0027] Purchase T-DNA-inserted Arabidopsis mutant seeds ( Attrm8aMutant) At5g24840 gene mutant strain salk_208791 (SN30869). From http: / / signal.salk.edu / tdnaprimers.2.html, we can know that T-DNA is inserted in the promoter. At the same time, mutant detection primers are used, LP (5′TACCGATCATTAGCGTATCGG3′) (SEQ ID No.2) and RP (5′GCTTCAGAGGGAGTCACAGTG3′) (SEQ ID No.3) are used as primers, and wild-type DNA is used as template; LB (5′ATTTTGCCGATTTCGGAAC3′) (SEQ ID No.4) and RP (5′GCTTCAGAGGGAGTCACAGTG3′) (SEQ IDNo.5) are used as primers, trm8a The mutant DNA was used as a template for fragment amplification and sequencing. Sequencing comparison revealed that the T-DNA was inserted into the promoter of the gene AtTRM8A (At5g24840) ( Figure 1 Middle A and Figure 1 Because the T-DNA seeds ordered from the AraShare website are heterozygous, it is necessary to screen homozygous mutants through PCR before proceeding to the next step of the experiment. Figure 1 C) Using T-DNA specific primers and gene specific primers to identify the mutant type, and isolate and screen homozygous mutants ( Figure 1 The homozygous mutant material was propagated and the harvested seeds were stored at 4°C for subsequent phenotypic observation and experiments.

[0028] Example 2 Attrm8a Mutant phenotype identification

[0029] Wild-type Arabidopsis thaliana (WT) and Arabidopsis thaliana Attrm8a After disinfection, mutant seeds were spread on 1 / 2MS plates and placed at 4° for 48 h. They were transferred to 22°, 16 h light / 8 h dark conditions and cultured for 7 days. The seedlings were transplanted into soil and cultured under the same conditions until flowering. When the first flower of Arabidopsis thaliana bloomed, the number of rosette leaves was counted.

[0030] Phenotypic analysis showed that Arabidopsis Attrm8a The number of rosette leaves in the mutant is greater than that in wild-type Arabidopsis. Attrm8a The mutant exhibited a late-flowering phenotype ( Figure 2 Middle A and Figure 2 B), prove AtTRM8A Genes affecting growth and development in Arabidopsis thaliana.

[0031] Example 3 mRNA7 G content identification

[0032] Arabidopsis Attrm8a Mutant m 7 G content identification: 9-day-old Arabidopsis seedlings were used to extract RNA using the Promega Eastep® Super Total RNA Extraction Kit according to the instructions; mRNA was extracted using the Thermo Fisher Dynabeads™ mRNA DIRECT™ Purification Kit according to the instructions, and mRNA was identified by LC-MS / MS 7 G content.

[0033] The results of LC-MSMS analysis showed that ( Figure 3 ), Arabidopsis thaliana Attrm8a Compared with wild-type Arabidopsis thaliana, the mutant 7 The G content was significantly reduced, proving AtTRM8A Regulation of Arabidopsis m 7 G modification, in summary AtTRM8A Regulation of Arabidopsis m 7 G modification affects the growth and development of Arabidopsis thaliana.

[0034] Example 4 Identification of ATTRM8A methyltransferase in vitro

[0035] 1. Protein prokaryotic expression in vitro

[0036] High-fidelity DNA polymerase was used to amplify the target fragment. The product fragment with His tag was 756 bp in size. The fragment was recovered by PCR product recovery kit. The pET28a-TRM8A-His recombinant plasmid was obtained by homologous recombination. PCR detection was performed using specific primers. The PCR product was subjected to 1% agarose gel electrophoresis. The band size was the same as the target fragment size ( Figure 4 A in the middle), indicating that the His recombinant plasmid is a positive clone containing the target fragment. Select any positive clone for sequencing. If the sequencing result is consistent with the target fragment, the prokaryotic expression His-tagged fusion protein expression vector is obtained. The constructed His-tagged prokaryotic expression vector was transformed into E. coli BL21, and one of the single clones was selected for induction culture. Under the condition of 28℃ 0.5mmol / L IPTG induction for 3h, SDS-PEGA protein gel detection showed that the His-tagged fusion protein had obvious protein bands ( Figure 4Induction was performed under this induction condition, and the broken cells were collected and centrifuged. The supernatant was passed through a nickel column, which can hang the protein with the His tag on the column. The 2X PBS Buffer was used to balance and remove other impurities. The induced target protein was eluted with imidazole, and the target protein was desalted and ultrafiltered to obtain a relatively pure His recombinant fusion protein ( Figure 4 Middle C).

[0037] 2. T7 in vitro transcription

[0038] According to literature reports, the partial sequence of the 5′UTR of human MPZL1 was used as the Arabidopsis m 7 G Substrate for in vitro methylation assay. Gene sequence ( Figure 4 The target gene was synthesized into the pUC57 vector using HyperScribe from APExBIO. TM The gene was transcribed in vitro using the T7 High Yield RNA Synthesis Kit Plus. The RNA obtained by in vitro transcription should not contain any modified nucleosides.

[0039] 3. In vitro methylation assay

[0040] Reaction conditions and system for in vitro methylation experiments. A 50 μL reaction mixture containing 150 mM HEPES-KOH pH 8.0, 800 mM KCL, 1.5 mM MgCL2, 4 mM SAM, 100 mM DTT, RNase inhibito, T7 transcribed RNA, His-TRM8A and His-GST proteins was incubated at 16°C for 12-14 h. Dot-Blot was performed after dilution.

[0041] The results showed that His-TRM8A had significant methylation activity in vitro ( Figure 4 Middle E), indicating that TRM8A can regulate m 7 G modification.

[0042] Example 5 Arabidopsis thaliana Attrm8a Mutants and wild-type Arabidopsis thaliana (WT) Attrm8a Comparison of gene expression

[0043] Take 35-day-old Arabidopsis thaliana whole plants (Arabidopsis thaliana Attrm8amutants and wild-type Arabidopsis thaliana), RNA was extracted using Promega's Eastep® Super Total RNA Extraction Kit according to the instructions; cDNA was synthesized using MightyScript First-Strand cDNA Synthesis Master Mix; qPCR experiments were performed using Taq Pro Universal SYBR qPCR Master Mix using cDNA as a template.

[0044] The results showed that Arabidopsis Attrm8a Mutant Attrm8a The expression level of the gene was significantly lower than that of wild-type Arabidopsis (WT). Attrm8a The expression level of the gene ( Figure 5 ).

Claims

1. Isolated from Arabidopsis thaliana AtTRM8A The use of a gene or its encoded protein in regulating plant growth and development; the regulating plant growth and development is: AtTRM8A Gene deletion or mutation AtTRM8A The gene or its encoded protein produces functional defects, showing a late flowering phenotype or a phenotype with an increased number of rosette leaves; AtTRM8A The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. A method for delaying flowering or increasing the number of rosette leaves in Arabidopsis thaliana, characterized in that: include: interference AtTRM8A Normal expression or normal function of genes in Arabidopsis AtTRM8A The expression level of the gene decreases or causes defects in the normal function of the AtTRM8A protein; AtTRM8A The nucleotide sequence of the gene is shown in SEQ ID No.1.

Images