Application of ononetin in the preparation of anti-renal fibrosis drugs

Abstract

The present invention relates to the field of medical technology, and in particular to the use of Ononetin in the preparation of an anti-renal fibrosis drug. Ononetin can at least reduce the expression of renal tubular cell fibrosis genes Acta2, Col1a1, Vim and Col3a1 induced by TGF-β stimulation, thereby resisting renal fibrosis.

Description

Technical Field

[0001] The invention relates to the field of medical technology, and in particular to application of Ononetin in the preparation of anti-renal fibrosis drugs. Background Art

[0002] Organ fibrosis refers to pathological changes in organs such as the lungs, liver, kidneys, blood vessels, pancreas, and skin, with an increase in fibrous connective tissue and a decrease in parenchymal cells in organ tissues. Severe cases can lead to organ structural destruction and functional impairment, or even failure. The pathogenesis of organ fibrosis is complex, and a variety of acute and chronic diseases can cause an increase in fibrous connective tissue and a decrease in parenchymal cells in organ tissues. It is also affected by multiple factors, including immune response, inflammatory response, cell metabolism, and genetic factors.

[0003] Commonly used anti-fibrotic drugs include pirfenidone and nintedanib. Clinical studies have shown that they can delay the process of fibrosis to a certain extent. Pirfenidone is a TGF-β inhibitor suitable for mild and moderate idiopathic pulmonary interstitial fibrosis; while nintedanib is a multi-target tyrosine kinase inhibitor suitable for the treatment of idiopathic pulmonary fibrosis. For renal fibrosis, there are currently no marketed drugs that can reverse / delay renal fibrosis. Most chronic kidney diseases will progress to end-stage renal disease, so there is an urgent need to develop drugs that reverse / delay renal fibrosis. TGF-β-mediated renal tubular cells play an important role in renal fibrosis. They can participate in renal fibrosis through their own epithelial-mesenchymal transition and paracrine regulation. Therefore, the development of drugs targeting renal tubular cells is of great significance in reversing / delaying renal fibrosis. Summary of the invention

[0004] In order to solve the above problems, the present invention provides the use of Ononetin in the preparation of anti-renal fibrosis drugs. TRPM3 (Transient receptor potential cation channel, subfamily M, member 3) is mainly expressed in the nervous system and kidneys. Ononetin is an effective selective TRPM3 channel blocker that can reduce the expression of fibrosis genes Acta2, Col1a1, Vim and Col3a1 induced by TGF-β stimulation, thereby preventing fibrosis.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] Application of ononetin in the preparation of anti-renal fibrosis drugs.

[0007] Preferably, the anti-fibrosis drug is an anti-renal fibrosis drug.

[0008] Preferably, the Cas number of Ononetin is 487-49-0.

[0009] Preferably, the Ononetin inhibits the expression of fibrosis genes.

[0010] Preferably, the fibrosis gene includes one or more of the Acta2 gene, Col1a1 gene, Vim gene and Col3a1 gene.

[0011] Preferably, the dosage form of the drug includes one or more of an oral dosage form, an injection dosage form, an inhalation dosage form and a transdermal dosage form.

[0012] Preferably, the drug further comprises pharmaceutically acceptable excipients, which include one or more of fillers, binders, bases, disintegrants, lubricants, solvents, solubilizers, flavoring agents, colorants, taste masking agents, pH regulators, isotonic agents, suspending agents, thickeners, preservatives, stabilizers, antioxidants, wetting agents, surfactants, suspending agents, propellants, absorption enhancers, absorption delay agents and coating materials.

[0013] definition:

[0014] The term "pharmaceutically acceptable salt" refers to a salt prepared from a compound of the present invention and a relatively nontoxic, pharmaceutically acceptable acid or base. When the compound of the present invention contains a relatively acidic functional group, a base addition salt can be obtained by contacting the prototype of such compound with a sufficient amount of a pharmaceutically acceptable base in a pure solution or a suitable inert solvent. Pharmaceutically acceptable base addition salts include, but are not limited to, lithium salts, sodium salts, potassium salts, calcium salts, aluminum salts, magnesium salts, zinc salts, bismuth salts, ammonium salts, and diethanolamine salts. When the compound of the present invention contains a relatively basic functional group, an acid addition salt can be obtained by contacting the prototype of such compound with a sufficient amount of a pharmaceutically acceptable acid in a pure solution or a suitable inert solvent. The pharmaceutically acceptable acid includes an inorganic acid, and the inorganic acid includes, but is not limited to, hydrochloric acid, hydrobromic acid, hydroiodic acid, nitric acid, carbonic acid, phosphoric acid, phosphorous acid, sulfuric acid, and the like. The pharmaceutically acceptable acid includes organic acids, including but not limited to acetic acid, propionic acid, oxalic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, suberic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-toluenesulfonic acid, citric acid, salicylic acid, tartaric acid, methanesulfonic acid, isonicotinic acid, acid citric acid, oleic acid, tannic acid, pantothenic acid, bitartrate, ascorbic acid, gentisic acid, fumaric acid, gluconic acid, sugar acid, formic acid, ethanesulfonic acid, pamoic acid (i.e., 4,4'-methylene-bis(3-hydroxy-2-naphthoic acid)), amino acids (e.g., glutamic acid, arginine), etc. When the compounds of the present invention contain relatively acidic and relatively basic functional groups, they can be converted into base addition salts or acid addition salts.

[0015] The term "pharmaceutical excipients" refers to excipients and additives used in the production of drugs and the preparation of prescriptions. They are all substances contained in pharmaceutical preparations except the active ingredients.

[0016] The beneficial effects of the present invention are:

[0017] Ononetin can at least reduce the expression of fibrosis genes Acta2, Col1a1, Vim and Col3a1 induced by TGF-β treatment, thereby resisting renal fibrosis, and is superior to the anti-fibrotic effect of the traditional TRPM3 inhibitor Primidone. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0019] Figure 1 The bar graph shows the mRNA levels of various fibrosis indicators in mouse renal proximal tubule epithelial cells under different treatments.

[0020] Figure 2 These are immunofluorescence images of FN and Col1a1 of HK-2 cells in Example 4 after treatment with Veh, TGF-β, TGF-β and Primidone, and TGF-β and Ononetin.

[0021] Figure 3 The immunofluorescence intensity graphs of FN and Col1a1 of HK-2 cells in Example 4 after treatment with Veh, TGF-β, TGF-β and Primidone, and TGF-β and Ononetin. DETAILED DESCRIPTION

[0022] The present invention provides the use of Ononetin in the preparation of anti-renal fibrosis drugs. In the present invention, the Cas number of the Ononetin is 487-49-0. In the present invention, the Ononetin preferably inhibits the expression of fibrosis genes. In the present invention, the fibrosis genes preferably include one or more of the Acta2 gene, the Col1a1 gene, the Vim gene and the Col3a1 gene. In the present invention, the dosage form of the drug preferably includes one or more of an oral dosage form, an injection dosage form, an inhalation dosage form and a transdermal dosage form. In the present invention, the drug also preferably includes a pharmaceutically acceptable excipient, and the excipient includes a filler, an adhesive, a matrix, a disintegrant, a lubricant, a solvent, a solubilizer, a flavoring agent, a colorant, a taste masking agent, a pH regulator, an isotonic agent, a suspending agent, a thickener, a preservative, a stabilizer, an antioxidant, a wetting agent, a surfactant, a suspending agent, a propellant, an absorption enhancer, an absorption delay agent and a coating material. One or more.

[0023] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0024] Example 1

[0025] Primary cell extraction

[0026] Method for extracting mouse kidney proximal tubule epithelial cells:

[0027] (1) Euthanize 6- to 8-week-old C57bl / 6 mice, disinfect the back with 75% alcohol, cut open the dorsal renal area, and aseptically obtain the kidneys (abdominal incision is more convenient). Place the kidneys in a culture dish filled with pre-cooled PBS, rinse the kidneys repeatedly, and remove the renal capsule and renal pedicle tissue;

[0028] (2) Separation of cortex and medulla: Cut the cortex into pieces (about 1 mm in size) and mix with DMEM / F12 + 0.1% BSA into EP tubes. Centrifuge at 4°C, 1500 rpm for 5 min. Repeat twice to wash the cortex thoroughly and discard the supernatant.

[0029] (3) Resuspend the tissue pellet in a 50 mL centrifuge tube with 15 mL of 0.1% type II collagenase and place in a 37°C shaker for 30 min. After digestion, let the pellet stand for about 1 min, carefully transfer the supernatant to a new 50 mL centrifuge tube, add 35 mL of ice-cold DMEM / F12 + 0.1% BSA, and place on ice for 5-10 min. Add 15 mL of collagenase solution to the original tube and repeat the above digestion steps;

[0030] (4) The supernatant was centrifuged at 1000 rpm for 10 min at 4°C; it was resuspended in 10 mL of ice-cold DMEM / F12 + 0.1% BSA and placed on ice; the supernatant of the second digestion was treated in the same way;

[0031] (5) Rinse the mesh with PBS or DMEM / F12; pass the supernatant through 70 μm and 40 μm nylon meshes in turn; centrifuge the filtrate at 4°C, 1000 rpm for 10 min;

[0032] (6) Wash the pellet twice with ice-cold PBS and centrifuge under the same conditions as (5);

[0033] (7) Resuspend the cells in complete culture medium (DMEM / F12+5% FBS+1% PS) warmed to 37°C and plate them in a 6 cm cell culture dish. After 3-4 days of culture, the cells can be used for experiments when the density is appropriate.

[0034] Example 2

[0035] Cellular drug delivery

[0036] Mouse renal proximal tubule epithelial cells were grown to a cell density of about 70-80%, and the previous culture medium was removed, and complete culture medium (DMEM / F12+10% FBS+1% PS) containing different drugs was added. For the Vehicle group cells, a culture medium containing 1μL / mL DMSO was added, 10ng / mL TGF-β was added to the TGF-β group, 10ng / mL TGF-β and 100μM Primidone were added to the TGF-β+Pri group, and 10ng / mL TGF-β and 10μM Ononetin were added to the TGF-β+Ono group. After adding drugs, the samples were collected after 48 hours of culture.

[0037] Example 3

[0038] Fluorescence quantitative PCR

[0039] The cells of Example 2 were used for fluorescence quantitative PCR to detect the relative expression levels of Actb, Acta2, Col1a1, Vim and Col3a1 genes, with Actb gene as the control gene.

[0040] (1) Extract cellular RNA and detect RNA concentration using Nanodrop instrument;

[0041] (2) Reverse transcription: Taking the 30 μL reverse transcription system as an example, calculate the required volume for 1500 ng based on the RNA concentration to ensure that the amount of RNA in each tube is consistent. Add 6 μL of 5× reverse transcriptase and fill the remaining volume to 30 μL with ddH2O. The reverse transcription procedure is shown in Table 1, and 30 μL of cDNA is finally obtained.

[0042] Table 1 Reverse transcription procedures

[0043]

[0044]

[0045] (3) Fluorescence quantitative PCR sample loading: Each well of a 96-well plate contains a 10 μL system, including 5 μL of SYBER Green fluorescent reagent, 1 μL of cDNA obtained by reverse transcription, 3 μL of enzyme-free water, and 0.5 μL of forward primer and reverse primer.

[0046] (4) Result analysis: After adding the sample, the four fibrosis indicators were detected using Actb as a relative change control. The primer sequences of the above five genes are shown in Table 2:

[0047] Table 2 Primer sequences

[0048] Forward primer (5'-3') Reverse primer (3'-5') Actb SEQ ID No.1: CATTGCTGACAGGATGCAGAAGG SEQIDNo.:2: TGCTGGAAGGTGGACAGTGAGG Acta2 SEQ ID No.3:TATGTCGCTCTGGACTTTGAA SEQ ID No.4:ACAGTTGTGTGCTAGAGACAG Col1a1 SEQ ID No.5:CCTCAGGGTATTGCTGGACAAC SEQ ID No.6:CAGAAGGACCTTGTTTGCCAGG Vim SEQ ID No.7: CGGAAAGTGGAATCCTTGCAGG SEQ ID No.8: AGCAGTGAGGTCAGGCTTGGAA Col3a1 SEQ ID No.9: GACCAAAAGGTGATGCTGGACAG SEQ ID No.10: CAAGACCTCGTGCTCCAGTTAG

[0049] (5) The relative expression levels of the four fibrosis genes under different treatment conditions were calculated according to the formula: relative expression level = 2^(-(fibrosis gene Cq value-Actb0020 Cq value)). The results are as follows: Figure 1 As shown: the expression level of fibrosis gene mRNA in the proximal tubular cells of mouse kidney under TGF-β treatment was significantly higher than that in the blank control group (Vehicle). Primidone (100μM) can reduce the expression of some fibrosis genes, while Ononetin (10μM) can reduce the expression of the above four fibrosis genes induced by TGF-β treatment, indicating that Ononetin has an anti-fibrotic effect in the proximal tubular cells of mouse kidney.

[0050] Example 4

[0051] Immunofluorescence

[0052] Immunofluorescence detection of the expression of fibrosis indicators FN and Col1a1 in HK-2 cells after treatment with Veh, TGF-β, TGF-β and Primidone, and TGF-β and Ononetin was performed as follows:

[0053] (1) Place a 12 mm round cover slip in a 24-well plate and inoculate approximately 2 × 10 4 Cells were cultured until confluence was 50%, washed twice with 1 mL / well ice-cold PBS, and 500 μL / well of 4% paraformaldehyde (PFA) was added and fixed at room temperature for 10 minutes.

[0054] (2) Wash away residual PFA with 1 mL / well PBS, 10 minutes each time, repeat twice; add 0.25% PBS-Triton X-100, 500 μL / well, permeabilize at room temperature for 5 minutes, repeat twice.

[0055] (3) Wash away residual TritonX-100 with 1 mL / well PBS, 5 minutes each time, repeat 3 times; add 3% BSA (prepared with 0.1% PBST) at 500 μL / well and block at room temperature for 1 hour.

[0056] (4) Aspirate the liquid in the wells and add FN (rabbit anti-Boster, 1:200) and Col1a1 (rabbit anti-Boster, 1:100) diluted with the blocking solution prepared in 3) and incubate at room temperature for 2 hours.

[0057] (5) Add 1 mL / well of 0.1% PBST to wash away the residual primary antibody, repeat for 10 minutes each time, and repeat twice; add fluorescent secondary antibody dilution (goat anti-rabbit Alexa-488, Invitrogen, 1:100) prepared in blocking solution and incubate at room temperature for 1 hour.

[0058] (6) Add 1 mL / well PBST to wash away the residual secondary antibody, repeat 3 times for 10 minutes each time; add a drop of DAPI-containing mounting medium (Invitrogen) and place at room temperature in the dark for 1 hour.

[0059] (7) Inverted fluorescence microscopy was used to observe the expression of FN and Col1a1 in HK-2 cells under different treatments. The results were collected and fluorescence quantification was performed using ImageJ.

[0060] Results: Figure 2 and Figure 3 As shown, TGF-β increases the expression of FN protein and Col1a1 protein in HK-2 cells, and Ononetin reduces the expression of FN protein and Col1a1 protein caused by TGF-β. Transforming growth factor β1 is one of the main initiators of fibrosis. FN and Col 1 increase significantly in the fibrosis stage, playing an important role in the formation and development of fibrosis. In summary, Ononetin can inhibit the fibrosis of renal tubular cells.

[0061] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of Ononetin in the preparation of anti-renal fibrosis drugs.

2. The use according to claim 1, characterized in that: The Cas number of Ononetin is 487-49-0.

3. The use according to claim 1, characterized in that: Ononetin inhibits the expression of fibrotic genes.

4. The use according to claim 3, characterized in that: The fibrosis gene includes one or more of the Acta2 gene, Col1a1 gene, Vim gene and Col3a1 gene.

5. The use according to claim 1, characterized in that: The dosage form of the drug includes one or more of an oral dosage form, an injection dosage form, an inhalation dosage form and a transdermal dosage form.

6. The use according to claim 1, characterized in that: The drug also includes pharmaceutically acceptable excipients, which include one or more of fillers, binders, bases, disintegrants, lubricants, solvents, solubilizers, flavoring agents, colorants, pH regulators, isotonic agents, suspending agents, thickeners, preservatives, stabilizers, antioxidants, wetting agents, surfactants, suspending agents, propellants, absorption enhancers, absorption delay agents and coating materials.

Images