Use of ncoa7 circular rna nanoliposome in preparation of drugs for treating premature ovarian failure or decline of ovarian reserve function
By using NCOA7 circular RNA nanoliposomes to enhance the expression of NCOA7 in ovarian granulosa cells, the problems of premature ovarian failure and decreased ovarian reserve were addressed, resulting in improved ovarian function and fertility.
Patent Information
- Application Number
- CN202410672690.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-28
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2044-05-28
AI Technical Summary
Current technologies are insufficient to effectively alleviate premature ovarian failure or decreased ovarian reserve, which leads to female reproductive aging and related health problems, and there is a lack of safe and effective treatment options.
By using NCOA7 circular RNA nanoliposomes to prepare NCOA7 mRNA-LNPs in a culture medium, the expression level of NCOA7 in ovarian granulosa cells was increased, thereby improving the growth activity and senescence phenotype of ovarian granulosa cells.
It significantly improves ovarian function and fertility in patients with DOR, delays reproductive aging, improves the aging phenotype and growth rate of ovarian granulosa cells, and provides a safe and effective treatment method.
Smart Images

Figure CN118593710B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of NCOA7 circular RNA nanoliposomes in the preparation of drugs for treating premature ovarian failure or decreased ovarian reserve. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] For most normal women, reproductive aging, marked by ovarian aging, generally occurs between the ages of 45 and 55. However, premature ovarian failure or diminished ovarian reserve (DOR) is gradually becoming one of the leading causes of infertility in women of reproductive age. As a vital component of the female reproductive system, ovarian aging accelerates systemic aging, leading to a significant increase in the risk of cardiovascular disease, all-cause mortality, and neurodegenerative diseases, ultimately shortening women's life expectancy. Therefore, timely, safe, and effective efforts to salvage ovarian function and fertility in women with physiological ovarian aging or DOR are of great importance. Exploring effective treatment options and slowing this process is of paramount significance for women.
[0004] Granulosa cells play a crucial role in maintaining ovarian physiological function and ensuring female reproductive health. As the only somatic cells in direct contact with the oocyte and a major source of estrogen and progesterone, changes in their morphology and function directly affect oocyte growth and division. As the primary functional cells within the follicle, they regulate follicle development, maturation, ovulation, and fertilization through bidirectional communication with the oocyte. However, abnormal autophagy activity in granulosa cells can lead to abnormal follicle recruitment and atresia, playing a dominant role in the development of dysregulation of ovarian function (DOR). Summary of the Invention
[0005] In order to solve the problems in the prior art, the application aims to provide the application of NCOA7 circular RNA nanoliposome in the preparation of a drug for treating premature ovarian failure or reduced ovarian reserve. The inventors of the application find that nuclear receptor coactivator 7 (NCOA7) can alleviate ovarian aging and significantly improve the ovarian function and fertility of DOR patients. Therefore, the inventors design NCOA7 circular RNA nanoliposome with NCOA7 circular RNA loaded in lipid nanoparticles (LNPs) to further explore whether NCOA7 circular RNA-LNPs can safely and effectively intervene in the process of ovarian aging. The application safely and effectively improves the expression level of NCOA7 in ovarian granulosa cells by preparing a culture medium with NCOA7 mRNA-LNPs and culturing the ovarian granulosa cells of DOR patients in vitro, improves the growth activity of the ovarian granulosa cells, and reduces the aging phenotype of the ovarian granulosa cells, thereby providing a simple, safe and effective treatment method for rescuing the aging of ovarian granulosa cells and providing a reference for the treatment of DOR, and having good practical application value.
[0006] In order to achieve the above-mentioned purpose, the technical scheme of the application is as follows:
[0007] In a first aspect of the application, the application of a reagent for promoting the expression of NCOA7 gene or the expression product of NCOA7 gene in the preparation of a drug for treating premature ovarian failure or reduced ovarian reserve is provided.
[0008] In some embodiments of the application, the reagent for promoting the expression of NCOA7 gene or the expression product of NCOA7 gene includes but is not limited to a nucleic acid molecule, a carbohydrate, a lipid, a small molecule chemical drug, an antibody drug, a polypeptide, a protein or an interfering lentivirus.
[0009] Preferably, the reagent for promoting the expression of NCOA7 gene or the expression product of NCOA7 gene is NCOA7 circular RNA nanoliposome.
[0010] The NCOA7 circular RNA nanoliposome includes a lipid nanoparticle and NCOA7 circular RNA encapsulated by the lipid nanoparticle.
[0011] The nucleic acid sequence of the NCOA7 circular RNA is as follows:
[0012] GGGTACACGGACAGACCATTTATTTTCATTGCAAAAAAAAAAA
[0013] AAACCAAAAAAAAAAAACAAAAAAAAAAAATAATTGACTAATT
[0014] AAAACAGCGGATGGGTACCCCACCATCCGACCCACTGGGTGTA
[0015] GTACTCTGGTACTTCGTACCTTTGTACGCCTGTTCTTCCCATTGT
[0016] ACCCTTCCTGAACTTCCAACCCAAGTAACGTTAGAAGCTCAAC
[0017] ATTTAGTACAACAGGAAGCACCACATCCAGTGGTGTTTAGTACA
[0018] AGCACTTCTGTTTCCCCGGAGCGAGGTATAGGCTGTACCCACTG
[0019] CCAAAAACCTTTAACCGTTATCCGCCAACCAACTACGTAAAAGC
[0020] TAGTAGTATTATGTTTTTAACTAGGCGTTCGATCAGGTGGATTTC
[0021] CCCTCCACTAGTTTGGTCGATGAGGCTAGGGATTCCCCACGGGT
[0022] GACCGTGTCCTAGCCTGCGTGGCGGCCAACCCAGCCCGGGCTG
[0023] GGACGCCTTTTTATAGACATGGTGTGAAGACTCGCATGTGCTTG
[0024] GTTGTGATTCCTCCGGCCCCTGAATGCGGCTAACCTTAACCCTG
[0025] GAGCCTTGTGTCACAAACCAGTGATGATAAGGTCGTAATGAGC
[0026] AATTCCGGGACGGGACCGACTACTTTGGGTGTCCGTGTTTCTTA
[0027] TTTTTCTTATTATTGTCTTATGGTCACAGCATATATATAACATATAC
[0028] TGTGATCTCTAGAGCCGCCATGGATACCAAGGAAGAGAAGAAG
[0029] GAACGGAAACAAAGTTATTTTGCTCGACTGAAAAAGAAAAAAC
[0030] AAGCCAAACAAAATGCAGAGACAGCCTCAGCTGTAGCTACAAG
[0031] GACTCATACTGGGAAGGAAGATAATAATACAGTAGTTTTAGAGC
[0032] CAGACAAGTGCAACATTGCTGTGGAAGAGGAATATATGACTGAT
[0033] GAGAAAAAAAAGAGAAAAAGTAATCAGTTAAAGGAGATCAGG
[0034] CGTACAGAACTAAAGAGATATTATAGTATTGATGACAATCAAAA
[0035] CAAAACACATGATAAAAAAGAGAAGAAGATGGTGGTTCAGAA
[0036] GCCCCATGGGACTATGGAATACACTGCTGGAAACCAGGACACC
[0037] CTAAACTCCATAGCACTGAAATTTAACATCACTCCCAATAAATTG
[0038] GTGGAACTGAATAAACTTTTCACACATACTATTGTTCCAGGCCA
[0039] GGTCCTTTTTGTGCCAGATGCCAACTCTCCTTCCAGTACCTTAA
[0040] GGCTATCATCATCCAGTCCTGGTGCTACTGTCTCTCCTTCATCAT
[0041] CAGATGCAGAATATGATAAATTGCCTGATGCTGACTTAGCACGA
[0042] AAGGCCTTGAAACCCATTGAAAGAGTCTTATCGTCTACTTCTGA
[0043] AGAAGATGAGCCAGGTGTGGTGAAATTTTTAAAAATGAATTGTC
[0044] GATACTTCACCGATGGAAAGGGTGTGGTTGGCGGTGTTATGATA
[0045] GTGACTCCTAACAACATCATGTTTGACCCTCATAAATCTGATCCT
[0046] CTGGTTATTGAAAATGGGTGTGAGGAGTATGGTCTCATCTGCCC
[0047] CATGGAAGAGGTTGTTTCCATTGCGCTCTACAATGACATTTCTC
[0048] ACATGAAGATCAAAGATGCCTTGCCATCTGACCTACCTCAGGAT
[0049] CTTTGTCCTCTGTACAGGCCTGGAGAATGGGAAGACCTGGCTTC
[0050] AGAAAAGGATATCAACCCATTCAGTAAGTTCAAATCTATCAACA
[0051] AGGAAAAACGACAGCAGAATGGAGAGAAAATTATGACTTCGGA
[0052] TTCCAGACCAATAGTACCTTTGGAGAAGTCCACAGGACATACAC
[0053] CTACAAAGCCCTCAGGCAGCTCTGTGTCAGAGAAATTAAAGAA
[0054] ACTGGACTCCTCTAGGGAGACATCCCATGGTTCTCCCACAGTGA
[0055] TCTACAGCCAAAGAAAACTTTCTAGGGGAAGATGATGATTTTGT
[0056] TCTACAGCCAAAGAAAACTTTCTAGGGGAAGATGATGATTTTGT
[0057] TGACTTGGAAGAACTTTCTTCTCAAACTGGTGGTGGAATGCAC
[0058] AAAAAAGACACCTTGAAGGAGTGCCTTTCTCTTGACCCAGAGG
[0059] AACGAAAGAAAGCTGAGTCACAAATAAACAATTCTGCCGTGGA
[0060] AATGCAGGTGCAGTCAGCCCTAGCCTTTTTGGGAACAGAGAAT
[0061] GATGTTGAACTGAAGGGGGCGCTAGATTTAGAAACCTGTGAGA
[0062] AGCAAGATATAATGCCAGAAGTGGACAAGCAGTCTGGTTCGCC
[0063] AGAAAGCCGAGTAGAAAACACACTGAACATACATGAAGATTTA
[0064] GATAAAGTTAAACTCATTGAATATTACCTGACTAAGAACAAAGA
[0065] AGGGCCACAGGTATCTGAAAATTTGCAGAAAACAGAATTAAGT
[0066] GATGGAAAAAGTATTGAACCAGGGGGAATAGACATTACCCTTA
[0067] GTAGTTCTCTTTCCCAGGCGGGTGATCCCATAACTGAGGGCAAT
[0068] AAAGAGCCAGATAAGACCTGGGTGAAAAAGGGAGAGCCCCTC
[0069] CCGGTAAAACTGAACTCTTCTACAGAAGCAAATGTGATTAAAG
[0070] AGGCTCTAGACTCCTCTTTGGAATCTACTCTGGACAACAGCTGT
[0071] CAAGGTGCACAAATGGATAATAAATCTGAAGTTCAGTTGTGGCT
[0072] GTTAAAGAGAATTCAGGTACCCATTGAAGATATACTTCCTTCAA
[0073] AAGAAGAAAAAAGCAAGACCCCACCCATGTTCCTGTGCATCAA
[0074] AGTGGGAAAACCAATGAGAAAATCCTTTGCCACTCACACTGCA
[0075] GCCATGGTCCAGCAGTACGGCAAACGGAGAAAGCAGCCAGAG
[0076] TACTGGTTTGCTGTTCCTCGGGAGAGGGTGGATCATTTGTACAC
[0077] ATTCTTTGTTCAGTGGTCTCCCGATGTCTATGGAAAAGATGCCA
[0078] AAGAGCAAGGCTTTGTGGTGGTGGAGAAGGAAGAACTGAACA
[0079] TGATTGACAACTTCTTCAGTGAGCCAACAACCAAGAGCTGGGA
[0080] GATCATCACTGTTGAAGAGGCAAAGCGCAGGAAGAGCACATGC
[0081] AGCTACTATGAAGACGAGGACGAAGAGGTGCTGCCTGTCCTAC
[0082] GGCCCCACAGCGCGCTCCTGGAGAATATGCACATCGAGCAGCT
[0083] GGCCCGACGCCTTCCTGCAAGGGTGCAAGGGTATCCATGGAGA
[0084] CTGGCCTATAGCACGTTAGAGCACGGGACCAGCTTAAAGACGC
[0085] TCTACCGGAAATCGGCATCACTAGACAGTCCTGTCCTATTGGTC
[0086] ATCAAAGATATGGATAATCAGATTTTTGGAGCATATGCAACTCAT
[0087] CCTTTCAAGTTCAGTGACCACTATTATGGCACAGGCGAAACTTT
[0088] TCTCTACACATTCAGCCCTCATTTTAAGGTCTTTAAGTGGAGTG
[0089] GAGAAAATTCATACTTTATCAATGGAGACATAAGTTCTTTAGAA
[0090] CTTGGTGGTGGAGGGGGACGATTTGGTTTATGGCTAGATGCTGA
[0091] TTTATACCACGGACGAAGCAACTCTTGCAGCACTTTCAATAATG
[0092] ATATTCTTTCCAAAAAGGAAGACTTCATAGTTCAGGATCTGGAG
[0093] GTGTGGGCATTTGATTGATCTAGACTCGAGAGATCTGCTGGAGC
[0094] CTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCC
[0095] TCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAG
[0096] TCTGAGTGGGCGGCAGGTCTGTCCGTGCATAGCAACCCGGGAACCGGGTTGCAATGAATTCGGATC(SEQ ID NO.1);
[0097] The lipid nanoparticles are composed of a mixture of ionizable cationic lipids, phospholipids, cholesterol, and polyethylene glycol lipids.
[0098] In some embodiments of the present invention, the method for preparing the NCOA7 circular RNA nanoliposomes includes the following steps:
[0099] Ionizable cationic lipids, phospholipids, cholesterol, and polyethylene glycol lipids were dissolved in ethanol in a molar ratio of 40:16:41.5:2.5 to obtain solution A, with a concentration of ionizable cationic lipids of 5 mg / mL.
[0100] NCOA7 circular RNA was diluted with buffer to obtain solution B;
[0101] Solution A and solution B were mixed to obtain NCOA7 circular RNA nanoliposomes; the obtained NCOA7 circular RNA nanoliposomes were dialyzed in DEPC-PBS solution to remove ethanol and free NCOA7 circular RNA.
[0102] The ionizable cationic lipid is PPZ-A10, the phospholipid is dilinoleoylphospholipid ethanolamine, and the polyethylene glycol lipid is DMG-PEG 2000.
[0103] The buffer solution is a citrate-disodium hydrogen phosphate buffer solution with a pH of 4.
[0104] The MWCO of the dialysis is 100 kDa, and the dialysis time is 10-15 h.
[0105] In some embodiments of the present invention, the drug may have any one or more of the following functions:
[0106] (1) Increase the expression of NCOA7 in ovarian granulosa cells;
[0107] (2) Reduce the content of β-galactosidase in ovarian granulosa cells;
[0108] (3) Increase the growth rate of ovarian granulosa cells;
[0109] (4) Reduce the expression levels of IL-1β, IL8, MMP3, and CCL2 in ovarian granulosa cells;
[0110] (5) Reduce the expression levels of cell cycle-related factors p21 and p16 in ovarian granulosa cells;
[0111] (6) Improves the growth activity of ovarian granulosa cells;
[0112] (7) Improves ovarian granulosa cell aging.
[0113] In some embodiments of the present invention, the NCOA7 gene and the NCOA7 gene expression product are both human-derived.
[0114] A second aspect of the present invention provides an NCOA7 circular RNA nanoliposome, comprising: lipid nanoparticles and NCOA7 circular RNA encapsulated by the lipid nanoparticles;
[0115] The nucleic acid sequence of the NCOA7 circular RNA is shown in SEQ ID NO.1;
[0116] The lipid nanoparticles are composed of a mixture of ionizable cationic lipids, phospholipids, cholesterol, and polyethylene glycol lipids.
[0117] A third aspect of the present invention provides a method for preparing the NCOA7 circular RNA nanoliposomes described in the second aspect, characterized by comprising the following steps:
[0118] Ionizable cationic lipids, phospholipids, cholesterol, and polyethylene glycol lipids were dissolved in ethanol in a molar ratio of 40:16:41.5:2.5 to obtain solution A, with a concentration of ionizable cationic lipids of 5 mg / mL.
[0119] NCOA7 circular RNA was diluted with buffer to obtain solution B;
[0120] Solution A and solution B were mixed to obtain NCOA7 circular RNA nanoliposomes; the obtained NCOA7 circular RNA nanoliposomes were dialyzed in DEPC-PBS solution to remove ethanol and free NCOA7 circular RNA.
[0121] The ionizable cationic lipid is PPZ-A10, the phospholipid is dilinoleoylphospholipid ethanolamine, and the polyethylene glycol lipid is DMG-PEG 2000.
[0122] The buffer solution is a citrate-disodium hydrogen phosphate buffer solution with a pH of 4.
[0123] The MWCO of the dialysis is 100 kDa, and the dialysis time is 10-15 h.
[0124] In a fourth aspect, the present invention provides a pharmaceutical composition wherein the active substance of the pharmaceutical composition is the NCOA7 cyclic RNA nanoliposomes described in the second aspect.
[0125] In some embodiments of the present invention, the pharmaceutical composition further includes pharmaceutically acceptable excipients. Those skilled in the art can select the excipients required to formulate different dosage forms and use methods well-known in the art to formulate the pharmaceutical composition into different dosage forms, such as injections, powder injections, etc.
[0126] A fifth aspect of the invention provides the use of the pharmaceutical composition described in the fourth aspect in the preparation of a medicament for treating premature ovarian failure or diminished ovarian reserve.
[0127] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0128] 1. This invention demonstrates that nuclear receptor coactivator 7 (NCOA7) can alleviate ovarian aging and significantly improve ovarian function and fertility in patients with diabetic retinopathy (DOR).
[0129] 2. To delay female reproductive aging and reverse the fertility crisis caused by diabetic retinopathy (DOR), this invention provides an NCOA7 circular RNA nanoliposome that can be used to treat and salvage ovarian granulosa cells in DOR patients. Research has shown that NCOA7 circular RNA nanoliposome treatment can significantly increase the expression level of NCOA7 protein in ovarian granulosa cells of DOR women, improve their aging phenotype and growth rate, and has no significant impact on the biological characteristics of ovarian granulosa cells. This provides a new approach to salvaging ovarian function and improving fertility in DOR women, and has excellent application prospects. Attached Figure Description
[0130] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0131] Figure 1 The expression levels of NCOA7 protein in granulocytes of the normal control group and the DOR patient group before and after treatment with NCOA7 mRNA-LNPs in Example 3 of the present invention are shown.
[0132] Figure 2 This is a graph showing the change in cell growth rate in Example 4 of the present invention; N7 mRNA-LNP is a nanomedicine treatment, and Day 0 was inoculated with 5 × 10 3 Cells / well;
[0133] Figure 3 This is a staining image of β-galactosidase (β-gal), a marker of cellular senescence in ovarian granulosa cells, in Example 5 of the present invention.
[0134] Figure 4 This is a statistical chart of β-galactosidase staining in Example 5 of the present invention; N7 mRNA-LNP represents the nanomedicine treatment group;
[0135] Figure 5 The results of the detection of cell senescence-related secretion phenotypes in Example 6 of the present invention;
[0136] Figure 6The results of cell cycle-related factors (p21, p16) detection in Example 6 of this invention are shown. Detailed Implementation
[0137] All test materials used in this invention are common commercially available products. The specific materials used in this invention and their brands are as follows:
[0138] 1. Lymphocyte Separation Medium (LSM) TM (MP Biomedicals)
[0139] 2. DMEM / F12 medium (Gibco)
[0140] 3. Fetal bovine serum (Gibco)
[0141] 4. NC membrane (Pall)
[0142] 5. SDS (Solebold)
[0143] 6. SDS-PAGE loading buffer (Beyotime)
[0144] 7. NaCl (Soleil)
[0145] 8. Glycine (Solebao)
[0146] 9. KCl (Soleil)
[0147] 10. NaOH (Sigma-Aldrich)
[0148] 11. PMSF (Sigma Aldridge)
[0149] 12. Skim milk powder (Solepro)
[0150] 13. NCOA7 antibody (Abcam)
[0151] 14. GAPDH antibody (Abcam)
[0152] 15. SA-β-gal Reagent Kit (Beyotime)
[0153] 16. Hematoxylin (Solarbio)
[0154] 17. Trizol (TAKARA)
[0155] 18. Reverse Transcription Kit (TAKARA)
[0156] 19.TB green premix Ex Taq(TAKARA)
[0157] 20. Primers were synthesized by Platinum Biotech Co., Ltd.
[0158] In this application, ovarian granulosa cells from the control and DOR patients were selected from participants undergoing assisted reproductive treatment at the Reproductive Hospital Affiliated to Shandong University. Each participant signed an informed consent form. Inclusion criteria for the DOR patient group were: baseline FSH ≥ 10 IU / L, AMH < 1.1 ng / ml, bilateral antral follicle count < 5, and irregular menstruation. Inclusion criteria for the control group were: FSH < 10 IU / L, AMH ≥ 1.1 ng / ml, bilateral antral follicle count > 5, and unilateral antral follicle count < 11. Exclusion criteria included: chromosomal abnormalities, autoimmune diseases, history of ovarian surgery, and history of ovarian radiotherapy or chemotherapy.
[0159] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0160] The NCOA7 circular RNA used in the following examples is a synthetic circular RNA with the sequence shown in SEQ ID NO.1, which was purchased from Guangzhou Gise Biotechnology Co., Ltd.
[0161] Example 1: Preparation of NCOA7 circular RNA nanoliposomes (LNPs)
[0162] Ionizable lipids PPZ-A10, DOPE, cholesterol, and DMG-PEG 2000 were dissolved in ethanol at a molar ratio of 40:16:41.5:2.5, with PPZ-A10 concentration at 5 mg / mL. NCOA7 circular RNA was diluted in disodium citrate-phosphate buffer (pH 4). LNPs were constructed by rapidly mixing the ethanol and aqueous phases using a microfluidic device, followed by dialyzing in DEPC-PBS solution (MWCO 100 kDa) for 12 hours to remove ethanol and free NCOA7 circular RNA.
[0163] Prior to dialysis, the Quant-iT RiboGreen RNA kit was used with LNPs or LNPs were demulsified with 2% Triton X-100. Fluorescence intensity at 520 nm was detected using a multimode plate reader (EnSight, PerkinElmer, Singapore) under 480 nm laser excitation, and the NCOA7 circular RNA content was calculated based on a standard curve.
[0164] The resulting NCOA7 circular RNA nanoliposomes are referred to as NCOA7 mRNA-LNPs.
[0165] Example 2: Extraction and culture of ovarian granulosa cells
[0166] S1. Extraction of ovarian granulosa cells: Collect the remaining cell samples after clinical oocyte retrieval, add lymphocyte separation medium and mix well, centrifuge at 1600 rpm for 10 min, aspirate the cell layer, wash with PBS, centrifuge at 1000 rpm for 5 min, discard the supernatant, and add culture medium (DMEM / F12 medium + 5% fetal bovine serum) to prepare a single-cell suspension. Seed the cells evenly on cell culture plates and incubate overnight at 37℃ in a 5% CO2 incubator.
[0167] S2. After cell adhesion, the medium was changed to include NCOA7 prepared in Example 1.
[0168] The cells were cultured in a medium containing mRNA-LNPs for 4 days, and their condition was observed under a microscope.
[0169] Results: After treatment with NCOA7 mRNA-LNPs, the morphology of surviving cells showed no obvious abnormalities, and the cell survival status was significantly improved.
[0170] Example 3: Detection of NCOOA7 expression level after NCOOA7 mRNA-LNPs treatment
[0171] S1. Lyse ovarian granulosa cells using RIPA lysis buffer, add protease inhibitor PMSF, place on ice for 15 min for complete lysis, scrape off the cells and collect them in EP tubes, centrifuge at 12000g for 5 min at 4°C.
[0172] S2. Protein concentration was determined using a BCA kit. The supernatant was added to protein loading buffer and boiled at 95°C for 10 min. 20 μg of protein sample was loaded into the SDS-PAGE gel wells and electrophoresed (80 V, 25 min; 130 V, 60 min) before being transferred to an NC membrane (300 mA, 70 min).
[0173] S3. Place the membrane in 5% skim milk powder and block at room temperature for 1 hour. Incubate with primary antibody overnight at 4°C. The next day, wash the membrane with TBST for 3 × 5 min, add secondary antibody and incubate at room temperature for 1 hour, then develop.
[0174] result: Figure 1 The expression levels of NCOA7 protein in granulosa cells before and after treatment with NCOA7 mRNA-LNPs were compared between the normal control group and the DOR patient group, indicating that nanomedicine treatment significantly increased the expression level of NCOA7 in ovarian granulosa cells.
[0175] Example 4: Statistical analysis of changes in cell number and growth rate after treatment
[0176] S1. Adjust the ovarian granulosa cell concentration to 5×10⁻⁶. 3Cells were then evenly seeded into 96-well plates, treated with NCOA7 mRNA-LNPs, and then 10 μL of CCK-8 solution was added to each well for incubation for 2 h. The absorbance at 450 nM was measured using an enzyme-linked immunosorbent assay (ELISA) reader, and the cell count was recorded.
[0177] result: Figure 2 This graph shows the changes in the growth rate of ovarian granulosa cells. Granulosa cells were treated with NCOA7 mRNA-LNPs, and the cell growth rate was significantly improved after 4 and 8 days of culture.
[0178] Example 5: β-galactosidase staining of ovarian granulosa cells
[0179] S1. Adjust the ovarian granulosa cell concentration to 5×10⁻⁶. 3 Then, the inoculum was evenly distributed in 96-well plates (5 × 10⁻⁶). 3 Cells (per well) were treated with NCOA7 mRNA-LNPs and stained according to the β-galactosidase staining kit (Beyotime) instructions at 0, 4, and 8 days after cell adhesion: the culture medium was discarded, the cells were washed with PBS, fixed with β-galactosidase staining fixative at room temperature for 15 min, washed with PBS, and β-galactosidase staining working solution was added and incubated at 37°C overnight. The cells were then observed and counted under a microscope.
[0180] result:
[0181] Figure 3 This is a staining pattern for β-galactosidase (β-gal), a marker of cellular senescence in ovarian granulosa cells. Figure 3 It was found that in the control group without nanomedicine treatment, DOR patients had a higher proportion of β-galactosidase-positive cells in their granulosa cells, indicating significant cellular senescence. Treatment with NCOA7 mRNA-LNPs significantly reduced the proportion of β-galactosidase-positive cells, indicating a significant improvement in cellular senescence.
[0182] Ovarian granulosa cells were extracted and cultured in vitro. The activity of β-galactosidase, a marker of cellular senescence, was evaluated on days 4 and 8. Figure 4 This is a statistical graph of β-galactosidase staining. The number of β-galactosidase-positive cells gradually increased with increasing culture days. Treatment of granulosa cells with NCOA7 mRNA-LNPs, and detection at 4 and 8 days, revealed a significant decrease in the proportion of β-galactosidase-positive cells, demonstrating that NCOA7 mRNA-LNPs treatment can improve cellular senescence.
[0183] Example 6: Changes in cellular senescence-related secretory phenotypes and cell cycle-related factors
[0184] S1. Adjust the ovarian granulosa cell concentration to 5×10⁻⁶. 3 Inoculate evenly in 96-well plates (5×10 3 Cells (1 cell / well) were treated with NCOA7 mRNA-LNPs for 4 days, and total RNA was extracted from the cells to detect cell senescence-related secretory phenotypes and cell cycle-related factors.
[0185] S2. Total RNA was extracted from cells using the TRIzol method. Both the control group and the NCOA7 mRNA-LNPs treatment group received 1 mL of TRIzol reagent, incubated for 5 min, then 200 μL of chloroform was added and incubated at room temperature for 5 min. The mixture was then centrifuged at 4°C at 12000 g for 15 min. 400 μL of the supernatant was transferred to a 1.5 mL RNase-free EP tube, and an equal volume of isopropanol was added. The tube was inverted to mix thoroughly, incubated on ice for 30 min, and then centrifuged at 4°C at 12000 g for 30 min. The supernatant was discarded. The RNA precipitate was washed with 1 mL of 75% ethanol and centrifuged at 4°C at 7500 g for 5 min, discarding as much supernatant as possible. After air-drying at room temperature for 5 min, the RNA precipitate was dissolved in 20 μL of DEPC water, and the OD value was measured using a NANO drop ultra-micro spectrophotometer to quantify the RNA concentration and purity.
[0186] S3. Reverse transcribe 1 μg of RNA into cDNA according to the kit instructions.
[0187] S4.RT-PCR. System: TB GREEN 5μL, forward and reverse primers 0.5μL each, cDNA template 1μL, ddH2O 3μL.
[0188] Real-time quantitative program: pre-denaturation 95℃ for 10 min; PCR amplification reaction 95℃ for 5 s, 60℃ for 15 s, 72℃ for 20 s, cycle number 40. 18S was used as an internal control. Results analysis was performed using 2... -ΔΔCT Law.
[0189] Primer list:
[0190]
[0191]
[0192] result:
[0193] Ovarian granulosa cells were extracted from the normal control group and the DOR patient group, respectively. After treating the cells with NCOA7 mRNA-LNPs, the changes in cell senescence-related secretory phenotypes (IL-1β, IL8, MMP3, CCL2) were detected by RT-PCR. Figure 5Results of cellular senescence-related secretory phenotype detection. The results showed that NCOA7 mRNA-LNPs treatment significantly improved the senescence-related secretory phenotype of granulocytes in women with DOR.
[0194] Ovarian granulosa cells were extracted from the normal control group and the DOR patient group, respectively. After treating the cells with NCOA7 mRNA-LNPs, the changes in cell cycle-related factors (p21, p16) were detected by RT-PCR. Figure 6 The results show that NCOA7 mRNA-LNPs treatment significantly improved cell cycle-related factors (p21, p16) in granulocytes of DOR patients.
[0195] In summary, after 4 days of treatment with NCOA7 mRNA-LNPs, compared with the normal control group, the expression of related genes (IL-1β, IL8, MMP3, CCL2) and cell cycle-related factors (p21, p16) in the cellular senescence-related secretory phenotype were significantly reduced, demonstrating that NCOA7 mRNA nanomedicine treatment has a significant ameliorative effect on ovarian granulosa cell senescence.
[0196] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. The application of reagents that promote NCOA7 gene expression or products that promote NCOA7 gene expression in the preparation of drugs for the treatment of premature ovarian failure or decreased ovarian reserve; The reagent that promotes NCOA7 gene expression or promotes NCOA7 gene expression products is NCOA7 circular RNA nanoliposomes; The NCOA7 circular RNA nanoliposomes comprise: Lipid nanoparticles and NCOA7 circular RNA encapsulated by lipid nanoparticles; The nucleic acid sequence of the NCOA7 circular RNA is shown in SEQ ID NO.1; The lipid nanoparticles are composed of a mixture of ionizable cationic lipids, phospholipids, cholesterol, and polyethylene glycol lipids.
2. The application as described in claim 1, characterized in that, The preparation method of the NCOA7 circular RNA nanoliposomes includes the following steps: Ionizable cationic lipids, phospholipids, cholesterol, and polyethylene glycol lipids were dissolved in ethanol in a molar ratio of 40:16:41.5:2.5 to obtain solution A, with a concentration of ionizable cationic lipids of 5 mg / mL. NCOA7 circular RNA was diluted with buffer to obtain solution B; Solution A and solution B were mixed to obtain NCOA7 circular RNA nanoliposomes; the obtained NCOA7 circular RNA nanoliposomes were dialyzed in DEPC-PBS solution to remove ethanol and free NCOA7 circular RNA.
3. The application as described in claim 2, characterized in that, The ionizable cationic lipid is PPZ-A10, the phospholipid is dilinoleoylphospholipid ethanolamine, and the polyethylene glycol lipid is DMG-PEG 2000.
4. The application as described in claim 2, characterized in that, The buffer solution is a citrate-disodium hydrogen phosphate buffer solution with a pH of 4.
5. The application as described in claim 2, characterized in that, The MWCO of the dialysis is 100 kDa, and the dialysis time is 10-15 h.
6. The application as described in claim 1, characterized in that, The drug has any one or more of the following functions: (1) Increase the expression of NCOA7 in ovarian granulosa cells; (2) Reduce the content of β-galactosidase in ovarian granulosa cells; (3) Increase the growth rate of ovarian granulosa cells; (4) Reduce the expression levels of IL-1β, IL8, MMP3, and CCL2 in ovarian granulosa cells; (5) Reduce the expression levels of cell cycle-related factors p21 and p16 in ovarian granulosa cells; (6) Improves the growth activity of ovarian granulosa cells; (7) Improves ovarian granulosa cell aging.
7. The application as described in claim 1, characterized in that, Both the NCOOA7 gene and its expression product are of human origin.
8. A NCOA7 circular RNA nanoliposome, characterized in that, It includes: Lipid nanoparticles and NCOA7 circular RNA encapsulated by lipid nanoparticles; The nucleic acid sequence of the NCOA7 circular RNA is shown in SEQ ID NO.1; The lipid nanoparticles are composed of a mixture of ionizable cationic lipids, phospholipids, cholesterol, and polyethylene glycol lipids.
9. A method for preparing NCOA7 cyclic RNA nanoliposomes according to claim 8, characterized in that, Includes the following steps: Ionizable cationic lipids, phospholipids, cholesterol, and polyethylene glycol lipids were dissolved in ethanol in a molar ratio of 40:16:41.5:2.5 to obtain solution A, with a concentration of ionizable cationic lipids of 5 mg / mL. NCOA7 circular RNA was diluted with buffer to obtain solution B; Solution A and solution B were mixed to obtain NCOA7 circular RNA nanoliposomes; the obtained NCOA7 circular RNA nanoliposomes were dialyzed in DEPC-PBS solution to remove ethanol and free NCOA7 circular RNA.
10. The preparation method according to claim 9, characterized in that, The ionizable cationic lipid is PPZ-A10, the phospholipid is dilinoleoylphospholipid ethanolamine, and the polyethylene glycol lipid is DMG-PEG 2000.
11. The preparation method according to claim 9, characterized in that, The buffer solution is a citrate-disodium hydrogen phosphate buffer solution with a pH of 4. The MWCO of the dialysis is 100 kDa, and the dialysis time is 10-15 h.
12. A pharmaceutical composition, characterized in that, The active substance in the pharmaceutical composition is the NCOA7 cyclic RNA nanoliposome as described in claim 8.
13. The pharmaceutical composition according to claim 12, characterized in that, The pharmaceutical composition also includes medically acceptable excipients.
14. The use of the pharmaceutical composition according to any one of claims 12-13 in the preparation of a medicament for treating premature ovarian failure or diminished ovarian reserve.