A method for multi-enzyme cascade conversion of L-tyrosine to produce tyrosol and salidroside

Abstract

The present invention relates to a method for multi-enzyme cascade conversion of L-tyrosine to produce tyrosol and salidroside, belonging to the field of bioengineering technology. First, the 158th threonine of the wild-type glycosyltransferase is mutated to alanine, and the 311th tyrosine is mutated to alanine, obtaining a glycosyltransferase with the amino acid sequence shown in SEQ ID NO.3. Then, a co-expression engineering bacterium with Escherichia coli as the host is constructed, and the glycosyltransferase, tyrosine decarboxylase, and tyramine oxidase are expressed through a dual-plasmid expression system, realizing the efficient production of tyrosol and salidroside using L-tyrosine as the substrate. The production method of the present invention achieves balanced expression of each enzyme through modular assembly and gene repeated expression, avoids the accumulation of by-products, realizes the efficient synthesis of tyrosol and salidroside using L-tyrosine as the substrate, and lays a foundation for the industrial production of tyrosol and salidroside.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and particularly to a method for multi-enzyme cascade conversion of L-tyrosine to produce tyrosol and salidroside. Background Art

[0002] Tyrosol is a phenolic compound with pharmacological activity. It is a derivative of phenethyl alcohol and a monophenolic antioxidant, and has various natural sources such as olive oil and green tea. Tyrosol has many physiological and active functions, such as antioxidant, anti-fatigue, anti-hypoxia, anti-stress, anti-cold, sedative, cardiovascular diseases, hypertension, etc. Tyrosol can also be used as a flavoring agent for wines and plays an important role in enhancing the taste of wine beverages, especially in sake, beer and wine.

[0003] With the development of the physiological activity of tyrosol and the increase in market demand, the development of an efficient tyrosol production route has become a research hotspot. Currently, the preparation methods of tyrosol mainly include natural extraction method, chemical synthesis method, and biosynthesis method. The natural extraction method has great difficulty in obtaining tyrosol and a complex process. The chemical synthesis method also has problems such as strict reaction conditions, high costs, and a large amount of pollution generated during the reaction process in actual production. Both methods are not conducive to the industrial production of tyrosol. Using Escherichia coli as a chassis cell, there are mainly three biosynthetic pathways for synthesizing tyrosol from tyrosine ( Figure 1 ), which are respectively: (1) TDC-TYO pathway, tyrosine is first converted to tyramine under the action of tyrosine decarboxylase (TDC), then tyramine is catalyzed by tyramine oxidase (TYO) to generate p-hydroxyphenylacetaldehyde, and finally reduced by alcohol dehydrogenase to generate tyrosol; (2) pyruvate decarboxylation pathway, tyrosine generates p-hydroxyphenylpyruvate under the action of aromatic amino acid aminotransferase, p-hydroxyphenylpyruvate is further catalyzed by pyruvate decarboxylase to generate p-hydroxyphenylacetaldehyde, and finally reduced by alcohol dehydrogenase to generate tyrosol; (3) AAS pathway, in this pathway, tyrosine is directly catalyzed by aromatic aldehyde synthase (AAS) to generate p-hydroxyphenylacetaldehyde, and then reduced by alcohol dehydrogenase to generate tyrosol.

[0004] Rhodiola is a rare wild plant growing in alpine pollution-free areas. It is a commonly used medicine among the Tibetan people in China and has a history of application for more than 1,000 years. It has the effects of stimulating the nervous system, increasing work efficiency, eliminating fatigue, and preventing altitude sickness. In addition, Rhodiola also has the functions of protecting the cardiovascular and cerebrovascular systems, nerve cells, and anti-tumor and anti-radiation. The main medicinal active ingredients of Rhodiola are salidroside and its aglycone tyrosol. At present, the main extraction methods of salidroside are natural extraction method, chemical synthesis method, and biosynthesis method. The main problems of natural extraction method at present are expensive raw materials, low extraction efficiency, high energy consumption, and damage to the health of production personnel, which still cannot well adapt to large-scale production. Although the purity of chemically synthesized salidroside is relatively high, the treatment of organic reagent residues and waste liquid makes it difficult to ensure the safety of the production process. Therefore, the production of salidroside by biosynthesis method is the current research hotspot.

[0005] Glycosyltransferases (EC2.4.x.y) are a class of enzymes that catalyze the formation of specific glycosidic bonds between a sugar moiety and a receptor and are ubiquitous in organisms. Glycosyltransferases use nucleoside diphosphate-activated sugar-containing compounds as sugar donors, and among them, glycosyltransferases using uridine diphosphate glucose as a sugar donor are the most common, and their full name is UDP-glucosyltransferases (UGTs). The glycosylation of natural products using glycosyltransferases is beneficial to improving the biological activity of substances and is more conducive to their application in the fields of medicine, health care, beauty, etc., to solve the problem that the natural way to obtain glycoside products cannot meet the demand. Summary of the Invention

[0006] To solve the above technical problems, the present invention provides a method for multi-enzyme cascade conversion of L-tyrosine to produce tyrosol and salidroside. In order to obtain a method for efficiently synthesizing tyrosol and salidroside, the present invention constructs a co-expression engineering bacterium with Escherichia coli as the host, realizing the efficient production of tyrosol and salidroside using L-tyrosine as a substrate.

[0007] The present invention realizes the efficient production of tyrosol and salidroside by expressing the pathway enzymes for synthesizing tyrosol and salidroside in Escherichia coli cells: tyrosine decarboxylase, tyramine oxidase, and glycosyltransferase, laying a foundation for the industrial production of tyrosol and salidroside.

[0008] The present invention is realized through the following technical solutions:

[0009] The first object of the present invention is to provide a recombinant Escherichia coli for producing tyrosol and salidroside, and the recombinant Escherichia coli is a dual-plasmid expression system expressing glycosyltransferase, tyrosine decarboxylase, and tyramine oxidase.

[0010] In one embodiment of the present invention, the dual plasmid includes pETDuet-1 plasmid and pACYCDuet-1 plasmid.

[0011] In one example of the present invention, the glycosyltransferase is located on the pETDuet-1 plasmid, and three copies of the glycosyltransferase gene are expressed using the pETDuet-1 plasmid; the tyrosine decarboxylase and tyramine oxidase are located on the pACYCDuet-1 plasmid.

[0012] In one example of the present invention, the glycosyltransferase is derived from Rhodiola rosea, and its amino acid sequence is as shown in SEQ ID NO.3; the tyrosine decarboxylase is derived from Enterococcus faecalis, and its amino acid sequence is as shown in SEQ ID NO.5; the tyramine oxidase is derived from Micrococcus luteus, and its amino acid sequence is as shown in SEQ ID NO.7; the glycosyltransferase is obtained by mutating the 158th threonine of the wild glycosyltransferase with the amino acid sequence as shown in SEQ ID NO.1 to alanine and mutating the 311th tyrosine to alanine.

[0013] In one example of the present invention, the Escherichia coli is Escherichia coli BL21(DE3).

[0014] The second object of the present invention is to provide a whole-cell catalyst containing the recombinant Escherichia coli.

[0015] The third object of the present invention is to provide the application of the recombinant Escherichia coli or the whole-cell catalyst in the preparation of tyrosol and salidroside.

[0016] The fourth object of the present invention is to provide a method for producing tyrosol and salidroside, comprising the following steps: using L-tyrosine as a substrate and the recombinant Escherichia coli or the whole-cell catalyst as a catalyst to catalytically produce tyrosol and salidroside.

[0017] In one example of the present invention, the temperature for the catalytic production is 20°C to 30°C; the time is 48 h to 50 h; the OD of the bacterial cells 600 is 30; the pH value is 7.0 to 8.0.

[0018] In one example of the present invention, the concentration of L-tyrosine is 20 g·L -1 to 30 g·L -1 .

[0019] In one example of the present invention, the reaction system for the catalysis further includes 30 mmol·L -1~40 mmol·L -1 of UDPG.

[0020] In the present invention, the nucleotide sequence of wild-type UGT33 is as shown in SEQ ID NO.1, and the amino acid sequence is as shown in SEQ ID NO.2. In order to improve the catalytic efficiency of glycosyltransferase, the 158th threonine and the 311th tyrosine in the amino acid sequence of wild-type UGT33 are both mutated to alanine, resulting in a mutated glycosyltransferase, and the amino acid sequence is as described in SEQ ID NO.3.

[0021] Advantages of the present invention:

[0022] The present invention provides a method for multi-enzyme cascade conversion of L-tyrosine to produce tyrosol and salidroside (the conversion pathway is as Figure 1 shown). The present invention constructs an Escherichia coli recombinant bacterium for whole-cell catalysis to produce tyrosol and salidroside. This Escherichia coli recombinant bacterium simultaneously expresses three enzymes, namely glycosyltransferase, tyrosine decarboxylase, and tyramine oxidase. The production method described in the present invention realizes the balanced expression of each enzyme through modular assembly and gene overexpression, avoids the accumulation of by-products, and realizes the efficient synthesis of tyrosol and salidroside using L-tyrosine as a substrate. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to make the content of the present invention easier to be clearly understood, the following further describes the present invention in detail according to specific embodiments of the present invention in conjunction with the drawings, wherein,

[0024] Figure 1 is the pathway for synthesizing tyrosol and salidroside starting from L-tyrosine in the present invention;

[0025] Figure 2 is the effect of the amount of bacteria on the whole-cell catalysis of the recombinant bacterium to synthesize salidroside in the present invention;

[0026] Figure 3 is the effect of pH on the whole-cell catalysis of the recombinant bacterium to synthesize salidroside in the present invention;

[0027] Figure 4 is the effect of temperature on the whole-cell catalysis of the recombinant bacterium to synthesize salidroside in the present invention;

[0028] Figure 5 is the whole-cell catalysis of the recombinant bacterium E. coli TS01 to produce tyrosol and salidroside in the present invention;

[0029] Figure 6 is the whole-cell catalysis of the recombinant bacterium E. coli TS01 to synthesize tyrosol and salidroside in a 5L fermenter in the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the embodiments cited are not intended to limit the present invention.

[0031] The genes used in the present invention are EfTDC (GenBank accession number: AF354231.1) from Enterococcus faecalis, MlTYO (GenBank accession number: AB010716.1) from Micrococcus luteus, and UGT33 (GenBank accession number: MF674558.1) from Rhodiola rosea.

[0032] The pETDuet-1 plasmid and pACYCDuet-1 plasmid used in the present invention are from the BioVector plasmid vector strain cell gene preservation center; Escherichia coli BL21(DE3) was purchased from Benna Biology.

[0033] In the present invention, high performance liquid chromatography was used to quantify and analyze tyrosol and salidroside. An Agilent ZORBAX Eclipse Plus C18 column (250×4.6 mm, 5 μm) was used, mobile phase A was an aqueous solution containing 0.1% formic acid, mobile phase B was 100% methanol, and the flow rate = 1 mL·min -1 , and the gradient elution conditions were 80% mobile phase A and 20% mobile phase B for 0 - 25 min; 80% mobile phase A and 20% mobile phase B gradually transitioned to 100% mobile phase B for 26 - 40 min; 100% mobile phase B for 41 - 45 min, and the flow rate was 1 mL·min -1 , the ultraviolet detection wavelength was 224 nm, the column temperature was 30 °C, and the injection volume was 10 μL. Standard solutions of tyrosol and salidroside with different concentrations (0.2 g·L -1 , 0.4 g·L -1 , 0.6 g·L -1 , 0.8 g·L -1 , 1.0 g·L -1 ) were prepared, and a standard curve was generated, with the R2 value of the standard curve > 0.999.

[0034] Example 1: Construction of pETDuet-UGT33 T158A / Y311A Plasmid construction

[0035] Using the company's synthetic pET28a-UGT33 as a template, the gene (nucleotide sequence is shown in SEQ ID NO.1) was PCR amplified using pETDuet-UGT33-F and pETDuet-UGT33-R primers (see Table 1 below) to obtain the amplified product of the gene fragment. The pETDuet-UGT33-F1 and pETDuet-UGT33-F2 primers were used to perform reverse PCR amplification of the linearized vector, and the gene fragment was connected to the linearized vector under the action of the homologous recombinase, and then the enzyme-linked product was chemically transformed into the BL21 competent state to obtain a transformant, which was spread on an LB solid medium containing ampicillin and cultured at 37°C for 12 hours. The positive colonies were picked to verify whether the plasmid was successfully constructed by colony PCR. After the positive single colony with the target band size was inoculated in a vial containing LB liquid medium and cultured for 12 hours, the plasmid was extracted and sequenced to construct the recombinant plasmid pETDuet-UGT33.

[0036] Table 1

[0037] Primer Primer sequence (5'→3') pETDuet-UGT33-F CATCACCACAGCCAGATGAGCTTAATTGA pETDuet-UGT33-R AGCTCGAATTCGGATCCTAACGGATATGTTTT pETDuet-UGT33-F1 CTGGCTGTGGTGATGAT pETDuet-UGT33-F2 GATCCGAATTCGAGC

[0038] Using pETDuet-UGT33 plasmid as template, UGT33-T158A-F and UGT33-T158A-R primers were used to perform inverse PCR to construct the mutant plasmid pETDuet-UGT33. T158A . Using pETDuet-UGT33 T158A The plasmid was used as a template and the whole plasmid inverse PCR was performed using primers UGT33-Y311A-F and UGT33-Y311A-R to construct the mutant plasmid pETDuet-UGT33 T158A / Y311A Specific primers are shown in Table 2 below:

[0039] Table 2

[0040] Primer Primer sequence (5'→3') UGT33-T158A-F CTGCTGTGGGCGGCGAGCGCGTGCGGC UGT33-T158A-R CTCGCCGCCCACAGCAGCGCAATCGG UGT33-Y311A-F CGTGATTGCGGTGAACTTTGGCA UGT33-Y311A-R TTCACCGCAATCACGCTTTT

[0041] Example 2: Construction of Salidroside Synthesis Pathway

[0042] Construction of pETDuet-UGT33 T158A / Y311A -UGT33 T158A / Y311A -UGT33 T158A / Y311A Plasmid, first with pETDuet-UGT33 T158A / Y311A The plasmid was used as a template and PCR amplification was performed using pETDuet-UGT33-F and pETDuet-UGT33-R primers to obtain UGT33 T158A / Y311AGene fragment. The plasmid pETDuet-UGT33 was amplified in reverse using primers pETDuet-UGT33-F1 and pETDuet-UGT33-F2 T158A / Y311A After the amplification, it was digested with DpnⅠ at 37 °C for 1 h. Through the design of primers, the gene fragment and the linearized vector carried homologous arm fragments, and the gene fragment was ligated to the linearized vector under the action of homologous recombinase to obtain the plasmid pETDuet-UGT33 T158A / Y311A -UGT33 T158A / Y311A The plasmid pETDuet-UGT33 T158A / Y311A -UGT33 T158A / Y311A -UGT33 T158A / Y311A plasmid was constructed in the same way. The plasmid pETDuet-UGT33 T158A / Y311A -UGT33 T158A / Y311A -UGT33 T158A / Y311A was transformed into Escherichia coli BL21, and the successfully constructed Escherichia coli recombinant strain after sequencing was named E.coli S1. The specific primer sequences are shown in Table 3:

[0043] Table 3

[0044] Primer Primer sequence (5'→3') pETDuet-UGT33-F TCACCACAGCCAGATGAGCCTGATTG pETDuet-UGT33-R CGAGCTCGAATTCGGATCTTAGCGAATATGTTTGG pETDuet-UGT33-F1 CTGGCTGTGGTGATGATGG pETDuet-UGT33-F2 GATCCGAATTCGAGCTCGGCG

[0045] Example 3: Optimization of the conditions for whole-cell catalyzed synthesis of salidroside

[0046] (1) Induced expression of the recombinant strain: E.coli S1 was streaked and activated on an LB resistant plate, and a single colony was picked and inoculated into 10 mL of LB liquid medium. It was cultured in a shaker at 37 °C and 180 r·min -1 for 12 - 14 h, then transferred to 50 mL of TB liquid medium containing the corresponding resistance according to an inoculation amount of 1%, and cultured under the conditions of 37 °C and 180 r·min -1 . When the OD 600 of the bacterial liquid reached 0.6 - 0.8, 0.2 mmol·L -1 IPTG was added, and it was induced at 16 °C and 180 r·min -1 for 16 h. After the induction, the cells were collected by centrifugation at 4 °C and 8000 r·min -1 for 10 min for subsequent whole-cell catalysis.

[0047] (2) Optimal reaction cell mass for whole-cell

[0048] In Tris-HCl buffer at pH 8.0, the substrate concentration of tyrosol was controlled at 15 mmol·L -1 , UDPG at 15 mmol·L -1 , the reaction temperature was 30 °C, 1% Triton X-100 was added to the system, and at OD600 Cell whole-cell catalysis for the synthesis of salidroside was carried out under the conditions of 10, 20, 30, 40, and 50 respectively. The yield of salidroside was determined by HPLC method.

[0049] The results are as Figure 2 shown. When OD 600 is within 30, the yield increases with the increase of the cell concentration. When the OD 600 in the conversion system is 30, the highest yield of salidroside is 3.02 g·L -1 . When OD 600 exceeds 30, the yield decreases, indicating that the optimal cell mass for the whole-cell reaction is OD 600 = 30.

[0050] (3) Optimal reaction pH of whole cell

[0051] Controlled the cell OD 600 = 30, the substrate concentration of tyrosol was 15 mmol·L -1 , UDPG was 15 mmol·L -1 , the reaction temperature was 30 °C. Whole-cell catalysis for the synthesis of salidroside was carried out under the conditions of adjusting the pH of Tris-HCl buffer to 6.0, 6.5, 7.0, 7.5, 8.0, and 8.5 respectively. The yield of salidroside was determined by HPLC method.

[0052] The results are as Figure 3 shown. With the increase of pH, the yield showed a trend of first increasing and then decreasing. When the pH of the reaction system was 7.0, the highest yield of salidroside was 3.26 g·L -1 , indicating that the optimal reaction pH of the whole cell was 7.0.

[0053] (4) Optimal reaction temperature of whole cell

[0054] In the Tris-HCl buffer with pH 7.0, controlled the cell OD 600 = 30, the substrate concentration of tyrosol was 15 mmol·L -1 , UDPG was 15 mmol·L -1 , 1% Triton X-100 was added to the system. Whole-cell catalysis was carried out at 20 °C, 25 °C, 30 °C, 35 °C, 40 °C, 45 °C, and 50 °C respectively. The yield of salidroside was determined by HPLC method.

[0055] The results are as Figure 4 shown. When the whole-cell catalysis reaction temperature was 30 °C, the highest yield of salidroside was 3.39 g·L -1 , indicating that the optimal reaction temperature of the whole cell was 30 °C.

[0056] Example 4: Construction of the tyrosol synthesis pathway

[0057] Construct the pACYCDuet-EfTDC-MlTYO plasmid. The EfTDC gene (the nucleotide sequence is shown in SEQ ID NO.4) is obtained by PCR cloning using the genomic DNA of Enterococcus faecalis as a template. After obtaining pACYCDuet-EfTDC by the method in Example 1 above, the pACYCDuet-EfTDC-MlTYO plasmid is further obtained. The nucleotide sequence of the MlTYO gene used is shown in SEQ ID NO.6. The pACYCDuet-EfTDC-MlTYO plasmid is transformed into Escherichia coli BL21, and the successfully constructed recombinant Escherichia coli strain after sequencing is named E.coliT1.

[0058] Example 5: Whole-cell catalysis for the synthesis of tyrosol from L-tyrosine

[0059] Add the substrate L-tyrosine at a concentration of 10 g·L in Tris-HCl buffer at pH 7.0 -1 , control the cell OD 600 = 30, and carry out whole-cell catalysis at 30 °C and 140 r·min -1 for 24 h. After the reaction is completed, samples are taken and the yield of the product tyrosol is detected by HPLC. According to the detection results, the highest conversion efficiency of E.coliT1 can reach 47.21%, and the tyrosol yield is 3.60 g·L -1 .

[0060] Example 6: Construction of a dual-plasmid co-expression strain

[0061] Considering the plasmid compatibility in Escherichia coli, the pETDuet-UGT33 T158A / Y311A -UGT33 T158A / Y311A -UGT33 T158A / Y311A plasmid obtained in Example 1 and Example 3 above and the pACYCDuet-EfTDC-MlTYO plasmid are simultaneously transformed into Escherichia coli BL21. According to the resistance genes carried on the two plasmids, they are cultured on a medium plate with Amp / Chl double resistance. After sequencing verification, the successfully constructed dual-plasmid co-expression strain is named E.coliTS01.

[0062] Example 7: Whole-cell catalysis for the production of tyrosol and salidroside from L-tyrosine

[0063] Use the recombinant strain E.coliTS01 for whole-cell catalysis to detect the ability of the recombinant strain to convert L-tyrosine into tyrosol and salidroside. The reaction is carried out at a substrate L-tyrosine concentration of 20 g·L -1 , UDPG 40 mmol·L -1 , OD 600= 30, 30 °C, 140 r·min -1 It was carried out under the conditions of pH 7.0 for a total of 48 h. Samples were taken regularly and the production of salidroside and the accumulation of tyrosol were detected by HPLC method.

[0064] The results are as Figure 5 shown. During the whole-cell catalysis process, the production of salidroside reached the highest at 36 h, and the production was 7.59 g·L -1 , and the accumulation of tyrosol was 2.48 g·L at this time -1 .

[0065] Example 8: Whole-cell catalysis of L-tyrosine to synthesize tyrosol and salidroside at the 5 L fermenter level

[0066] In a 5 L fermenter, the recombinant strain E. coli TS01 was used to transform L-tyrosine to synthesize tyrosol and salidroside. The concentration of the substrate L-tyrosine was 20 g·L -1 , UDPG 40 mmol·L -1 , OD 600 = 30, 30 °C, 140 r·min -1 Whole-cell catalysis was carried out on the fermenter under the conditions of pH 7.0. Samples were taken regularly during the transformation process, and the production of salidroside and the accumulation of tyrosol in the transformation solution were detected by HPLC method.

[0067] The results are as Figure 6 shown. During the whole-cell catalysis process, the production of salidroside reached the highest at 36 h, and the production was 10.89 g·L -1 , and the accumulation of tyrosol was 2.86 g·L at this time -1 . It shows that the recombinant strain E. coli TS01 can use L-tyrosine as a substrate to synthesize tyrosol and salidroside.

[0068] Obviously, the above examples are only for illustration and are not limitations on the implementation methods. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A recombinant Escherichia coli for producing tyrosol and salidroside, characterized in that, The recombinant Escherichia coli is a dual-plasmid expression system for expressing glycosyltransferase, tyrosine decarboxylase, and tyramine oxidase; The glycosyltransferase is located on the pETDuet-1 plasmid, and three copies of the glycosyltransferase gene are expressed using the pETDuet-1 plasmid; the tyrosine decarboxylase and tyramine oxidase are located on the pACYCDuet-1 plasmid; The amino acid sequence of the glycosyltransferase is as shown in SEQ ID NO.3; the amino acid sequence of the tyrosine decarboxylase is as shown in SEQ ID NO.5; the amino acid sequence of the tyramine oxidase is as shown in SEQ ID NO.7; The glycosyltransferase is obtained by mutating the 158th threonine of the wild glycosyltransferase with the amino acid sequence shown in SEQ ID NO.2 to alanine and mutating the 311th tyrosine to alanine.

2. The recombinant Escherichia coli according to claim 1, wherein The Escherichia coli is Escherichia coli BL21(DE3).

3. A whole-cell catalyst, characterized in that, Contains the recombinant Escherichia coli described in claim 1 or 2.

4. Use of the recombinant Escherichia coli described in claim 1 or 2 or the whole-cell catalyst described in claim 3 in the preparation of tyrosol and salidroside.

5. A method for producing tyrosol and salidroside, characterized in that, Comprises the following steps: Using L-tyrosine as a substrate, and using the recombinant Escherichia coli described in claim 1 or 2 or the whole-cell catalyst described in claim 3 as a catalyst to catalytically produce tyrosol and salidroside.

6. The method according to claim 5, characterized in that, The temperature for the catalytic production is 20°C to 30°C; the time is 48 h to 50 h; the pH value is 7.0 to 8.

0.

7. The method according to claim 5, characterized in that, The concentration of the L-tyrosine is 20 g·L −1 ~30 g·L −1 .

8. The method according to claim 5, wherein The catalyzed reaction system also includes UDPG at 30 mmol·L -1 ~40 mmol·L -1 .

Images