A sgRNA for targeted editing of pig HNF1A gene and its application

Abstract

The present invention relates to the field of animal genetic engineering technology, and provides a sgRNA for targeted editing of pig HNF1A gene and its application. The present invention determines the sequence of pig targeting site by homologous comparison based on the HNF1A gene mutation site hHNF1Ac.391C>T, which is typical of human MODY3 diabetes, and obtains pigs with pHNF1A c.391C>T point mutation by gene editing, and the genetic basis of the pig is consistent with that of humans. Pigs are similar to humans in terms of body size, anatomy, physiology, and susceptibility to obesity. As omnivorous animals, pigs have digestive systems and nutritional metabolic characteristics that are more similar to those of humans, and are suitable for translational medical application research on diseases related to human glucose and lipid metabolism disorders. Related diagnostic methods and treatment measures can be directly applied to humans.

Description

Technical Field

[0001] The present invention relates to the technical field of animal genetic engineering, and in particular to a sgRNA for targeted editing of pig HNF1A gene and an application thereof. Background Art

[0002] Maturity-onset diabetes of the young (MODY) is a monogenic diabetes characterized by early onset, autosomal dominant inheritance, and pancreatic β-cell dysfunction. MODY3 is a monogenic diabetes characterized by β-cell dysfunction. About 1% to 2% of patients diagnosed with diabetes have MODY3. The age of onset of the disease ranges from 10 to 60 years old, and the clinical manifestations are also highly heterogeneous, and it is easy to be misdiagnosed as T1DM or T2DM. In terms of clinical manifestations, MODY3 patients have a clear family history of diabetes, are non-insulin dependent, and are mostly negative for insulin autoantibodies. The genes known to cause MODY mainly include 14 genes such as hepatocyte nuclear factor (HNF1A, HNF4A and HNF1B), glucokinase (GCK), insulin (INS), B lymphocyte kinase (BLK) and NEUROD1. Mutations in the GCK, HNF1A, HNF4A and HNF1B genes are the most common causes of MODY. Among them, HNF1A mutations lead to progressive β-cell dysfunction, leading to diabetes in early adulthood, and are the most common cause of MODY in Asia, Europe, and North America. So far, more than 200 HNF1A gene mutations have been found to cause MODY3. HNF1A mutations show high penetrance: 63% of carriers develop diabetes at the age of 25, and almost all carriers develop diabetes before the age of 55. Due to reduced renal glucose reabsorption, carriers develop glycosuria even before diabetes. In addition, because hyperglycemia is severe and worsens over time, the risk of microvascular and macrovascular complications is similar to that of type 1 diabetes (T1DM) and T2DM. Therefore, patients need to strictly control blood sugar and closely monitor diabetic complications.

[0003] The HNF transcription factor family has a similar structure, including a dimerization domain, a DNA binding domain, and a transactivation domain. Functional analysis of mutations in these genes revealed that they are mainly loss-of-function mutations, resulting in defects in dimerization ability (1-31AA), DNA binding affinity (91-181AA, 198-279AA), transcriptional activity (280-631AA), or subcellular localization, depending on the location of the mutation. HNF1A, also known as TCF1, is located on the long arm of chromosome 12 (12q24.2) and is mainly distributed in the liver, pancreas, kidneys, and intestines. It has the functions of regulating lipid metabolism and protein synthesis in the liver, insulin secretion in the pancreas, and glucose reabsorption in the kidneys. For example, HNF1A in the pancreas binds to DNA to regulate the expression of target genes such as insulin (INS) and glucose transporter 2 (GLUT2) in mature β cells; HNF1A is involved in regulating many central rate-limiting steps in gluconeogenesis and related pathways, and its products are essential for normal liver function. Genes, including carbohydrate synthesis and storage, lipid metabolism (synthesis of cholesterol and lipoproteins), detoxification (synthesis of cytochrome P450 monooxygenases), and serum protein synthesis (albumin, complement, and coagulation factors); In addition, HNF1A in the liver interacts with deacetylases to regulate target gene expression. The HNF family, including HNF1A, is involved in liver development, function, and tumor growth. Systemic knockout, tissue-specific knockout or frameshift mutation of HNF-1A can lead to severe metabolic disorders. Individuals whose arginine at position 131 of the coding gene mutates to serine show metabolic disorders, but there is currently no animal model for this amino acid mutation.

[0004] Pigs are attractive model organisms because they are similar to humans in terms of size, anatomy, physiology, and susceptibility to obesity. The established diagnostic methods and treatment measures can be directly applied to humans. As omnivores, pigs have digestive systems and nutritional metabolism characteristics that are more similar to those of humans, and have been successfully used in the study of human nutritional metabolism-related obesity, NAFLD, atherosclerosis, and diabetes. The pancreas of pigs and humans has high similarities in histology, physiology, and pathology. First, in terms of histology, the size, shape, location in the body, and blood supply of the pig pancreas are similar to those of humans; second, the homology of important functional genes is high. For example, there is only one amino acid difference between pig and human insulin at the 30th position of the B chain, and pig insulin has been used in the treatment of human diabetes for decades; third, in the process of diabetes, the pathological mechanism of β-cell damage is similar. When the amount of pig and human β-cells is reduced by 50%, the amount of insulin secretion will be reduced, resulting in impaired glucose tolerance. Unlike rodent β-cells, which have significant proliferation capacity, promoting β-cell proliferation does not seem to be an important strategy for preventing hyperglycemia in humans and pigs. When pigs fast, the drop in blood sugar levels is accompanied by a variety of adaptive mechanisms, including increased lipolysis to produce fatty acids and glycerol to meet the needs of liver gluconeogenesis and ketone body production, which is almost consistent with human metabolism. With age, peripheral tissue insulin resistance increases, glucose tolerance decreases, and blood sugar and insulin levels also rise steadily. This shows that pigs are not only similar to humans in terms of gross anatomy, physiology, nutritional metabolism, and susceptibility to obesity, but also in terms of pancreatic morphology, endocrine cell composition and distribution, insulin and incretin-releasing hormone homology, etc. The pathological mechanisms related to metabolic disorders are also similar to those of humans, making them suitable materials for the study of human pancreatic physiology and pathology.

[0005] Therefore, providing a sgRNA that targets and edits the pig HNF1A gene will lay the foundation for the preparation and application of gene-edited pigs. Summary of the invention

[0006] The purpose of the present invention is to provide a sgRNA for targeted editing of the pig HNF1A gene and its application.

[0007] Studies have found that systemic knockout, tissue-specific knockout or frameshift mutation of the HNF-1A gene can lead to severe metabolic disorders. Individuals whose arginine at position 131 of the coding gene mutates to serine show metabolic disorders. There is currently no animal model for this amino acid mutation.

[0008] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a sgRNA for targeted editing of the porcine HNF1A gene, which is a sgRNA based on the CRISPR-Cas9 system, and the sgRNA action site is located on the second exon of the porcine HNF1A gene. The DNA sequence of the sgRNA action site is shown in SEQ ID NO:2.

[0009] In the present invention, the reference sequence number of the porcine HNF1A gene in NCBI is NC_010456.5.

[0010] In a second aspect, the present invention provides a CRISPR-Cas9 targeting vector containing the sgRNA.

[0011] Preferably, the backbone vector of the targeting vector is PX458.

[0012] In a third aspect, the present invention provides a porcine HNF1A gene editing vector based on CRISPR-Cas9 technology, comprising the targeting vector and a gene homologous recombination vector; wherein the gene homologous recombination vector comprises a donor DNA, and the donor DNA comprises a nucleotide sequence in which the 391st base of the second exon of the porcine HNF1A gene is mutated from C to T.

[0013] Furthermore, the donor DNA is double-stranded donor DNA or single-stranded donor DNA.

[0014] Preferably, the double-stranded donor DNA comprises a donor ssODN and its complementary ssODN, and their nucleotide sequences are shown in SEQ ID NOs: 6 and 7, respectively.

[0015] In a fourth aspect, the present invention provides a porcine fetal fibroblast cell line with a point mutation in the HNF1A gene, which is obtained by introducing the gene editing vector into porcine fetal fibroblast cells.

[0016] In a fifth aspect, the present invention provides the use of the sgRNA, the targeting vector, the gene editing vector or the cell line in preparing gene-edited cloned pigs.

[0017] In a sixth aspect, the present invention provides a method for CRISPR-Cas9-mediated point mutation of the porcine HNF1A gene, wherein the gene editing vector is transferred into porcine fetal fibroblasts to obtain cells in which the 391st base on the second exon of the porcine HNF1A gene is mutated from C to T.

[0018] In a seventh aspect, the present invention provides any of the following uses of the cell line:

[0019] 1) Used to study the function of porcine HNF1A gene;

[0020] 2) Used to construct HNF1A knockout pigs;

[0021] 3) Used as a cell model or drug screening model for studying lipid metabolism disorders.

[0022] In an eighth aspect, the present invention provides a use of an HNF1A gene knockout pig constructed using the cell line as an animal model for studying glucose and lipid metabolism disorders or a drug screening model.

[0023] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0024] The present invention determines the sequence of the pig target site based on the HNF1A gene mutation site hHNF1A c.391C>T, which is typical of human MODY3 diabetes, by homology comparison, and obtains a pig with pHNF1A c.391C>T point mutation by gene editing, and the genetic basis of the pig is consistent with that of humans. Pigs are similar to humans in terms of body size, anatomy, physiology, and susceptibility to obesity. As omnivores, pigs have digestive systems and nutritional metabolic characteristics that are more similar to those of humans, and are suitable for translational medical application research on diseases related to human glucose and lipid metabolism disorders. The relevant diagnostic methods and treatment measures can be directly applied to humans. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the efficiency of transfecting fetal fibroblasts with the sgRNA expression vector in a preferred embodiment of the present invention.

[0026] Figure 2 This is the sequencing result of the pHNF1A c.391C>T point mutation cell in a preferred embodiment of the present invention.

[0027] Figure 3 It is the target fragment of PCR amplification of HNF1A homozygous mutant pigs in the preferred embodiment of the present invention. M is a DNA molecular weight standard, 1#-6# are amplified fragments of mutant homozygous piglets, C is a negative control, and the length of the amplified fragment is 500bp.

[0028] Figure 4 This is the sequencing result of the HNF1A homozygous mutant pig in the preferred embodiment of the present invention.

[0029] Figure 5 This is a photo of piglets born from HNF1A homozygous mutant pigs in a preferred embodiment of the present invention. DETAILED DESCRIPTION

[0030] The present invention provides a sgRNA for targeted editing of the porcine HNF1A gene and an application method thereof. The targeted editing is the mutation of the 131st arginine codon on the porcine HNF1A coding gene to a tryptophan codon, which refers to the porcine pHNF1A c.391C>T mutation.

[0031] The present invention adopts the following technical solution:

[0032] (1) Determine the target site based on the amino acid mutation site according to the porcine HNF1A gene sequence;

[0033] (2) synthesizing sgRNA and complementary sequences according to the target site determined in step (1), and then constructing them into an expression vector carrying the Cas9 encoding gene;

[0034] (3) synthesizing a donor single-stranded nucleotide sequence (ssODN) of the site mutation according to the mutant core sequence of the target site determined in step (1);

[0035] (4) The Cas9 and sgRNA expression vector obtained in the above step (2) and the ssODN sequence obtained in step (3) are co-transfected into fetal fibroblasts; through monoclonal cell identification, cell lines with point mutations in the HNF1A encoding gene are screened; through somatic cell nuclear transplantation, cloned reconstructed embryos are established, and then transplanted into recipient sows to produce pigs with HNF1A point mutations.

[0036] Preferably, the sequence of the second exon where the porcine pHNF1A c.391C site is located is: 5'-GGAGGACCCGTGGCGCGTGGCCAAGATGGTCAAGTCCTACCTGCAGCAGCACAAC ATCCCACAGCGGGAGGTGGTCGACACCACTGGCCTCAACCAGTCCCACCTGTCCCA GCACCTCAACAAGGGCACCCCCATGAAGACGCAGAAGCGAGCCGCCCTGTACACCTGGTACGTCCGCAAGCAGCGAGAGGTGGCCCAGC-3' (SEQ ID NO: 1).

[0037] Preferably, the target nucleotide sequence on the porcine HNF1A encoding gene recognized by the sgRNA is: 5'-GCACAACATCCCACAGCGGGAGG-3' (SEQ ID NO: 2).

[0038] Preferably, the sequence of the guide sequence and complementary sequence plus restriction site for the sgRNA recognition target site is: F: 5'-CACCGCACAACATCCCACAGCGGG-3' (SEQ ID NO: 3) and

[0039] R: 5'-AAACCCCGCTGTGGGATGTTGTGC-3' (SEQ ID NO: 4).

[0040] Preferably, the backbone vector is PX458 purchased from Addgene.

[0041] Wherein, the donor DNA is double-stranded donor DNA or single-stranded donor DNA.

[0042] Preferably, the codon (CGG) for arginine at position 131 on the HNF1A coding gene in the donor DNA is mutated to a codon for tryptophan (TGG), which refers to a c.391C>T mutation; at the same time, in order to prevent Cas9 from performing secondary cleavage on the double-stranded genomic DNA of the edited cell, the sgRNA recognizes the PAM region of the donor DNA and mutates according to the codon degeneracy, i.e., pHNF1Ac.396G>A; its core sequence is 5'-CAGTGGGAAG-3' (SEQ ID NO: 5).

[0043] Preferably, the donor ssODN and complementary ssODN carrying mutation points are:

[0044] ssODN-Forward:5'-TGGCTGAGCAGGCCCCGTCCTCACCCTCCCTGCAGGGAGGACCCGTGGCGCGTGG CCAAGATGGTCAAGTCCTACCTGCAGCAGCACAACATCCCACAGTGGGAAGTGGTC GACACCACTGGCCTCAACCAGTCCCACCTGTCCCAGCACCTCAACAAGGGCACCCC CATGAAGACGCAGAAGCGAGCCGCCCTGTACAC-3'(SEQ ID NO:6).

[0045] ssODN-Reverse:5'-GTGTACAGGGCGGCTCGCTTCTGCGTCTTCATGGGGGTGCCCTTGTTGAGGTGCT GGGACAGGTGGGACTGGTTGAGGCCAGTGGTGTCGACCACTTCCCACTGTGGGATG TTGTGCTGCTGCAGGTAGGACTTGACCATTCTGGCCACGCGCCACGGGTCCTCCCT GCAGGGAGGGTGAGGACGGGGCCTGCTCAGCCA-3'(SEQ ID NO:7).

[0046] Preferably, the monoclonal cell identification PCR primers are:

[0047] pHNF1A-F:5'-GCTCTGACGTGAGTGTCCTT-3' (SEQ ID NO:8);

[0048] pHNF1A-R: 5'-CCTCTTAGTCTGTCTGTCCAGG-3' (SEQ ID NO: 9).

[0049] The porcine HNF1A gene contains 10 exons in total. The present invention targets the second exon.

[0050] The wild-type sequence of exon 2 of the porcine HNF1A gene is shown in SEQ ID NO: 1, and the sequence after point mutation is: 5'-GGAGGACCCGTGGCGCGTGGCCAAGATGGTCAAGTCCTACCTGCAGCAGCACAAC ATCCCACAGTGGGAAGTGGTCGACACCACTGGCCTCAACCAGTCCCACCTGTCCCA GCACCTCAACAAGGGCACCCCCATGAAGACGCAGAAGCGAGCCGCCCTGTACACCT GGTACGTCCGCAAGCAGCGAGAGGTGGCCCAGC-3' (SEQ ID NO: 10).

[0051] Preferably, the primers used to identify the genotype of the gene-edited pig are:

[0052] pHNF1A-F:5'-GCTCTGACGTGAGTGTCCTT-3' (SEQ ID NO:8);

[0053] pHNF1A-R: 5'-CCTCTTAGTCTGTCTGTCCAGG-3' (SEQ ID NO: 9).

[0054] Furthermore, in the above method, pHNF1A-F / R primers were used to amplify the piglet genomic DNA sample, the amplified fragment length was 500 bp, and the sequencing results were:

[0055] 5'-GCTCTGACGTGAGTGTCCTTACCTCCCTGTCCCTGAGTCGGGGTGCAGGCTCCCA GGCTCCACGCTTGCTTCCATCCACCATCCCACTCCCTGGGGGACAGGGCTCCAGCGCCTAGGACCCCCGCCCTGCCCACTGGGCACCCTGGCTGAGCAGGCCCCGTCCTCACCCTCCCTGCAGGGAGGACCCGTGGCCGTGGCCAAGATGGTCAAGTCCTACCTGCAGCAGCACAACATCCCACAGTGGGAAGTGGTCGACACCACTGGCCTCAACCAGTCCCA CCTGTCCCAGCACCTCAACAAGGGCACCCCCATGAAGACGCAGAAGCGAGCCGCCCTGTACACCTGGTACGTCCGCAAGCAGCGAGAGGTGGCCCAGCGTAAGTAATGACCGACTGCAGCCCCGTCTTCCCAGCGGGGCCTGGGACTCCCTGCAGCTCAGGGGGTGGAGTGGGGGCTGGAAGCCTCACCACCCCCTTCCTGGACAGACAGACTAAGAGG-3'(SEQ ID NO:11).

[0056] The amplification results were sequenced to determine whether the expected gene editing genotype (pHNF1A c.391C>T) was contained. If the genotype was contained, the model was successfully constructed.

[0057] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0058] Example 1

[0059] 1. Sequence analysis and targeting vector construction

[0060] The sequences of human and porcine HNF1A genes were searched in Genbank, and through homology comparison, it was determined that the codon causing the mutation of the human arginine 131 codon to tryptophan was pHNF1A c.391C nucleotide, and the sequence of the second exon where it was located was shown in SEQ ID NO:1.

[0061] Targeting the editing site of the porcine HNF1A gene, 6 sgRNAs and complementary sequences (including sticky end sequences after annealing) were designed and synthesized, respectively named sg1, sg2, sg3, sg4, sg5 and sg6, and detailed information is shown in Table 1. The sgRNAs in Table 1 were used to detect the cutting efficiency, and the cutting efficiency results of each sgRNA are shown in Table 1. As can be seen from Table 1, the sgRNA sequence contained in sg4 has the highest cutting efficiency. Therefore, the present invention uses the sgRNA shown in sg4 for subsequent experiments.

[0062] Table 1 sgRNA cutting efficiency test results

[0063]

[0064] The PX458 circular vector with GFP selection marker was linearized by enzyme digestion with Bbs I, 1% agarose gel electrophoresis, and then the gel was cut for recovery, purification, and concentration determination. The two complementary oligo chains (SEQ ID NO: 3) and (SEQ ID NO: 4) synthesized were annealed to form double-stranded DNA, and then Soultion I was used to connect dsDNA and linearized PX458 vector. The specific annealing reaction system is shown in Table 2. PX458 was linearized and recombined with annealed dsDNA, and the connected product was transformed into competent DH5α and cultured on LB solid medium containing ampicillin resistance. On the second day, a single colony was picked and shaken to extract the plasmid and sent to the company for sequencing and identification. The successfully connected plasmid was expanded and used for subsequent transfection experiments. The plasmid recombination connection reaction system is shown in Table 3.

[0065] Table 2 Annealing reaction system

[0066] Reagent name System dosage Oligo Justice 10μL Oligo antisense strand 10uL NEB Buffer 3 5μL <![CDATA[ddH2O]]> 25uL Total volume 50μL

[0067] Table 3 Plasmid recombination ligation reaction system

[0068] Reagent name System dosage Linearized plasmid vector 1μL Annealing Oligo Reaction Solution 4μL Soultion I 5μL Total volume 10μL

[0069] 2. Preparation of homologous recombination template

[0070] According to the DNA sequence of the HNF1A gene provided in NCBI, the codon (CGG) of the 131st arginine on the HNF1A coding gene in the homologous recombination template donor DNA was mutated to the codon (TGG) of tryptophan, which refers to the c.391C>T mutation; at the same time, in order to prevent Cas9 from performing secondary cutting on the double-stranded genomic DNA of the edited cell, the sgRNA recognition PAM region of the donor DNA was mutated according to the codon degeneracy, that is, pHNF1A c.396G>A. Based on this, the homologous recombination donor ssODN and complementary ssODN carrying the mutation point were synthesized, and their nucleotide sequences are shown in SEQ ID NO: 6 and 7, respectively.

[0071] 3. Preparation of HNF1A point mutation fetal fibroblasts

[0072] Resuscitated Bama porcine fetal fibroblasts (PEFs) were placed in a 10 cm dish and used for transfection when the cells were about 80% full. The medium was changed 8 hours after transfection. After 48 hours of culture, positive cells were sorted using a flow cytometer. The steps of cell transfection and flow sorting were as follows:

[0073] (1) After the PEFs cells have grown to about 80%, they are digested with EDTA-free trypsin, and the cells are collected and counted after centrifugation;

[0074] (2) According to 10 6 Cells / well were electroporated. The electroporation kit used was the Lonza nuclear transfection kit. The ratio of Solution and Supplement was 82:18, and they were mixed thoroughly.

[0075] (3) Add 100 μL of nuclear transfection reagent to the centrifuge tube after centrifugation, blow gently with a pipette to resuspend the cells, add 5 μg of recombinant vector to the suspension, and mix gently;

[0076] (4) Use a pipette to gently add the mixed cell suspension to the electroporation cup. Try to avoid bubbles during the process to avoid affecting the electroporation efficiency.

[0077] (5) To obtain cells with precise editing of amino acid 131 of HNF1A gene, 5 μg of sgRNA plasmid vector PX458-sg4 and 5 μg of ssODN were transfected into PEFs cells. 6 / well transfection. Select U-023 for electroporation program. After transfection, add complete medium and gently blow the cells apart. Culture in DMEM complete medium at 37℃ for 6-8h and then change the medium. After 48h of culture, enrich the positive cells by flow cytometry.

[0078] (6) After culturing for 48 h, the luminescence was observed under a fluorescence microscope, and the cells were sorted using a flow cytometer. The cells were digested and centrifuged, and the culture medium was removed and 300 μL of DMEM culture medium was added to resuspend the cells. The cells were transferred to a flow cytometer for later use. Before loading the flow cytometer, a cell sieve was used to remove the cell clusters with severe adhesion to avoid blocking the loading tube. The positive cells that stimulated GFP were selected by sorting on the flow cytometer, and the enriched cells were collected in a 1.5 mL EP tube.

[0079] (7) After successful sorting, the positive single cells were cultured in a cell culture incubator, and the culture medium was changed every 3 days. When the cells grew to 80%, they were transferred to a 48-well plate and continued to be cultured. The culture medium was changed every 3 days. When the cells grew to 80% in the 48-well plate, some cells were taken to extract genomic DNA for genotype identification. The PCR amplification primers were: pHNF1A-F: 5'-AGTCCTTGTGCTCTGACGTG-3' (SEQ ID NO: 8) and pHNF1A-R: 5'-AATCGAACCTGTGTCCCAGC-3' (SEQID NO: 9). The amplification reaction system is shown in Table 4. The remaining cells were cultured.

[0080] A total of 174 monoclonal cell lines were obtained and amplified by PCR and sequenced ( Figure 1 ), of which 4 were homozygous PEF cells with precise editing of amino acid 131 in exon 2 of HNF1A gene, accounting for 2.9% of the total number of monoclones; 1 was a heterozygous cell, accounting for 0.6% of the total number of monoclones. The cells with positive sequencing results were further expanded and cultured and then frozen for future use.

[0081] Table 4 PCR amplification reaction system

[0082] Reagent name System dosage DNA template 2μL Tag enzyme 10μL Primer pHNF1A-F 1μL Primer pHNF1A-R 1μL <![CDATA[ddH2O]]> 6μL Total volume 20μL

[0083] Depend on Figure 1 It can be seen that the cell luminescence was observed under a fluorescence microscope 48 hours after cell transfection. Some cells could emit green light after transfection, indicating that the transfection of cells with the 6 sgRNA expression vectors was successful.

[0084] The sequencing results of pHNF1Ac.391C>T point mutation cells are shown in Figure 2 The gray arrow box is the sgRNA target sequence, the purple arrow box is the PAM region, and the yellow box is the codon of the mutant amino acid R131W. The Original Sequence is the wild-type sequence, 1#, 2#, 33# and 79# are mutant homozygous cells, and 20# is a mutant heterozygous cell. The blue dotted line box is the mutant core sequence, the red solid line box is the mutant base, and the cyan box is the heterozygous mutation point double peak.

[0085] 4. Preparation of HNF1A point mutation pigs

[0086] Somatic cell cloning technology was used to prepare gene-edited pigs from a cell line with a porcine HNF1A point mutation. The specific method is as follows: collect commercial pig ovaries from the slaughterhouse, wash with preheated saline containing double antibodies to remove blood and other contaminants, extract the oocyte complex, and wash it 2-4 times with 38°C egg washing solution. Under the microscope, pick the oocyte complex with uniform cytoplasm in the maturation culture medium, and after culturing for 40 hours at 5% CO2 and 38.5°C, perform somatic cell nuclear transplantation. After the oocyte is cultured and matured in vitro, the nucleus of the oocyte is removed with an injection needle, and the nucleus of the HNF1A point mutation cell with good quality and vitality is transferred into the enucleated oocyte to obtain a recombinant egg. The culture medium is replaced with mannitol containing calcium and magnesium ions for electrofusion, and then placed in a 5% CO2, 38.5°C incubator for culture. Finally, it was transplanted into the oviducts of 8 recipient sows in estrus, and 6 live piglets were obtained. After the cloned pigs were born, pig ear tissue samples were taken to extract pig genomic DNA, which was amplified by PCR and sequenced using the cloned cell positive primers pHNF1A-F: 5'-AGTCCTTGTGCTCTGACGTG-3' (SEQ ID NO: 8) and pHNF1A-R: 5'-AATCGAACCTGTGTCCCAGC-3' (SEQ ID NO: 9).

[0087] The target fragment amplified by PCR in HNF1A homozygous mutant pigs is shown in Figure 3 .

[0088] The sequencing results of HNF1A homozygous mutant pigs are shown in Figure 4 Among them, the gray arrow box is the sgRNA target sequence, the purple arrow box is the PAM region, and the yellow box is the codon of the mutant amino acid R131W. Original Sequence is the wild-type sequence, 1#-6# are mutant homozygous piglets, and the red solid line box is the mutant base.

[0089] Healthy HNF1A gene-edited pigs were obtained by somatic cell cloning ( Figure 5 ), which reduces the expression of genes such as insulin and glucose transporter 2 in pancreatic β cells, as well as the expression of liver function-related genes such as gluconeogenesis in the liver, causing lipid metabolism disorders.

[0090] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A sgRNA for targeted editing of the porcine HNF1A gene, characterized in that: It is an sgRNA based on the CRISPR-Cas9 system. The sgRNA action site is located on the second exon of the porcine HNF1A gene. The DNA sequence of the sgRNA action site is shown in SEQ ID NO:

2.

2. A CRISPR-Cas9 targeting vector containing the sgRNA according to claim 1.

3. The targeting carrier according to claim 2, characterized in that The backbone vector of the targeting vector is PX458.

4. A porcine HNF1A gene editing vector based on CRISPR-Cas9 technology, characterized in that: It comprises the targeting vector and the gene homologous recombination vector as described in claim 2; wherein the gene homologous recombination vector comprises a donor DNA, and the donor DNA comprises a nucleotide sequence in which the 391st base of the second exon of the pig HNF1A gene is mutated from C to T.

5. The gene editing vector according to claim 4, characterized in that The donor DNA is double-stranded donor DNA or single-stranded donor DNA; The double-stranded donor DNA includes a donor ssODN and a complementary ssODN, and their nucleotide sequences are shown in SEQ ID NOs: 6 and 7, respectively.

6. Use of the sgRNA according to claim 1, the targeting vector according to claim 2 or 3, and the gene editing vector according to claim 4 or 5 in the preparation of gene-edited cloned pigs.

7. A method for CRISPR-Cas9-mediated point mutation of porcine HNF1A gene, characterized in that: The gene editing vector according to claim 4 or 5 is transferred into porcine fetal fibroblasts to obtain cells in which the 391st base on the second exon of the porcine HNF1A gene is mutated from C to T.

Images