A primer-probe composition, kit, and application for detecting iPSC residues.

Abstract

This invention provides a primer-probe composition, kit, and application for detecting iPSC residues, relating to the field of pluripotent stem cell residue detection technology. The biomarkers include the ZIC3, ADAM19, ADD2, or ZSCAN10 genes, solving the technical problem of the lack of marker genes in existing technologies capable of detecting or assessing iPSC residues in different tissues and functional cells derived from iPSCs. The primer-probe combination of biomarkers can specifically amplify the ZIC3, ADAM19, ADD2, and ZSCAN10 genes respectively, enabling quantitative detection of each biomarker in cells. This improves the accuracy of iPSC residue detection or assessment results, ensures the safety of iPSC-derived cells, and reduces the clinical risks of related applications. The method is time-efficient, convenient, rapid, and highly sensitive, capable of quantitatively analyzing the proportion of iPSC residues in samples, ensuring product safety.

Description

Technical Field

[0001] This invention relates to the field of pluripotent stem cell residue detection technology, and in particular to a primer-probe composition, kit, and application for detecting iPSC residue. Background Technology

[0002] Human pluripotent stem cells (hPSCs), such as human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs), possess the ability to differentiate into various cell types and to self-renew. Based on these two characteristics, they provide a robust new source for regenerative medicine / cell therapy and the sustainable production of various cells and tissues. Furthermore, hiPSCs offer a viable solution to the immune rejection of hESCs, thus opening new avenues for patient-specific cell therapy.

[0003] With the development of stem cell technology, an increasing number of cell products derived from hiPSCs are entering clinical trials. Because induced pluripotent stem cells (iPSCs) inherently possess tumorigenic properties, injecting them into the human body carries the risk of causing malignant tumors. Therefore, to ensure the safety of the final cell therapy product, it is necessary to test for residual iPSCs in the product.

[0004] Currently, the main techniques for detecting residual iPSCs in cells include the following: ① Teratoma detection: Cells are injected into mice with severe combined immunodeficiency (SCID) to observe whether tumors form. Tumor formation detection is the gold standard for demonstrating the differentiation potential of pluripotent embryonic stem cells and is also a standard for assessing the safety of embryonic stem cell-derived cell populations used for therapeutic applications. However, it requires a large amount of cost and time, greatly increasing the detection cycle and difficulty. ② Clonal culture method: Using iPSC culture conditions, the cells to be tested are cultured for 8-14 days. Undifferentiated iPSCs can form visible clones, and staining is then performed to determine the alkaline phosphatase activity or expression of specific markers in the clones. This method can effectively detect residual iPSCs, but the detection cycle is long, and there is a risk of false negatives due to differentiation of the cells to be tested during the long culture period. ③ Flow cytometry detection: Flow cytometry is used to detect iPSC-specific surface marker antigens. This method has low sensitivity and cannot detect small amounts of residual iPSCs in high-dose products. It is also highly affected by the amount of antibody used, staining specificity, cell number and activity, and gating technology. ④ Traditional qPCR detection method: This method detects residual iPSCs by detecting the expression of iPSC-specific genes. Compared with flow cytometry and culture methods, this method has the advantages of shorter detection time and higher sensitivity. However, its detection sensitivity is greatly affected by the selection of iPSC-specific genes, the type of functional cells, primer design, and qPCR method, and needs further improvement.

[0005] Currently, commonly used methods for detecting residual iPSCs include quantitative PCR and digital PCR, which are used to detect the expression of specific genes in pluripotent stem cells, thereby determining their residual proportion. For example, Chinese patent application number 202111581332.X discloses primers and probes for detecting the pluripotency genes OCT4 and Nanog using qRT-PCR, with a corresponding method sensitivity of 0.01%; Chinese patent application number 201780071024.8 discloses a method for detecting residual PSCs in pluripotent stem cell cultures, including cell culture enrichment and q-PCR identification of pluripotency. This method includes multiple genes such as LIN28 (Lin28A), OCT4 (POU5F1), SOX2, FOXD3, NANOG, PODXL, REX1 (ZFP42), SSEA1 (FUT4), DPPA2, and DPPA3. However, some of these genes are significantly expressed in certain types of functional cells. For example, LIN28A can be detected in hiPSC-induced liver and endothelial cells, therefore it is not suitable for detecting hiPSC residues in these induced functional cells. SOX2 is expressed in nerve cells, therefore it is not suitable for detecting hPSC residues in hPSC-induced nerve cells. Furthermore, Chinese patent application number 202110612182.8 discloses a method for detecting iPSC residues using single-cell sequencing data analysis, revealing various pluripotent stem cell markers with different expression levels in different tissues and functional cells. However, it does not experimentally demonstrate the accuracy and sensitivity of single-cell sequencing results, and this method involves single-cell sequencing sample preparation and data analysis, resulting in high costs.

[0006] In view of this, the present invention is hereby proposed. Summary of the Invention

[0007] One of the objectives of this invention is to provide a biomarker for detecting or evaluating iPSC residues, in order to solve the technical problem in the prior art of lacking marker genes capable of detecting or evaluating iPSC residues in different tissues and functional cells of iPSC origin.

[0008] A second objective of this invention is to provide the application of substances that detect the aforementioned biomarkers in the detection or evaluation of iPSC residues.

[0009] A third objective of this invention is to provide a primer-probe combination for amplifying the aforementioned biomarkers.

[0010] The fourth objective of this invention is to provide a method for detecting iPSC residues.

[0011] The fifth objective of this invention is to provide the application of the above-described primer-probe combination in the preparation of products for detecting or evaluating iPSC residues.

[0012] The sixth objective of this invention is to provide a reagent for detecting or evaluating iPSC residues.

[0013] The seventh objective of this invention is to provide a kit for detecting or evaluating iPSC residues.

[0014] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted:

[0015] In a first aspect, the present invention provides a biomarker for detecting or evaluating iPSC residues, the biomarker comprising the ZIC3, ADAM19, ADD2 and ZSCAN10 genes.

[0016] Secondly, the present invention provides the application of substances that detect the above-mentioned biomarkers in the detection or evaluation of iPSC residues;

[0017] Preferably, the biomarker includes at least one of the ZIC3, ADAM19, ADD2, or ZSCAN10 genes.

[0018] Thirdly, the present invention provides a primer-probe combination for amplifying the above-mentioned biomarkers, the primer-probe combination including at least one of a primer set for detecting the ZIC3 gene, a primer set for detecting the ADAM19 gene, a primer set for detecting the ADD2 gene, or a primer set for detecting the ZSCAN10 gene.

[0019] The primer set used to detect the ZIC3 gene includes a forward primer, a reverse primer, and a probe, with nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

[0020] The primer set used to detect the ADAM19 gene includes a forward primer, a reverse primer, and a probe, with nucleotide sequences shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively.

[0021] The primer set for detecting the ADD2 gene includes a forward primer, a reverse primer, and a probe, with nucleotide sequences shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9, respectively.

[0022] The primer set used to detect the ZSCAN10 gene includes a forward primer, a reverse primer, and a probe, with nucleotide sequences shown in SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12, respectively.

[0023] Preferably, the 5' ends of the probes for detecting the ZIC3 gene, the ADAM19 gene, the ADD2 gene, and the ZSCAN10 gene all contain fluorescent reporter groups, which include FAM, HEX, or VIC, preferably FAM.

[0024] The probes for detecting the ZIC3 gene, the ADAM19 gene, the ADD2 gene, and the ZSCAN10 gene all contain a fluorescence quenching group at their 3' ends. The fluorescence quenching group includes MGB, BHQ1, or BHQ2, preferably MGB.

[0025] Fourthly, the present invention provides a method for detecting iPSC residues, comprising detecting the expression level of the biomarker of claim 1 in iPSC-derived cells.

[0026] Furthermore, the detection method includes using the cDNA of the cell to be tested as a template, performing PCR amplification using the primer and probe combination described in claim 3, and detecting the expression level of the biomarker in the cell to be tested.

[0027] Preferably, the template is dispersed into microdroplets, and a primer-probe combination is used to perform PCR amplification on the template in each microdroplet;

[0028] Preferably, if the copy number of the amplified product is less than 3, the expression level is 0.

[0029] Furthermore, the PCR amplification conditions include a pre-denaturation temperature of 94–99°C for 5–10 min, a denaturation temperature of 94–99°C for 30–60 s per cycle, an annealing extension temperature of 60–65°C for 45–60 s, and a number of amplification reaction cycles of 40–55.

[0030] Preferably, the PCR amplification conditions include a pre-denaturation temperature of 95°C for 10 min, a denaturation temperature of 94°C for 30 s per cycle, an annealing extension temperature of 60°C for 60 s per cycle, and a total amplification reaction cycle of 50 cycles.

[0031] Furthermore, the iPSC-derived cells include cells differentiated from iPSCs.

[0032] Fifthly, the present invention provides the application of the above-described primer-probe combination in the preparation of products for detecting or evaluating iPSC residues.

[0033] In a sixth aspect, the present invention provides a reagent for detecting or evaluating iPSC residues, comprising the primer-probe combination described above.

[0034] In a seventh aspect, the present invention provides a kit for detecting or evaluating iPSC residues, comprising the reagents described above.

[0035] This invention provides a biomarker for detecting or evaluating iPSC residues, wherein the expression levels of ZIC3, ADAM19, ADD2, and ZSCAN10 genes are almost zero or close to zero in MSC and iMSC cells, but extremely high in iPSCs, and can be used as biomarkers for detecting iPSC residues. This solves the technical problem in the prior art of lacking marker genes capable of detecting or evaluating iPSC residues in different tissues and functional cells of iPSC origin.

[0036] On the other hand, the provided primer and probe combination for amplifying the aforementioned biomarkers can specifically amplify the ZIC3, ADAM19, ADD2, and ZSCAN10 genes, respectively, enabling quantitative detection of each biomarker in cells. This improves the accuracy of detecting or assessing iPSC remnants, ensures the safety of iPSC-derived cells, and reduces the clinical risks associated with related applications.

[0037] Another method for detecting iPSC residues is provided, which uses primer-probe combinations to detect the content of biomarkers in iPSC-derived cells. Compared with existing technologies, this method is applicable to the detection of different tissues and functional cells from which iPSCs originate. The method is time-efficient, convenient and fast, and highly sensitive. It can quantitatively analyze the residual proportion of iPSCs in the sample, ensuring product safety. Attached Figure Description

[0038] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0039] Figure 1 The relative expression levels of candidate genes provided in iPSC, iMSC, and MSC are shown in Example 1 of this invention.

[0040] Figure 2 A comparison of amplification curves of candidate primer and probe sequence set 1 and candidate primer and probe sequence set 2 for the ZIC3, ADAM19, ADD2 and ZSCAN10 genes provided in Example 2 of the present invention;

[0041] Figure 3Comparison of positive droplet separation under 40, 50, and 55 cycles of ZIC3, ADAM19, ADD2, and ZSCAN10 genes provided in Example 3 of the present invention;

[0042] Figure 4 This is a scatter plot of the IDs of the ZIC3, ADAM19, ADD2 and ZSCAN10 genes in iPSCs and MSCs provided in Example 4 of the present invention. Detailed Implementation

[0043] Unless otherwise defined herein, the scientific and technical terms used in conjunction with this invention shall have the meanings commonly understood by one of ordinary skill in the art. The meaning and scope of terms shall be clear; however, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or foreign definitions. In this application, unless otherwise stated, the use of "or" means "and / or". Furthermore, the use of the term "comprising" and other forms is non-limiting.

[0044] Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well known in the art and as described in various general and more specific references, which are cited and discussed throughout this specification.

[0045] In one aspect, the present invention provides a biomarker for detecting or evaluating iPSC residues, the biomarker comprising the ZIC3, ADAM19, ADD2 and ZSCAN10 genes.

[0046] By comparing the expression levels of candidate genes in iPSC cells, iPSC-derived mesenchymal-like cells (iMSCs), and umbilical cord-derived mesenchymal stem cells (MSCs), it was found that the expression levels of ZIC3, ADAM19, ADD2, and ZSCAN10 genes were almost zero or close to zero in MSCs and iMSCs, but their expression levels were extremely high in iPSCs. These genes can serve as biomarkers for detecting iPSC remnants. This solves the technical problem of the lack of marker genes in existing technologies capable of sensitively detecting or assessing iPSC remnants in different tissues and functional cells derived from iPSCs.

[0047] Based on the differences in the expression of ZIC3, ADAM19, ADD2, and ZSCAN10 genes among iPSCs, MSCs, and iMSCs, another aspect of the present invention provides the application of substances that detect the aforementioned biomarkers in the detection or assessment of iPSC residues.

[0048] In applications, the biomarkers include at least one of the ZIC3, ADAM19, ADD2, or ZSCAN10 genes.

[0049] The mRNA sequences of the ZIC3, ADAM19, ADD2, and ZSCAN10 genes were retrieved using NCBI PubMed. Based on the coding sequences and spanning exons, corresponding primer pairs and probes were designed. Primer-probe combinations for amplifying the above biomarkers are provided. These combinations can be selected from primer sets for detecting the ZIC3 gene, the ADAM19 gene, the ADD2 gene, or the ZSCAN10 gene.

[0050] The primer set used to detect the ZIC3 gene includes a forward primer, a reverse primer, and a probe, with nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

[0051] The primer set used to detect the ADAM19 gene includes a forward primer, a reverse primer, and a probe, with nucleotide sequences shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively.

[0052] The primer set for detecting the ADD2 gene includes a forward primer, a reverse primer, and a probe, with nucleotide sequences shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9, respectively.

[0053] The primer set used to detect the ZSCAN10 gene includes a forward primer, a reverse primer, and a probe, with nucleotide sequences shown in SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12, respectively.

[0054] Preferably, the 5' ends of the probes for detecting the ZIC3 gene, the ADAM19 gene, the ADD2 gene, and the ZSCAN10 gene all contain fluorescent reporter groups, which include FAM, HEX, or VIC, preferably FAM.

[0055] The probes for detecting the ZIC3 gene, the ADAM19 gene, the ADD2 gene, and the ZSCAN10 gene all contain a fluorescence quenching group at their 3' ends. The fluorescence quenching group includes MGB, BHQ1, or BHQ2, preferably MGB.

[0056] Each primer set specifically amplifies the ZIC3, ADAM19, ADD2, and ZSCAN10 genes, enabling quantitative detection of various biomarkers in cells. The sensitivity of the primer sets for detecting the ZIC3, ADAM19, ADD2, and ZSCAN10 genes was 0.00001%, respectively. This improves the accuracy of detecting or assessing iPSC remnants, ensures the safety of iPSC-derived cells, and reduces the clinical risks associated with related applications.

[0057] According to another aspect of the present invention, a method for detecting iPSC residues is also provided, wherein the expression level of the biomarker of claim 1 in iPSC-derived cells is detected.

[0058] Using primer-probe combinations, the expression levels of biomarkers in iPSC-derived cells were detected by ddPCR. The expression levels of biomarkers are directly proportional to the residual amount of pluripotent stem cells in iPSC-derived cell products. The amount of residual pluripotent stem cells in cell products can be determined by the expression levels of biomarkers. Compared with existing technologies, this method is applicable to the detection of different tissues and functional cells derived from iPSCs. The method is time-efficient, convenient, rapid, and highly sensitive, and can quantitatively analyze the residual proportion of iPSCs in samples, ensuring product safety.

[0059] In some specific embodiments, the detection method includes using cDNA from the cell to be tested as a template, performing PCR amplification using the primer-probe combination described in claim 3, and detecting the expression level of the biomarker in the cell to be tested.

[0060] Using cDNA from the target cells as a template, a reaction system was prepared and dispersed into microdroplets. Each microdroplet contained 0, 1, or several molecules of the cDNA fragment from the iPSC-derived cells. PCR amplification was performed on the cDNA fragment in each microdroplet using a reaction system containing primer and probe combinations to generate an amplification signal. After amplification, all microdroplets were identified and counted based on fluorescence signals. The concentration of the target molecule was calculated using the Poisson distribution principle, and the copy number of the target molecule was output. If the copy number of the amplified product was <3, the expression level was considered 0, indicating no residue. Otherwise, the amount of pluripotent stem cells remaining in the cell product was determined based on the expression level of the biomarker.

[0061] This process can be carried out within tens of thousands of microdroplets (also known as microdroplets) generated by the microdroplet fragmentation method (water-in-oil method). The volume of the microdroplets is generally on the order of nL.

[0062] In conventional PCR systems, the number of cycles is usually set to 40. However, in this invention, considering the detection of trace samples, a lower detection limit and higher reaction sensitivity are more conducive to detecting residual iPSCs in the sample. In some specific embodiments, the ddPCR amplification conditions include a pre-denaturation temperature of 94-99°C for 5-10 min, a denaturation temperature of 94-99°C for 30-60 s per cycle, an annealing extension temperature of 60-65°C for 45-60 s, and a total amplification reaction cycle of 40-55 cycles.

[0063] The best amplification results are achieved when the ddPCR amplification conditions are set as follows: pre-denaturation temperature 95℃, time 10 min, denaturation temperature 94℃, denaturation time 30 s, annealing extension temperature 60℃, extension time 60 s, and amplification reaction cycle count of 50 cycles.

[0064] In some specific embodiments, the iPSC-derived cells include cells differentiated from iPSCs.

[0065] iPSCs are derived from blood cells (such as umbilical cord blood and peripheral blood) and mature somatic cells (such as skin fibroblasts).

[0066] Cells differentiated from iPSCs include ectoderm, mesoderm, endoderm cells, mesenchymal-like cells, NK cells, pancreatic islet cells, hepatocytes, RPE cells, cardiomyocytes, neurons, and adipocytes.

[0067] According to another aspect of the invention, the application of the above-described primer-probe combination in the preparation of products for detecting or evaluating iPSC residues is also provided.

[0068] According to another aspect of the present invention, a reagent for detecting or evaluating iPSC residues is also provided, characterized in that it comprises the primer-probe combination described above.

[0069] According to another aspect of the present invention, a kit for detecting or evaluating iPSC residues is also provided, comprising the reagents described above.

[0070] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the protection scope of the present invention.

[0071] Cell culture methods: The culture and preparation methods for umbilical cord blood-derived iPSCs, PBNK cells, and PSC-derived NK cells (iNK) were all derived from literature PMID:35747945; iPSC-derived MSCs (iMSCs) were prepared using Stemcell's Mesencult method. TM Differentiation kit (catalog number 05446).

[0072] RNA extraction: The reagents were prepared and RNA was extracted from the cell samples to be tested using the TaKaRa MiniBEST Universal RNA Extraction Kit (Takara product, catalog number: 9767) kit instructions. 60 μL of RNase-free ddH2O was added in the final step of the extraction.

[0073] cDNA preparation: The reverse transcription system was prepared according to Table 1, following the instructions of the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, catalog number: K1622). The reaction was terminated at 42℃ for 60 minutes and then at 70℃ for 5 minutes. After briefly centrifuging the PCR reaction tube, 80 μL of sterile water was added and mixed well. The mixture was then stored at -20℃ for use in q-PCR.

[0074] Table 1 Reverse Transcription System

[0075] Element volume Total RNA 500ng 5×Reaction Buffer 4μL RiboLock RNase inhibitor (20 U / μL) 1μL 10mM dNTP Mix 2μL RevertAid M-MuLV reverse transcriptase (200 U / μL) 1μL Oligo(dT)18 primers 1μL <![CDATA[RNase Free ddH2O]]> Up to 20 μL

[0076] Example 1: Screening Biomarkers

[0077] Candidate genes include ZIC3, ADAM19, ADD2, ZSCAN10, SOX2, OCT4, Nanog, and TDGF1, with GAPDH as the internal reference gene.

[0078] Candidate genes were selected through high-throughput transcriptome sequencing of pluripotent stem cells, mesenchymal-like cells differentiated from pluripotent stem cells, and umbilical cord-derived mesenchymal stem cells. Software was used to remove sequence adapters and low-quality bases, and the filtered sequences were aligned to the human genome. The number of sequencing fragments corresponding to the coding genes was calculated, and the significance of gene expression differences between groups was tested. Based on fold change differences, biomarkers were screened using KEGG and GO pathway analysis databases. Specifically, gene expression levels were validated using log2(Fold Change) > 10, and q-PCR was used to detect the expression levels of candidate genes.

[0079] Real-time quantitative PCR: Prepare the real-time quantitative PCR reaction system in PCR tubes according to Table 2, mix gently, and centrifuge. Prepare 1-2 extra systems according to the specific quantities. After preparing the mixture, mix well and aliquot into 18μL / tube. Add 2μL of template cDNA to each tube and mix well. After centrifugation, run the sample into the PCR instrument. The reaction conditions for real-time quantitative PCR are: pre-denaturation 95℃ for 30 seconds; denaturation 95℃ for 5 seconds, annealing extension 60℃ for 30 seconds, 40 cycles; melting curve 95℃ for 5 seconds, 60℃ for 1 minute, 95℃ for 1 second.

[0080] Table 2. Real-time quantitative PCR reaction system

[0081]

[0082] The primer sequences for each gene are shown in Table 3. Among them, the primers for OCT4 and Nanog genes are from Chinese patent publication number CN114164258A, and the primers for TDGF1 gene are from Chinese patent publication number CN114150074A.

[0083] Table 3. Primer sequences

[0084]

[0085]

[0086] The amplification results were obtained by relative quantification using GAPDH as an internal reference gene. -△CT Method analysis: All gene Ct values ​​from the three experiments were compiled. Then, the Ct value of the internal reference gene was subtracted from the Ct value of the target gene in each sample group to obtain ΔCT. The average ΔCT of the three experiments was calculated, as shown in Table 4.

[0087] Table 4. Expression levels of the target gene in MSC, iMSC, and iPSC cells, respectively.

[0088]

[0089] Then, the relative expression levels of each cell group were calculated by raising the -ΔCT of the cells in Table 4 to a power of 2. The relative expression ratios (Fold Change) of iPSC / MSC and iPSC / iMSC were then calculated separately, as follows: Figure 1 As shown.

[0090] The expression levels of the four biomarker genes in iPSCs were more than 100 times higher than those in MSCs and iMSCs, especially ADAM19 and ADD2, whose expression levels in iPSCs were more than 10,000 times higher than those in iMSCs. This demonstrates that the expression of ADAM19, ADD2, ZIC3, and ZSCAN10 varies greatly among different cell types, with high expression in iPSCs but almost no expression in MSCs and iMSCs.

[0091] Example 2: Specific detection of primer-probe combinations.

[0092] cDNA was prepared by reverse transcription of the extracted RNA using the method described in Example 1. The mRNA sequences of the ZIC3, ADAM19, ADD2, and ZSCAN10 genes were queried using NCBI PubMed. Based on the coding sequence and spanning exons, two sets of primers and corresponding probes were designed for each gene (as shown in Tables 5 and 6). The primer amplification curves were tested using 2×T5 Fast q-PCR Mix (Probe) (Catalog No.: TSE301) from Qingke Biotechnology to determine the effectiveness of different design schemes.

[0093] Table 5

[0094] Primers Candidate primer sequence set 1 (5'-3') serial number ZIC3-F1 GACCCACACAGGTGAGAAAC SEQ ID NO.1 ZIC3-R1 TGTAGGACTTGTCGCACACT SEQ ID NO.2 ZIC3-Probe TTGCCAACAGCAGCGACCGT SEQ ID NO.3 ADAM19-F1 ACACAAGCTGGGAAGATTGC SEQ ID NO.4 ADAM19-R1 GAATCTGTGGCTCTGGCTTG SEQ ID NO.5 ADAM19-Probe CCTTTCTCCTCCTCCACAAGTGGCA SEQ ID NO.6 ADD2-F1 TTTCAGGGAGGAGCTGGAAG SEQ ID NO.7 ADD2-R1 TCAGCTGTGTGGAGGTCATT SEQ ID NO.8 ADD2-Probe TGGCCAGCACCTCCCACGCA SEQ ID NO.9 ZSCAN10-F1 CGTTTCCGCAATAGCTCCAA SEQ ID NO.10 ZSCAN10-R1 CTGAAGCTCTTCCCGCACTC SEQ ID NO.11 ZSCAN10-Probe TCGCAGCTTCCGGCGCAACG SEQ ID NO.12

[0095] Table 6

[0096] Primers Candidate primer sequence set 2 (5'-3') serial number ADD2-F2 CGGCAGGACTTCAACCTGAT SEQ ID NO.23 ADD2-R2 AGGTCCAGGAGTCGGTAGAC SEQ ID NO.24 ADD2-Probe-2 TGGAAGGCCTCATCCAGGA SEQ ID NO.25 ZSCAN10-F2 TCCGCAATAGCTCCAACCTG SEQ ID NO.26 ZSCAN10-R2 CTAGTACAGCGTCTCGCGG SEQ ID NO.27 ZSCAN10-Probe-2 TGTCAGACGTGCGGTCGCAG SEQ ID NO.28 ZIC3-F2 AACAGCAGCGACCGTAAGAA SEQ ID NO.29 ZIC3-R2 TGCACAGTAGGTTCGGCATT SEQ ID NO.30 ZIC3-Probe-2 CTATATCTGCAAAGTGTGCG SEQ ID NO.31 ADAM19-F2 TGGGCCATTGGCTTCTTTTTG SEQ ID NO.32 ADAM19-R2 GCCTGACATTGCCAGTCTCT SEQ ID NO.33 ADAM19-Probe-2 CAGAACCAAGCTAGACCCAC SEQ ID NO.34

[0097] All probes are marked with FAM at the 5' end and MGB at the 3' end.

[0098] The reaction system is shown in Table 7:

[0099] Table 7

[0100]

[0101]

[0102] The reaction procedure is shown in Table 8:

[0103] Table 8

[0104]

[0105] The amplification effects of each primer and probe sequence are as follows: Figure 2The diagram shows a comparison of amplification curves for candidate primer and probe sequence group 1 (ZIC3, ADAM19, ADD2, and ZSCAN10) and candidate primer and probe sequence group 2. In the diagram, A represents ZIC3, B represents ADAM19, C represents ADD2, and D represents ZSCAN10. Curve 1 represents candidate primer and probe sequence group 1, and curve 2 represents candidate primer and probe sequence group 2. Comparing the amplification curves, even for the same target gene sequence, different primer and probe designs result in different Q-PCR amplification effects. Using the sequences in candidate group 1 can specifically amplify the target sequence, producing a classic S-shaped amplification curve, with significantly better results than the sequences in candidate group 2. Therefore, primers and probes from candidate group 1 were used in subsequent examples for ddPCR method studies.

[0106] Example 3: Optimization of ddPCR amplification conditions

[0107] In conventional PCR systems, the number of cycles is typically set to 40. Considering that for the detection of trace samples, a lower detection limit and higher reaction sensitivity are more beneficial for detecting residual iPSCs in the sample, the inventors attempted to increase the number of reaction cycles to examine the effect of ddPCR. Method optimization tests were conducted on the number of cycles in the reaction program and the probe concentration in the reaction system.

[0108] The preparation of the ddPCR reaction system is shown in Table 9:

[0109] Table 9. Composition of each component in the ddPCR reaction.

[0110] reagents Final concentration Added amount 2×ddPCR Supermix NA 10μL upstream primer 900nM 1.8μL Downstream primer 900nM 1.8μL probe 125nM 2.5μL cDNA sample 1000ng 2μL sterile water NA 1.9μL

[0111] After adding the samples, vortex to mix thoroughly, then transfer to a droplet generator in the dark to generate water-in-oil droplets. Transfer the droplets to a 96-well plate, heat-seal with aluminum foil, and perform droplet PCR. The program settings are shown in Table 10.

[0112] Table 10 ddPCR reaction program settings

[0113]

[0114]

[0115] Cell sample preparation: The spiked samples used often contain extremely low numbers of iPSCs. Using conventional AOPI or trypan blue counting methods makes it difficult to guarantee the accuracy of sample loading when the sample volume is only a few or dozens of cells. Therefore, this invention employs a combination of conventional cell counting and limiting dilution. The iPSC suspension counted by AOPI is diluted to a concentration of 80 cells / 10 mL. The cell suspension is then evenly spotted into a 96-well plate at a rate of 100 μL / well. Each well is observed under a microscope, and wells containing only one iPSC are selected and labeled. Cells from these wells are collected for the preparation of samples with different iPSC doping ratios.

[0116] Cells were mixed according to the proportions shown in Table 11. Three biological replicates were set up for each sample group. The samples were centrifuged at 300g / 5min, and the supernatant was discarded and the precipitate was collected. RNA was extracted, reversed to cDNA, and the copy number was determined by ddPCR.

[0117] Table 11

[0118] serial number sample iPSC (units) MSC (units) 1 iPSC 1E7 0 2 0.001% iPSC 1000 1E7 3 0.0001% iPSC 100 1E7 4 0.00001% iPSC 10 1E7 5 0.000001% iPSC 1 1E7 6 MSC 0 1E7 7 iMSC 0 1E7

[0119] Optimization Project 1: The reaction cycle number was set to 40, 50, and 55 cycles. The reaction program was 95℃ for 10 min, [94℃ for 30 s, 60℃ for 1 min] × different cycle numbers, 98℃ for 10 min, and 4℃ hold. The separation of positive droplets in 0.0001% iPSC in MSC cell samples was detected. Specific results are as follows... Figure 3 The image shows a comparison of the separation of positive droplets from the ZIC3, ADAM19, ADD2, and ZSCAN10 genes in 40, 50, and 55 cycles (left, middle, and right channels). A represents ZIC3, B represents ADAM19, C represents ADD2, and D represents ZSCAN10.

[0120] It was found that in ZIC3, the number of detectable positive droplets after 50 and 55 cycles was significantly higher than that after 40 cycles, but the positive droplets after 55 cycles were less dispersed than those after 50 cycles. For the ADAM19 gene, the number of non-specific positive droplets increased significantly after 55 cycles, and the number of positive droplets after 50 cycles was greater than that after 40 cycles, which is beneficial for detecting samples with very low iPSC cell residue. In ADD2, the number of detectable positive droplets after 50 and 55 cycles was significantly higher than that after 40 cycles, and the dispersion of positive droplets in the 50 and 55 cycles was similar, considering the reaction time and enzyme activity. In ZSCAN10, the number of detectable positive droplets after 50 and 55 cycles was significantly higher than that after 40 cycles, and the dispersion of positive droplets in the 50 and 55 cycles was similar. Therefore, 50 cycles is preferred.

[0121] Optimization Project 2: The probe concentrations were grouped into 125 nM and 250 nM. The reaction program was: 95℃ for 10 min, [94℃ for 30 s, 60℃ for 1 min] × 50 cycles, 98℃ for 10 min, 4℃ hold. The number of positive droplets in 0.001% iPSC in MSC, 0.0001% iPSC in MSC cell samples and NTC and negative control was detected, as shown in Table 12. There was no significant order of magnitude difference in the positive copy number output by ddPCR under the final probe concentrations of 125 nM and 250 nM. Therefore, the 125 nM probe concentration was selected for detection.

[0122] Table 12

[0123]

[0124] Example 4: Detection of the expression of ZIC3, ADAM19, ADD2, and ZSCAN10 in iPSCs, MSCs, and iMSCs using ddPCR.

[0125] In this embodiment, the optimized ddPCR amplification conditions of Example 3 were used to detect the iPSC, MSC and iMSC cell samples prepared in Table 11. In addition, a reverse transcription blank control NTC group was set up, in which only water was added during reverse transcription.

[0126] FAM fluorescence signal was detected, and copy number was counted. Gene thresholds were set according to Amplitude = 2000. The copy number results after adding 10 ng of cDNA are shown in Table 13, and the corresponding 1D scatter plot is shown below. Figure 4 The distribution of positive droplets is shown, with the sample channels from left to right as follows: ZIC3, ADAM19, ADD2, and ZSCAN10 in iMSC; ZIC3, ADAM19, ADD2, and ZSCAN10 in MSC and iPSC.

[0127] Table 13

[0128]

[0129]

[0130] It was found that the four marker genes could output high copy numbers when the template amount was 10 ng of iPSC cDNA, but they were undetectable in negative control NTC and negative control MSC and iMSC cells (copy number < 3). Furthermore, the droplet distribution map showed concentrated positive droplets, which could be well distinguished from negative droplets. Therefore, the primers and probes in this embodiment have excellent specificity for iPSC residual detection.

[0131] Example 5: Sensitivity of primer-probe combination.

[0132] In this embodiment, cell samples with different iPSC concentration gradients prepared according to Table 11 were selected, including 0.001% iPSC, 0.0001% iPSC, 0.00001% iPSC, 0.000001% iPSC and negative control MSCs. The copy numbers of ZIC3, ADAM19, ADD2 and ZSCAN10 in the above cell samples were detected according to the optimized ddPCR conditions in Example 3. The output copy number results are shown in Tables 14 to 17.

[0133] Table 14. Copy number results of ZIC3 cells as detected by gradient assay

[0134]

[0135] Table 15. Copy number results of ADAM19 cells as detected by gradient assay.

[0136]

[0137] Table 16. Copy number results of ADD2 cells gradient detection

[0138]

[0139] Table 17. Copy number results from ZSCAN10 cell gradient detection

[0140]

[0141]

[0142] The calculation is based on the formula LLOD = mean + 3.18 × SD.

[0143] ZIC3 has an LLOD of 2.59 copies / reaction, ADAM19 has an LLOD of 4.24 copies / reaction, ADD2 has an LLOD of 1.73 copies / reaction, and ZSCAN10 has an LLOD of 0.61 copies / reaction.

[0144] The test results show that ZIC3 can detect 0.00001% with a sensitivity of 0.00001%; ​​ADAM19 can detect 0.0001% with a sensitivity of 0.0001%; ​​ADD2 can detect 0.00001% with a sensitivity of 0.00001%; ​​and ZSCAN10 can detect 0.00001% with a sensitivity of 0.00001%.

[0145] Example 5: Application of primer-probe combinations in the detection of mixed cell samples

[0146] This example uses the same dd-PCR reaction system as Example 3.

[0147] Table 18

[0148] serial number sample iPSC (units) MSC (units) PBNK 1 iPSC 1E7 0 0 3 0.0001% iPSC in MSC 100 1E7 0 4 0.00005% iPSC in MSC 5 1E7 0 5 0.000001% iPSC in MSC 1 1E7 0 6 MSC 0 1E7 0 7 PBNK 0 0 1E7 8 0.0001% iPSC in PBNK 100 0 1E7 9 0.00005% iPSC in PBNK 5 0 1E7 10 0.000001% iPSC in PBNK 1 0 1E7

[0149] The expression of ZIC3, ADAM19, ADD2, and ZSCAN10 genes in 0.0001% iPSC in MSC, 0.00005% iPSC in MSC, 0.00001% iPSC in MSC and MSC samples, as well as 0.0001% iPSC in PBNK, 0.00005% iPSC in PBNK, 0.00001% iPSC in PBNK and PBNK samples prepared according to the method in Table 18 were detected six times repeatedly, and the copy numbers are shown in Tables 19-22.

[0150] Table 19

[0151]

[0152]

[0153] As shown in Table 19, the number of positive droplets differed significantly between 0.00001% iPSC in MSC and MSC, and between 0.00001% iPSC in PBNK and PBNK. Therefore, the lower limit of the 95% confidence interval for the corresponding concentrations (2.463443 and 0.527443) was selected as the reference for determining the detection rate of each replicate test. The detection rate of MSC and PBNK in the negative control group was 0, while the detection rate of 0.00001% iPSC in MSC and 0.00001% iPSC in PBNK was 100%. Therefore, the detection limit of the ZIC gene was 0.00001% iPSC, which is qualified for specificity.

[0154] Table 20

[0155]

[0156] As shown in Table 20, the number of positive droplets differed significantly between 0.0001% iPSC in MSC and MSC, and between 0.0001% iPSC in PBNK and PBNK. Therefore, the lower limit of the 95% confidence interval for the corresponding concentrations (3.158734 and 5.285794) was selected as the reference for determining the detection rate of each replicate test: the detection rate of MSC and PBNK in the negative control group was 0, and the detection rate of 0.0001% iPSC in MSC and 0.0001% iPSC in PBNK was 100%. Therefore, the detection limit of ADAM19 gene is 0.0001% iPSC, which is qualified for specificity.

[0157] Table 21

[0158]

[0159] As shown in Table 21, the number of positive droplets differed significantly between 0.00001% iPSC in MSC and MSC, and between 0.00001% iPSC in PBNK and PBNK. Therefore, the lower limit of the 95% confidence interval for the corresponding concentrations (2.533651 and 6.139225) was selected as the reference for determining the detection rate of each replicate test: the detection rate of PBNK in the negative control group was 0, and the detection rates of 0.00001% iPSC in MSC and 0.00001% iPSC in PBNK were 100%. Therefore, the detection limit of the ADD2 gene is 0.00001% iPSC, which is qualified for specificity.

[0160] Table 22

[0161]

[0162]

[0163] As shown in Table 22, the number of positive droplets differed significantly between 0.00001% iPSC in MSC and MSC, and between 0.00001% iPSC in PBNK and PBNK. Therefore, the lower limit of the 95% confidence interval for the corresponding concentrations (1.810079 and 4.783654) was selected as the reference for determining the detection rate of each replicate test: the detection rate of MSC and PBNK in the negative control group was 0, and the detection rate of 0.00001% iPSC in MSC and 0.0001% iPSC in PBNK was 100%. Therefore, the detection limit of ADAM19 gene is 0.00001% iPSC, which is qualified for specificity.

[0164] Example 6: Application of detecting iPSC cell remnants in iMSCs and iNKs

[0165] Cell samples iNK and iMSC were prepared for testing. Positive controls included 0.00001% iPSC in PBNK and 0.00001% iPSC in MSC, while negative controls included NTC in PBNK and MSC. The ddPCR reaction system and procedure disclosed in Example 3 were used to perform ddPCR detection on three batches of cell samples. The output copy number results are shown in Table 23.

[0166] Table 23

[0167]

[0168] As shown in Table 23, positive droplets could be detected in both the detection limit group (0.00001% iPSC in PBNK and 0.00001% iPSC in MSC). The detection values ​​in the negative control group (MSC and PBNK) were both lower than the limit of quantitation copy number. The detection values ​​in iNK and iMSC were undetectable (less than the limit of quantitation positive droplet number), indicating that the method is robust and no iPSC residues were found in the application of iMSC and iNK.

[0169] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a reagent for detecting a biomarker in detecting or evaluating iPSC residue for non-disease diagnosis purposes. The biomarker comprises ZIC3, ADAM19, ADD2 and ZSCAN10 genes.

2. Use of a primer probe combination for amplifying the biomarker of claim 1 in the detection or assessment of iPSC persistence for non-diagnostic purposes, characterized in that, The primer probe combination comprises a primer set for detecting the ZIC3 gene, a primer set for detecting the ADAM19 gene, a primer set for detecting the ADD2 gene and a primer set for detecting the ZSCAN10 gene. The primer set for detecting the ZIC3 gene comprises a forward primer, a reverse primer and a probe, and the nucleotide sequences are shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3, respectively. The primer set for detecting the ADAM19 gene comprises a forward primer, a reverse primer and a probe, and the nucleotide sequences are shown in SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6, respectively. The primer set for detecting the ADD2 gene comprises a forward primer, a reverse primer and a probe, and the nucleotide sequences are shown in SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9, respectively. The primer set for detecting the ZSCAN10 gene comprises a forward primer, a reverse primer and a probe, and the nucleotide sequences are shown in SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 12, respectively.

3. Use according to claim 2, characterized in that, The 5' end of the probe for detecting the ZIC3 gene, the probe for detecting the ADAM19 gene, the probe for detecting the ADD2 gene and the probe for detecting the ZSCAN10 gene all contain a fluorescent reporter group, which comprises FAM, HEX or VIC. The 3' end of the probe for detecting the ZIC3 gene, the probe for detecting the ADAM19 gene, the probe for detecting the ADD2 gene and the probe for detecting the ZSCAN10 gene all contain a fluorescent quencher group, which comprises MGB, BHQ1 or BHQ2.

4. Use according to claim 3, characterized in that, The fluorescent reporter group is FAM, and the fluorescent quencher group is MGB.

5. A method for detecting residual iPSCs for a purpose other than disease diagnosis, characterized by, The method comprises detecting the expression amount of the biomarker in the iPSC-derived cells. The biomarker comprises ZIC3, ADAM19, ADD2 and ZSCAN10 genes.

6. The method of claim 5, wherein, The method comprises using the cDNA of the cells to be tested as a template and using the primer probe combination of claim 2 to perform PCR amplification, and detecting the expression amount of the biomarker in the cells to be tested.

7. The method of claim 6, wherein, The template is dispersed into microdroplets, and the primer probe combination is used to perform PCR amplification on the template in each microdroplet.

8. The method of claim 7, wherein, If the copy number of the amplification product is < 3, the expression amount is 0.

9. The method of claim 6, wherein, The conditions of the PCR amplification comprise a pre-denaturation temperature of 94-99℃ for 5-10 min, each cycle of denaturation temperature 94-99℃ for 30-60 s, annealing and extension temperature 60-65℃, extension time 45-60 s, and amplification reaction cycle number 40-55 cycles.

10. The method of claim 9, wherein, The PCR amplification conditions include pre-denaturation temperature 95℃, time 10 min, each cycle with denaturation temperature 94℃, denaturation time 30 s, annealing and extension temperature 60℃, extension time 60 s, and the number of amplification reaction cycles is 50 cycles.

11. The method according to any one of claims 5 to 10, characterized in that, The iPSC-derived cells include cells produced by differentiation of iPSCs.

12. Use of the primer probe combination according to any one of claims 2-4 in the manufacture of a product for detecting or assessing iPSC persistence for non-disease diagnostic purposes.

Images