A method for constructing high-throughput protein capture interfaces by antibody adsorption

By synthesizing tetrahedral framework nucleic acid structures on a gold island substrate and mixing them with antibodies, a high-throughput protein capture interface was constructed, solving the problems of complex interface operation and poor versatility in existing technologies, and achieving high-sensitivity and high-accuracy protein detection.

CN118604346BActive Publication Date: 2026-05-19RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410707752.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-03
Publication Date
2026-05-19
Estimated Expiration
2044-06-03

AI Technical Summary

Technical Problem

In existing technologies, antibody interfaces constructed through chemical modification methods are complex to operate, have low modification yields, and are difficult to achieve stable and universal high-throughput protein capture interfaces.

Method used

A high-throughput protein capture interface was constructed by mixing a tetrahedral framework nucleic acid structure with an antibody on a gold island substrate. Through steps such as incubation, blocking, and fluorescent secondary antibody incubation, a uniform capture interface was formed, and fluorescence imaging and quantification were performed using a chip scanner.

Benefits of technology

It achieves high-throughput, high-sensitivity, and high-accuracy protein capture and quantification with good interface uniformity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118604346B_ABST
    Figure CN118604346B_ABST
Patent Text Reader

Abstract

The application discloses a method for constructing a high-throughput protein capture interface by antibody adsorption, which comprises the following steps: S1, synthesizing a tetrahedral framework nucleic acid structure; S2, mixing a capture antibody and the synthesized tetrahedral framework nucleic acid structure on a gold island substrate to prepare a high-throughput protein capture interface; S3, placing the gold island substrate in a wet box for overnight incubation; S4, blocking the capture interface to prevent non-specific adsorption; S5, incubating a protein target; S6, incubating a detection antibody; S7, incubating a fluorescent secondary antibody; S8, washing the capture interface with pure water and centrifuging and air-drying; and S9, performing fluorescent imaging and quantification on the capture interface by using a chip scanner. The method for constructing a high-throughput protein capture interface by antibody adsorption has high uniformity, and can realize high-throughput, high-sensitivity and high-accuracy protein capture and quantitative detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of bioinformatics and biomedicine, and in particular to a method for constructing a high-throughput protein capture interface through antibody adsorption. Background Technology

[0002] Enzyme-Linked Immunosorbent Assay (ELISA) is a highly specific detection technique based on enzyme-linked immunosorbent assays (ELISA), combining the specific recognition of antigens and antibodies with the highly efficient catalytic action of enzymes. The basic method involves adsorbing known antigens or antibodies onto the surface of a solid-phase support (polystyrene microplate), allowing the enzyme-labeled antigen-antibody reaction to occur on the solid surface. Free components in the liquid phase are then washed away, ensuring the specificity and stability of the test results. Finally, quantitative determination is achieved through a colorimetric reaction. Different designs can be used to detect specific antigens or antibodies; a double-antibody sandwich assay is commonly used to detect large molecular antigens (such as proteins).

[0003] In recent years, fluorescent solid-phase interfaces have made significant progress in biosensing interfaces. These sensing systems offer high throughput and parallel analysis capabilities, along with high versatility, making them widely used in disease diagnosis. Compared to colorimetric ELISA methods, fluorescent solid-phase sensing offers higher sensitivity, meeting the detection requirements of low-abundance targets. Currently, existing capture interfaces typically involve chemical modification, where antibodies are attached to the interface. These methods are complex, have low modification yields, and, due to their dependence on specific amino acid groups of the antibody, lack versatility, making it difficult to develop a stable and universal method for constructing capture interfaces. Therefore, there is a need to develop a method for constructing high-throughput protein capture interfaces through antibody adsorption. Summary of the Invention

[0004] To overcome the shortcomings of existing technologies, a method for constructing a high-throughput protein capture interface through antibody adsorption is provided.

[0005] This invention is achieved through the following scheme:

[0006] A method for constructing a high-throughput protein capture interface via antibody adsorption, the method comprising the following steps:

[0007] S1, synthesize tetrahedral framework nucleic acid structures;

[0008] S2, the capture antibody and the synthesized tetrahedral framework nucleic acid structure were mixed and prepared on the gold island substrate to construct a high-throughput protein capture interface;

[0009] S3, place the Golden Island substrate in a humidified box and incubate overnight;

[0010] S4 seals the capture interface to prevent non-specific adsorption;

[0011] S5, incubation protein target;

[0012] S6, incubation for antibody detection;

[0013] S7, incubate with fluorescent secondary antibody;

[0014] S8, wash the capture interface with pure water and centrifuge and air dry;

[0015] S9 uses a chip scanner to perform fluorescence imaging and quantification of the capture interface.

[0016] In step S1, the edge length of the synthesized tetrahedral framework nucleic acid structure is 17bp, which is the 17bp DTF.

[0017] A tetrahedral framework nucleic acid structure with an edge length of 17 bp was formed by the self-assembly of four single-stranded DNAs with sequences SEQ ID: 1, SEQ ID: 2, SEQ ID: 3, and SEQ ID: 4.

[0018] In step S2, the molar ratio of the capture antibody to 17bp DTF is 5:1.

[0019] In step S3, the humidity of the incubation is 70%.

[0020] In step S4, the solution used for sealing is 2% BSA.

[0021] The capture interface was sealed with a 2% BSA solution to prevent nonspecific adsorption for 45 minutes, and then the capture interface was washed to remove excess BSA.

[0022] In step S5, the incubation time for the protein target is 2.5 hours.

[0023] In step S6, the incubation of the detection antibody takes 1.5 hours, and the concentration of the detection antibody is 50 nM.

[0024] In step S7, the concentration of the fluorescent secondary antibody is 20 nM, and the incubation time for the fluorescent secondary antibody is 20 minutes.

[0025] The beneficial effects of this invention are as follows:

[0026] The present invention provides a method for constructing a high-throughput protein capture interface through antibody adsorption, which has high uniformity and can achieve high-throughput, high-sensitivity, and high-accuracy protein capture and quantitative detection. Attached Figure Description

[0027] Figure 1This is a schematic diagram of a high-throughput protein capture interface constructed by antibody adsorption in Embodiment 1 of the present invention.

[0028] Figure 2 This is a physical image of the high-throughput protein capture interface constructed by antibody adsorption according to Embodiment 1 of the present invention.

[0029] Figure 3 This is a schematic diagram illustrating the principle of high-throughput protein detection using a capture interface according to Embodiment 1 of the present invention.

[0030] Figure 4 This is a quantitative scatter plot of the capture interface uniformity according to Embodiment 1 of the present invention, wherein the gray dashed line represents the average fluorescence intensity of all fluorescent spots; the scale bar is 200 μm.

[0031] Figure 5 This is a fluorescence imaging characterization of the protein capture interface according to Example 1 of the present invention, wherein the capture antibody is labeled with a Cy3 fluorescent group and the tetrahedral structure is labeled with a Cy5 fluorescent group; the scale bar is 200 μm.

[0032] Figure 6 The capture interface is characterized by fluorescence imaging after protein detection according to Example 1 of the present invention, wherein the capture antibody is labeled with the Cy3 fluorescent group and the secondary fluorescent antibody is labeled with the Alexa Fluor 647 fluorescent group; the scale bar is 200 μm.

[0033] Figure 7 The standard curve and fluorescence graph of protein target concentration versus fluorescence intensity according to Example 1 of the present invention are shown, wherein the secondary antibody is labeled with the Alexa Fluor 647 fluorescent group; the scale bar of the fluorescence graph is 200 μm. Detailed Implementation

[0034] The preferred embodiments of the present invention are further described below:

[0035] In this application, the English term for tetrahedral nucleic acid structure is DNA tetrahedral frameworks, abbreviated as DTF. bp stands for base pair.

[0036] A method for constructing a high-throughput protein capture interface via antibody adsorption, the method comprising the following steps:

[0037] S1, synthesize tetrahedral framework nucleic acid structures;

[0038] S2, the capture antibody and the synthesized tetrahedral framework nucleic acid structure were mixed and prepared on the gold island substrate to construct a high-throughput protein capture interface;

[0039] S3, place the Golden Island substrate in a humidified box and incubate overnight;

[0040] S4 seals the capture interface to prevent non-specific adsorption;

[0041] S5, incubation protein target;

[0042] S6, incubation for antibody detection;

[0043] S7, incubate with fluorescent secondary antibody;

[0044] S8, wash the capture interface with pure water and centrifuge and air dry;

[0045] S9 uses a chip scanner to perform fluorescence imaging and quantification of the capture interface.

[0046] In step S1, the edge length of the synthesized tetrahedral framework nucleic acid structure is 17bp, which is the 17bp DTF.

[0047] A tetrahedral framework nucleic acid structure with an edge length of 17 bp was formed by the self-assembly of four single-stranded DNAs with sequences SEQ ID: 1, SEQ ID: 2, SEQ ID: 3, and SEQ ID: 4.

[0048] In step S2, the molar ratio of the capture antibody to 17bp DTF is 5:1.

[0049] In step S3, the humidity of the incubation is 70%.

[0050] In step S4, the solution used for sealing is 2% BSA.

[0051] The capture interface was sealed with a 2% BSA solution to prevent nonspecific adsorption for 45 minutes, and then the capture interface was washed to remove excess BSA.

[0052] In step S5, the incubation time for the protein target is 2.5 hours.

[0053] In step S6, the incubation of the detection antibody takes 1.5 hours, and the concentration of the detection antibody is 50 nM.

[0054] In step S7, the concentration of the fluorescent secondary antibody is 20 nM, and the incubation time for the fluorescent secondary antibody is 20 minutes.

[0055] The present application will be further described below with reference to specific embodiments:

[0056] This invention selects a plasma gold island as a substrate and uses an ultra-micro pipetting platform to mix monoclonal antibodies and tetrahedral framework nucleic acid structures on the substrate, thus constructing a uniform and high-throughput capture interface that can achieve highly sensitive and specific detection of protein targets.

[0057] The novel method for antibody interfacial adsorption described in this invention mainly includes the following steps: S1, synthesizing a tetrahedral framework nucleic acid structure. S2, mixing the monoclonal antibody and the tetrahedral framework nucleic acid structure and preparing it on a gold island substrate to construct a high-throughput protein capture interface. S3, placing the gold island substrate in a humidified chamber at 70% humidity and incubating overnight. S4, blocking the capture interface with 2% BSA solution to prevent non-specific adsorption for approximately 45 minutes, then washing the capture interface to remove excess BSA. S5, incubating the protein target for approximately 2.5 hours, then washing the capture interface to remove excess target. S6, incubating the detection antibody for approximately 1.5 hours, then washing the capture interface to remove excess detection antibody. S7, incubating the fluorescent secondary antibody for approximately 20 minutes, then washing the capture interface to remove excess fluorescent secondary antibody. S8, washing the capture interface with pure water and centrifuging to dry. S9, performing fluorescence imaging and quantification of the capture interface using a chip scanner.

[0058] The specific engineering process of the method described in this application is as follows:

[0059] The reagents included four single-stranded DNA strands for assembling tetrahedral DNA structures (17 bp in length, with thiol groups modified at the vertices): A17 (55 nt, ssDNA), B17 (55 nt, 5' end modified with thiol groups, ssDNA), C17 (55 nt, 5' end modified with thiol groups, ssDNA), and D17 (55 nt, 5' end modified with thiol groups, ssDNA). All were purchased from Shanghai Sangon Biotech Co., Ltd.

[0060] A17: (SEQ ID NO: 1)

[0061] ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAA GAGCCGCCATAGTA

[0062] B17: (SEQ ID NO: 2)

[0063] TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATG CGAGGGTCCAATAC

[0064] C17: (SEQ ID NO: 3)

[0065] TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC

[0066] D17: (SEQ ID NO: 4)

[0067] TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTAT TGGACCCTCGCAT

[0068] The substrate was purchased from Suzhou Nada Biotechnology Co., Ltd. GOLM 1 protein capture antibody (monoclonal antibody, mouse anti-human) and detection antibody (polyclonal antibody, rabbit anti-human) were purchased from Proteintech. Human GOLM 1 protein standards were purchased from Thermo Fisher. Phosphate-buffered saline (PBS), Tween 20, and bovine serum albumin (BSA) were purchased from Sangon Biotech (Shanghai) Co., Ltd. Tris-(2-carboxythyl)phosphine hydrochloride (TCEP) was purchased from Sigma-Aldrich.

[0069] Phosphate-buffered saline (PBS) contains 10 mM phosphate, 137 mM NaCl, and 2.7 mM KCl, with a pH of 7.4. PBST solution is a PBS solution containing 0.5% Tween 20.

[0070] According to the present invention, the specific process of antibody interfacial adsorption is as follows:

[0071] S1: Synthesis of tetrahedral framework nucleic acid structures. Equal volumes of four ssDNA strands (A17, B17, C17, and D17) were mixed in magnesium-containing Tris buffer (20 mmol / L Tris + 50 mmol / L MgCl2, pH 8.0, prepared with ultrapure water), and 30 mM TCEP was added to bring the final concentration of each ssDNA strand to 1 μM and the final concentration of TCEP to 3 mM. The reaction system was placed in an Eppendorf PCR instrument and incubated at 95°C for 10 min, then at 4°C for at least 10 min to obtain tetrahedrons with an edge length of 17 bp (17 bp DTF). The structures were then stored at 4°C until use.

[0072] S2: Dilute the capture antibody to 2 μM with PBS and the 17 bp DTF to 400 nM with PBS. Mix 30 μL of the diluted capture antibody with 30 μL of the diluted DTF, and incubate briefly. Print the capture antibody and DTF mixture onto a gold island substrate using an ultra-micropipette platform. Each gold island substrate contains 14 arrays, and each array contains 25 microdroplets. The ultra-micropipette platform program is set as follows:

[0073] "S1BL1,2,3,4,5,6,7,8,9,10,11,12,13,141:5,1:5=10"

[0074] S3: Place the gold island substrate in a humidified chamber at 70% humidity and incubate overnight. After incubation, place the gold island substrate into a metal clamp, wash the capture interface twice with PBST solution, wash the capture interface once with PBS solution, and shake off any remaining liquid in the enclosure.

[0075] S4: Prepare a 2% BSA solution (0.2g BSA powder dissolved in 10mL PBS solution). Add 100μL of 2% BSA solution to each enclosure and incubate on a shaker for 45 minutes to seal the capture interface and prevent non-specific adsorption. After incubation, wash the capture interface 4 times with PBST solution and 2 times with PBS solution to remove excess BSA. Shake off any remaining liquid in the enclosure.

[0076] S5: GOLM 1 protein standards were serially diluted with PBS to obtain standards at concentrations of 3500 pg / mL, 1750 pg / mL, 437.5 pg / mL, 109.4 pg / mL, 27.3 pg / mL, and 13.7 pg / mL. 50 μL of each concentration of standard and PBS solution (blank control) were added to each trap and incubated on a shaker for 2.5 hours. After incubation, the trap interface was washed 6 times with PBST solution and 3 times with PBS solution to remove excess protein. The remaining liquid in the trap was then shaken dry.

[0077] S6: Dilute the detection antibody to 50 nM with PBS solution. Add 50 μL of detection antibody to each enclosure and incubate on a shaker for 1.5 hours. After incubation, wash the capture interface 4 times with PBST solution and 2 times with PBS solution to remove excess detection antibody, and shake off any remaining liquid in the enclosure.

[0078] S7: Dilute the fluorescent secondary antibody to 20 nM with PBS solution. Add 50 μL of fluorescent secondary antibody to each enclosure and incubate on a shaker for 20 minutes. After incubation, wash the capture interface 6 times with PBST solution and 3 times with PBS solution to remove excess fluorescent secondary antibody. Shake off any remaining liquid in the enclosure.

[0079] S8: Remove the metal fence, immerse the entire Golden Island base in pure water and remove it immediately, then centrifuge and air dry.

[0080] S9: Use a chip scanner to perform fluorescence imaging and quantification of the capture interface.

[0081] Although the technical solutions of the present invention have been described and enumerated in detail, it should be understood that modifications to the above embodiments or the adoption of equivalent alternatives are obvious to those skilled in the art. Such modifications or improvements made without departing from the spirit of the present invention are all within the scope of protection claimed by the present invention.

Claims

1. A method for constructing a high-throughput protein capture interface via antibody adsorption, characterized in that, The method includes the following steps: S1, synthesize tetrahedral framework nucleic acid structures; S2, a high-throughput protein capture interface is constructed by mixing the capture antibody and the synthesized tetrahedral framework nucleic acid structure on a gold island substrate; S3, place the Golden Island substrate in a humidified box and incubate overnight; S4 seals the capture interface to prevent non-specific adsorption; S5, incubation protein target; S6, incubation for antibody detection; S7, incubate with fluorescent secondary antibody; S8, wash the capture interface with pure water and centrifuge and air dry; S9 uses a chip scanner to perform fluorescence imaging and quantification of the capture interface.

2. The method for constructing a high-throughput protein capture interface via antibody adsorption according to claim 1, characterized in that: In step S1, the edge length of the synthesized tetrahedral framework nucleic acid structure is 17 bp, which is the 17 bp DNA tetrahedral framework nucleic acid structure (DTF).

3. The method for constructing a high-throughput protein capture interface via antibody adsorption according to claim 2, characterized in that: A tetrahedral framework nucleic acid structure with an edge length of 17 bp was formed by the self-assembly of four single-stranded DNAs with sequences SEQ ID No:1, SEQ ID No:2, SEQ ID No:3, and SEQ ID No:

4.

4. The method for constructing a high-throughput protein capture interface via antibody adsorption according to claim 3, characterized in that: In step S2, the molar ratio of the capture antibody to 17 bp DTF is 5:

1.

5. The method for constructing a high-throughput protein capture interface via antibody adsorption according to claim 1, characterized in that: In step S3, the humidity of the incubation is 70%.

6. The method for constructing a high-throughput protein capture interface via antibody adsorption according to claim 1, characterized in that: In step S4, the solution used for sealing is 2% BSA.

7. The method for constructing a high-throughput protein capture interface via antibody adsorption according to claim 6, characterized in that: The capture interface was sealed with a 2% BSA solution to prevent nonspecific adsorption for 45 minutes, and then the capture interface was washed to remove excess BSA.

8. The method for constructing a high-throughput protein capture interface via antibody adsorption according to claim 1, characterized in that: In step S5, the incubation time for the protein target is 2.5 hours.

9. The method for constructing a high-throughput protein capture interface by antibody adsorption according to claim 1, characterized in that: In step S6, the incubation time for the detection antibody is 1.5 hours, and the concentration of the detection antibody is 50 nM.

10. The method for constructing a high-throughput protein capture interface by antibody adsorption according to claim 1, characterized in that: In step S7, the concentration of the fluorescent secondary antibody is 20 nM, and the incubation time for the fluorescent secondary antibody is 20 minutes.