A maize ZmMKKK88 gene and its application in improving plant drought tolerance

Abstract

The present invention relates to a maize ZmMKKK88 gene and its application in improving plant drought tolerance, belonging to the technical field of plant gene breeding. This gene has a nucleotide sequence as shown in SEQ ID NO.1, and the encoded protein of this gene has an amino acid sequence as shown in SEQ ID NO.2. By analyzing the ZmMKKK88 gene deletion mutant and the ZmMKKK88 overexpression transgenic Arabidopsis plants, the present invention finds that the ZmMKKK88 gene has a positive regulatory effect on the drought resistance of plants, providing important theoretical significance and application value for creating new drought-resistant maize germplasms and molecular breeding of drought-resistant maize.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic breeding, and particularly relates to a maize ZmMKKK88 gene and its application in improving plant drought tolerance. Background Art

[0002] Maize (Zea mays), wheat, and rice are known as the three major food crops in China, with its sown area and yield ranking first. Since plants cannot actively avoid the impacts brought by the external environment like animals, the growth and development of plants are constantly challenged by various factors in the natural environment. Such stress is mainly divided into biotic stress and abiotic stress. Among the two types of stress, abiotic stress is the main factor affecting crop yield and quality, mainly including drought and temperature, especially in recent years, with the change of the global climate, drought has become one of the important stress factors seriously affecting maize yield. Therefore, studying the drought resistance response mechanism and physiological changes of maize under drought conditions and mining maize drought response regulatory genes will provide excellent gene resources and application basis for maize stress-resistant breeding.

[0003] More and more studies have shown that the MAPK cascade pathway has important biological functions in all developmental stages of plant growth and various biotic and abiotic stress responses. There have been many reports on the functions of this type of gene in other species, including participating in the regulation of various abiotic stress responses, but there are relatively few research reports on the function of the maize MAPKKK family genes in improving plant resistance. Summary of the Invention

[0004] The purpose of the present invention is to provide a maize ZmMKKK88 gene and its application in improving plant drought tolerance to solve the above problems.

[0005] The present invention realizes the above purpose through the following technical solutions:

[0006] The present invention provides a maize ZmMKKK88 gene, which has the nucleotide sequence shown in SEQ ID NO.1 and is 3408bp in full length.

[0007] The present invention also provides an application of the above maize ZmMKKK88 gene in improving plant drought tolerance.

[0008] As a further optimized scheme of the present invention, overexpression of the ZmMKKK88 gene in plants can improve plant drought tolerance.

[0009] As a further optimized scheme of the present invention, the plant is maize or Arabidopsis thaliana.

[0010] The present invention also provides a coding protein of the above-mentioned maize ZmMKKK88 gene. This coding protein has an amino acid sequence shown in SEQ ID NO.2, with a full length of 1135 aa.

[0011] The present invention also provides a plasmid vector, which is obtained by inserting the above-mentioned maize ZmMKKK88 gene into the Blunt, pCAMBIA1301 or pCAMBIA1305 vector.

[0012] The present invention also provides a genetically engineered host cell, which is an Escherichia coli or Agrobacterium competent cell containing the above plasmid vector.

[0013] The beneficial effects of the present invention are as follows:

[0014] The present invention provides a maize ZmMKKK88 gene and its application. By analyzing the ZmMKKK88 gene deletion mutant and ZmMKKK88 overexpression transgenic Arabidopsis plants, it is found that the ZmMKKK88 gene has a positive regulatory effect on the drought resistance of plants, providing important theoretical significance and application value for creating new drought-resistant maize germplasms and maize drought-resistant molecular breeding. Brief Description of the Drawings

[0015] Figure 1 For the gene structure and mutation site detection results (A: Schematic diagram of mutation sites; B: Sequencing peak map of mutation sites);

[0016] Figure 2 For the phylogenetic tree analysis of ZmMKKK88;

[0017] Figure 3 For the tissue expression pattern analysis of ZmMKKK88 (V3-R: Root at the 3-leaf stage; V3-L: Leaf at the 3-leaf stage; V8-R: Root at the 8-leaf stage; V8-S: Stem at the 8-leaf stage; V8-L: Leaf at the 8-leaf stage; V11-S: Stem at the 11-leaf stage; V11-L: Leaf at the 11-leaf stage; R1-S: Stem at the silking stage; R1-L: Leaf at the silking stage; SK: Silk at the silking stage; E: Ear; T: Tassel; EM: Embryo 20 days after pollination);

[0018] Figure 4 For the subcellular localization of ZmMKKK88;

[0019] Figure 5 For the drought treatment phenotypes of wild-type plants and dsm mutant plants (A: Phenotypes of wild-type and mutant plants under normal conditions and drought treatment conditions; B: RWC measurement; C: MDA content measurement. **p<0.01, bar = 10 cm);

[0020] Figure 6For the staining of leaves after drought treatment and the analysis of ROS accumulation (A: DAB staining of plant leaves; B: NBT staining of plant leaves; C: Determination of POD content; D: Determination of SOD content. **p<0.01, bar = 1 cm);

[0021] Figure 7 For the identification of positive seedlings of ZmMKKK88 transgenic lines;

[0022] Figure 8 For the drought resistance analysis of overexpressing Arabidopsis plants (A - D: Phenotypes of 0 mM, 200 mM, 250 mM, 300 mM mannitol - simulated drought treatment; E: Statistical analysis of root length data. **p<0.01, bar = 2 cm);

[0023] Figure 9 For the drought phenotype analysis of wild - type and overexpressing Arabidopsis (A: Drought treatment phenotype analysis of Arabidopsis; B: RWC determination; C: Determination of SOD content. **p<0.01, bar = 5 cm); Detailed implementation mode

[0024] The methods used in this example are all conventional methods known to those skilled in the art unless otherwise specified. The reagents and other materials used are all commercially available products unless otherwise specified.

[0025] 1. Experimental materials and main reagents

[0026] 1.1 Experimental materials

[0027] The maize (Zea mays) B73 inbred line used in this experiment was provided by the National - Local Joint Engineering Laboratory of Crop Stress Resistance Breeding and Disaster Reduction, Anhui Agricultural University. The Arabidopsis thaliana material used was the Columbia wild - type. Homologous genes in maize were queried using reported genes in rice, Arabidopsis thaliana, etc., and combined with the annotation and screening of the EMS mutant library (http: / / elabcaas.cn / memd / public / index.html# / pages / search / geneid). The mutant plants of known genes in the EMS mutant library were analyzed for drought resistance. A mutant sensitive to drought and homologous to rice DSM1 was found during the stress treatment. After backcrossing this mutant with wild - type B73 plants for 2 generations, a stable drought - sensitive phenotype could still be obtained. Since this gene is homologous to rice DSM1, this mutant was named dsm, and its effector mutant gene is Zm00001eb254410.

[0028] 1.2 Main reagents and vectors

[0029] Vector: T / A cloning vector - Blunt Cloning Kit, pCAMBIA1305 subcellular localization and PCAMBIA1301 overexpression vector.

[0030] The genomic DNA extraction kit, reverse transcription kit, ordinary TRlzol, and conventional Taq enzyme were purchased from Hunan Aikery Biotechnology Co., Ltd.; primers and other common chemical reagents were purchased from Shanghai Sangon Biotech Co., Ltd. The high-fidelity DNA polymerase (PRIMER STAR MAX) and restriction endonucleases used for amplifying the target fragment were purchased from Takara, and the fluorescence quantitative reagents were from Nanjing Novizan Co., Ltd.

[0031] 2. Experimental methods and main results

[0032] 2.1 Molecular characterization analysis of ZmMKKK88 gene

[0033] 2.1.1 Identification of dsm drought-sensitive mutant

[0034] The mutation site structure and location were analyzed using the mutation site annotation information in the EMS mutant library. The results are shown in Figure 1 Figure A. This mutant is a mutation in the first exon of the Zm00001eb254410 gene, where glutamine (CAG) in the first exon has mutated to a stop codon (TAG), causing premature termination of gene translation.

[0035] From wild-type plants and mutant plants, with normally growing maize leaves as templates, PCR sequencing detection of the mutant site of the mutant was performed. The detection primers are as follows:

[0036] SEQ ID NO.3: ZmMKKK88-F 5′TCCTCAGGAAGCTCCATATCGG 3′

[0037] SEQ ID NO.4: ZmMKKK88-R 5′CCAGACTAAGCTGCTTGGCGAC 3′

[0038] The results are shown in Figure 1 Figure B. At this gene locus in the mutant, C has mutated to T, which is consistent with the prediction results in the EMS mutant library.

[0039] 2.1.2 Sequence alignment analysis of ZmMKKK88 protein and homologous proteins

[0040] The maize whole-genome sequence was obtained through the MaizeGDB website (https: / / maizegdb.org), and the whole-genome sequences of rice and Arabidopsis thaliana were obtained through the Phytozome website (https: / / phytozome-next.jgi.doe.gov / ). MEGA6.0 was used for alignment and construction of phylogenetic trees (N-J = 1000 bootstraps). The amino acid sequences of the obtained homologous proteins were aligned using the DNAMAN software to analyze their sequence domains and conservation;

[0041] The results showed that the mutant effector gene Zm00001eb254410 belongs to the MAPKKK family in the MAPK cascade pathway and is the most upstream kinase in this cascade pathway, named ZmMKKK88. The nucleotide sequence is shown in SEQ ID NO.1. Phylogenetic analysis showed that in addition to a high similarity with the DSM1 gene in rice, the ZmMKKK88 gene also has a close evolutionary relationship with genes such as OsMAPKKK7 and EDR1 ( Figure 2 ).

[0042] 2.1.3 Analysis of the expression pattern of ZmMKKK88

[0043] Tissues at different stages of maize were collected, including leaves and roots at the three-leaf stage, roots, stems and leaves at the eight-leaf stage, stems and leaves at the eleven-leaf stage, stems and leaves at the silking stage, as well as silks, embryos and endosperms. RNA was extracted respectively, and cDNA was obtained after reverse transcription. Using the cDNA of these tissues as the quantitative template, specific quantitative primers were designed as follows:

[0044] SEQ ID NO.5: GAPDH-F 5′ATCAACGGCTTCGGAAGGAT 3′

[0045] SEQ ID NO.6: GAPDH-R 5′CCGTGGACGGTGTCGTACTT 3′

[0046] SEQ ID NO.7: ZmMKKK88-F’5′AGAATTGGGTTGTGAAGGTT 3′

[0047] SEQ ID NO.8: ZmMKKK88-R’5′GCATTTTTCATCCGATCGTT 3′

[0048] The expression level of ZmMKKK88 in different tissues was detected by fluorescence quantitative PCR. The results are as Figure 3 shown. ZmMKKK88 is expressed in all tissues, and its expression level is relatively high in leaves at the V8 stage, leaves and embryo tissues at the V11 stage.

[0049] 2.1.4 Subcellular localization analysis of ZmMKKK88

[0050] Using the pCAMBIA1305 empty vector as a blank control, the ZmMKKK88-GFP subcellular localization vector as the experimental group, and the leaves of B73 etiolated seedlings as raw materials to prepare protoplasts. The two vector plasmids were respectively transferred into maize protoplast cells, and the nuclear localization signal was co-transferred. The results are as Figure 4 shown. Fluorescence signals were observed in the cell nucleus, cytoplasm, and cell membrane of the control group, while fluorescence signal expression was only observed in the nucleus of the experimental group and could overlap with the nuclear signal fluorescence, indicating that ZmMKKK88 is a nuclear localization protein.

[0051] 2.2 Drought resistance analysis of ZmMKKK88 deletion mutants

[0052] Wild-type B73 and dsm mutant seeds were germinated under dark conditions at 28°C. After 2 days, seeds with consistent growth were selected and planted in nutrient soil with a ratio of black soil:vermiculite of 2:1. After the three-leaf and one-heart stage, natural drought treatment was carried out for 7 days, and the phenotypes were observed and relevant physiological and biochemical indexes were measured.

[0053] The results showed that there were no obvious differences between wild-type plants and mutant plants under normal growth conditions; after 7 days of drought treatment, compared with wild-type plants, the degree of leaf curling and wilting of mutant plants was more obvious, and the growth and damage degree of mutant plants were more serious ( Figure 5 A); further determination of the relative water content (RWC) and malondialdehyde (MDA) content of wild-type plants and mutant plants was carried out. Under normal growth conditions, there were no obvious differences in the relative water content (RWC) and malondialdehyde (MDA) content between the two germplasms. After drought treatment, the RWC of mutant plants was significantly lower than that of wild-type plants, and the MDA content was significantly higher than that of wild-type plants ( Figure 5 B, C). The research shows that the MDA content is one of the important indexes of the degree of membrane lipid peroxidation, and the degree of membrane lipid peroxidation will be significantly deepened after the plant is subjected to drought stress.

[0054] In order to observe the changes of ROS in plants, the leaves of wild-type and mutant plants were stained with nitroblue tetrazolium (NBT) and 3,3'-diaminobenzidine (DAB), and the activities of peroxidase (POD) and superoxide dismutase (SOD) were detected. Under normal conditions, there were no obvious differences in the staining results between the two lines; after drought treatment, the staining of mutant plant leaves was deeper than that of wild-type plants. Figure 6A, B). At the same time, under normal conditions, there were no significant differences in the activities of peroxidase (POD) and superoxide dismutase (SOD) between the two strains. After drought treatment, the activities of these enzymes in the mutant plants were significantly lower than those in the wild-type plants( Figure 6 C, D). The above results indicate that the mutant plants are more sensitive to drought than the wild-type plants.

[0055] 2.3. Analysis of drought resistance of ZmMKKK88 overexpressing plants

[0056] 2.3.1 Obtaining of ZmMKKK88 overexpressing transgenic Arabidopsis plants

[0057] 2.3.1.1 Construction of ZmMKKK88 overexpression vector

[0058] The ZmMKKK88 gene was divided into two segments, A and B. The target gene was cloned in segments by overlapping PCR and then overlapped to obtain the full-length fragment. The primer design is as follows:

[0059] SEQ ID NO.9: ZmMKKK88-A-F 5′ATGAAGAACTTCCTCAGGAAGCTC 3′

[0060] SEQ ID NO.10: ZmMKKK88-A-R 5′CAAGTGGCACAATTACACTTCC 3′

[0061] SEQ ID NO.11: ZmMKKK88-B-F 5′AACTTCATTCGAGAACTTCAGA 3′

[0062] SEQ ID NO.12: ZmMKKK88-B-R 5′TCACTCATCTGTTTGTTGCACT 3′

[0063] Using the cDNA reverse transcribed from B73 leaves as a template, PCR amplification was performed with a high-fidelity enzyme and full-length overlapping amplification was carried out to obtain the full-length gene product, which was ligated to Blunt. The ligation product was transferred into Escherichia coli DH5α strain for sequencing verification. Sac I and Sal I restriction enzyme sites were introduced at both ends of the ZmMKKK88 gene. The PCAMBIA 1301 vector ligated with the 35S promoter was digested with restriction enzymes Sac I and Sal I for linearization, and the target fragment was ligated downstream of the 35S promoter of the PCAMBIA1301 vector by homologous recombination to obtain the ZmMKKK88 overexpression vector.

[0064] 2.3.1.2 Agrobacterium transformation

[0065] The constructed overexpression vector was transferred into Agrobacterium, and an Arabidopsis infection solution was prepared for inflorescence infection of Arabidopsis to obtain T0 generation plants. The T0 generation transgenic seeds were coated on a resistant medium, and resistant plants that could germinate normally were selected for planting. After extracting the genomic DNA from these plants, PCR detection was carried out. The results showed that bright and single target bands ([ Figure 7 Figure 7 ) could be seen in transgenic plants L1, L5, L6, L7, L8 and L11, indicating that the overexpression vector had been successfully transferred into Arabidopsis, and transgenic positive Arabidopsis plants were obtained.

[0066] 2.3.2 Drought resistance analysis of Arabidopsis overexpressing ZmMKKK88

[0067] 2.3.2.1 Phenotypic analysis of root drought stress in Arabidopsis plants overexpressing ZmMKKK88

[0068] The seeds of transgenic Arabidopsis and wild-type Arabidopsis were disinfected and sterilized, and then coated on a blank medium and a resistant medium containing hygromycin respectively, and placed vertically in an Arabidopsis greenhouse for 7 days. Wild-type and overexpressing Arabidopsis seedlings that had grown for 7 days and had the same growth vigor and size were selected and placed vertically and flat on mannitol media with different concentrations of 0 mM, 200 mM, 250 mM and 300 mM. The media were placed vertically in the greenhouse for 7 days, and their root lengths were measured respectively. The results were as Figure 8 shown. In the medium without mannitol, there was no obvious difference in root length between wild-type plants and overexpressing plants. In the mannitol media with different concentrations, the root lengths of both wild-type plants and transgenic plants became shorter, and their growth was significantly inhibited. However, the root length of overexpressing plants was significantly longer than that of wild-type plants.

[0069] 2.3.2.2 Drought stress analysis of Arabidopsis plants overexpressing ZmMKKK88

[0070] Wild-type and overexpressing Arabidopsis seedlings that had grown for 10 days and had the same growth vigor and size were selected and transplanted into a mixed nutrient soil of black soil: vermiculite = 1:3. After the transplanted seedlings were placed in an Arabidopsis culture greenhouse and uniformly managed for 15 days at the seedling stage, wild-type plants and overexpressing plants L5, L6 and L7 were subjected to drought treatment for 15 days, and their phenotypes were observed and their physiological indexes were measured.

[0071] As Figure 9 shown in A, both wild-type plants and overexpressing plants grew well under normal conditions and there was no obvious difference. After 15 days of drought treatment, the leaves of wild-type Arabidopsis plants wilted severely, turned dry and yellow, but the degree of leaf wilting, drying and yellowing of overexpressing Arabidopsis plants was significantly lighter than that of wild-type plants, and the degree of drought stress was lower.

[0072] The relative water content (RWC) and superoxide dismutase (SOD) activity of wild-type and overexpressing Arabidopsis plants were measured. As Figure 9 shown in B and C, under normal growth conditions, there were no significant differences in RWC, SOD, etc. between wild-type and overexpressing plants. After drought treatment, the RWC of overexpressing plants was significantly higher than that of wild-type plants, and the SOD content of wild-type plants was significantly lower than that of overexpressing plants. The above research results indicate that the drought tolerance of overexpressing Arabidopsis plants is significantly higher than that of wild-type plants, and overexpression of the ZmMKKK88 gene can improve the drought resistance of transgenic plants.

[0073] The above only expresses several implementation modes of the present invention, and its description is relatively specific and detailed, but it should not be construed as a limitation to the scope of the patent of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the concept of the present invention, several deformations and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. Use of the maize ZmMKKK88 gene in improving plant drought tolerance, characterized in that, The nucleotide sequence of this gene is shown in SEQ ID NO.1; overexpression of the ZmMKKK88 gene improves the drought tolerance of Arabidopsis thaliana.

Images