Application of SgHAD1 gene from Stylosanthes guianaensis in improving plant tolerance to aluminum toxicity stress

Abstract

The invention discloses the application of the Guyana Stylosanthes SgHAD1 gene in improving the tolerance of plants to aluminum toxicity stress, and belongs to the technical field of plant breeding. The purpose of the invention is to improve the tolerance of plants to aluminum toxicity stress, and to provide the application of the SgHAD1 gene in regulating plants to improve the tolerance of plants to aluminum toxicity stress. The SgHAD1 gene of the invention has a positive effect on improving the aluminum toxicity stress resistance of the slender stem Stylosanthes, and the sequence of the SgHAD1 gene is shown in SEQ ID NO.1. The SgHAD1 encoding gene can reduce the content of fructose-6-phosphate and glucose-6-phosphate in plants, and significantly increase the content of fructose and glucose, thereby improving the tolerance of plants to aluminum toxicity stress, which is of great significance for cultivating new varieties of crops adapted to acidic soil cultivation.

Description

Technical Field

[0001] The invention relates to the technical field of plant breeding, and in particular to an application of a Stylosanthes guiana SgHAD1 gene in improving the tolerance of plants to aluminum toxicity stress. Background Art

[0002] Acidic soils (pH < 5.5) account for 40% to 50% of the world's potential arable land, covering approximately 40 million hectares of land worldwide. In acidic soils, aluminum is mainly present in the form of Al 3+ Al 3+ It will cause serious damage to the plant root system, resulting in reduced root elongation. 3+ In the root, it inhibits cell division, elongation and membrane polarization, and reduces the photosynthetic efficiency and pigment content of leaves. 3+ It also causes excessive accumulation of reactive oxygen species, which in turn interferes with cell wall proteins and other metabolic pathways, leading to insufficient mineral nutrition and reduced production performance of crops. Therefore, in acidic soils, aluminum toxicity seriously hinders the growth of crops. Globally, aluminum toxicity is second only to drought as the second largest abiotic stress factor.

[0003] The halogenated acid dehalogenase (HAD) superfamily mainly catalyzes carbon or phosphate transfer reactions on different substrates. They are ubiquitous in bacteria, fungi, animals, and plants. There are at least 40 HAD encoding genes in the genome of the model plant Arabidopsis thaliana, and at least 41 HAD encoding genes in the genome of the model crop rice. At present, the main function of HAD family genes in plants reported is to participate in the adaptation to low phosphorus stress. For example, in Arabidopsis thaliana, the AtPECP1 gene belonging to the HAD family is induced to express by low phosphorus stress. Its main function is to hydrolyze phosphocholine and phosphoethanolamine and release phosphate ions, thereby enhancing the tolerance of Arabidopsis to low phosphorus stress. In rice, the OsACP1 gene belonging to the HAD family has a similar function to AtPECP1 of Arabidopsis thaliana. At present, no HAD family gene has been reported to have the function of tolerance to aluminum toxicity stress.

[0004] Stylosanthes guianensis originated from the acidic soil of South America, and it may have developed a potential mechanism for aluminum stress tolerance during its long evolution. Therefore, Stylosanthes guianensis shows strong tolerance to aluminum stress, which is common in acidic soil. Discovering the gene for aluminum stress tolerance in Stylosanthes guianensis can be used to improve the tolerance of other plants to aluminum stress, which is of great significance for cultivating new crop varieties that are adapted to cultivation in acidic soils. Summary of the invention

[0005] The present invention provides an application of a Stylosanthes guiana SgHAD1 gene in improving the tolerance of plants to aluminum toxicity stress, so as to solve the above problems.

[0006] The present invention provides an application of a Stylosanthes guiana SgHAD1 gene in improving tolerance to aluminum toxicity stress.

[0007] Furthermore, the nucleotide sequence of the SgHAD1 gene of Stylosanthes ananas is shown in SEQ ID NO.1.

[0008] Furthermore, the amino acid sequence of the protein encoded by the Guyana Stylosanthes SgHAD1 gene is shown in SEQ ID NO:2.

[0009] Furthermore, the plant is Stenoptera.

[0010] The invention provides a method for improving the tolerance of plants to aluminum toxicity stress. The SgHAD1 gene of Stylosanthes guiana is introduced into the genome of other plants to be enhanced by using transgenic technology. Through the heterologous expression of the SgHAD1 gene, the other plants to be enhanced acquire the aluminum toxicity stress resistance function of the SgHAD1 gene and the protein encoded by the gene. The sequence of the SgHAD1 gene is shown in SEQ ID NO: 1, and the sequence of the SgHAD1 protein is shown in SEQ ID NO: 2.

[0011] Furthermore, the amplified SgHAD1 gene is used to construct a plant expression vector, and the plant expression vector is transferred into other plants to be enhanced through Agrobacterium-mediated method to obtain transgenic plants with improved tolerance to aluminum toxicity stress.

[0012] Furthermore, the SgHAD1 gene is heterologously expressed in plants, and the protein encoded by the gene catalyzes the degradation of fructose-6-phosphate and glucose-6-phosphate to generate fructose and glucose, thereby promoting root growth and improving the tolerance of plants to aluminum toxicity stress;

[0013] Furthermore, the plant to be enhanced is a closely related species of Stylosanthes guianaensis: Stylosanthes slenderstalks.

[0014] The beneficial effects of the present invention are:

[0015] The invention discloses an application of the Guyana Stylosanthes SgHAD1 gene in improving tolerance to aluminum toxicity stress. Through the transgenic hairy roots of plants heterologously expressing SgHAD1, the SgHAD1 protein hydrolyzes fructose-6-phosphate and glucose-6-phosphate to produce fructose and glucose, thereby promoting plant root growth, thereby significantly improving the tolerance of the plant to aluminum toxicity stress, and improving the ability of the plant to resist aluminum toxicity stress. The SgHAD1 gene plays an important role in the adaptation of plants to aluminum toxicity stress, can be used to improve the adaptability of crops to aluminum toxicity stress in acidic soil through transgenic technology, and has important guiding significance for the subsequent cultivation of new germplasm of aluminum resistant crops suitable for production. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1 This is the result of the expression pattern analysis of the SgHAD1 gene in Stylosanthes guiana under aluminum treatment;

[0018] Figure 2 Phylogenetic tree analysis of SgHAD1 and 40 Arabidopsis HAD family members;

[0019] Figure 3 This is the electrophoresis diagram of PCR identification of transgenic hairy roots of Stylosanthes slenders expressing SgHAD1 heterologously;

[0020] Figure 4 This is the absolute quantitative detection result of 6 metabolites in SgHAD1 positive transgenic hairy roots;

[0021] Figure 5 This is a diagram showing the results of purification of the SgHAD1 recombinant protein;

[0022] Figure 6 This is the result of the analysis of the biochemical enzymatic properties of the SgHAD1 recombinant protein;

[0023] Figure 7 This is the result of the aluminum toxicity stress tolerance experiment on the transgenic hairy roots of Slender-stem Stylosanthes. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] The materials of Stylosanthes guianensis and Stylosanthes gracilis used in the present invention are both from the Grassland Research Center of the Institute of Tropical Crop Variety Resources of the Chinese Academy of Tropical Agricultural Sciences.

[0026] Example 1: Analysis of the expression pattern of the SgHAD1 gene of Stylosanthes guiana in response to aluminum treatment

[0027] The seeds of Stylosanthes guiana were placed on moist filter paper in the dark for germination and then transferred to modified Magnavaca nutrient solution (1 mM KCl, 1 mM CaCl2, 0.077 mM Fe-EDTA(Na), 0.2 mM MgSO4, 0.5 mM Mg(NO3)2·6H2O, 1.5 mM NH4NO3, 11.8×10 -3 mM MnCl2·4H2O, 3.06×10 -3 mM ZnSO4·7H2O, 0.8×10 -3 mMCuSO4·5H2O, 33×10 -3 mM H3BO3, 1.07×10 -3 mM Na2MoO4·2H2O, 0.155mM MgCl2·6H2O, 0.3mM KH2PO4), with a nutrient solution pH of 5.8; the seedlings pre-cultured for 10 days were transferred to a modified Magnavaca nutrient solution containing 540μM AlCl3 (aluminum treatment) and a modified Magnavaca nutrient solution without AlCl3 (control treatment), respectively, with a nutrient solution pH of 4.2 for both aluminum treatment and control treatment, and a KH2PO4 concentration of 45×10 -3 mM, leaf and root samples collected 10 days after treatment;

[0028] The roots and leaves of aluminum-treated and control-treated Stylosanthes were ground into powder with liquid nitrogen as samples, and then the total RNA of Stylosanthes was extracted using a plant total RNA extraction kit (DP432, TIANGEN), and its integrity was detected by 1% agarose gel electrophoresis. The operation was referred to the product manual; then, cDNA was synthesized using a HiScript III RT SuperMix for qPCR reverse transcription kit (R323-01, Vazyme), and the operation was referred to the product manual; using the synthesized cDNA as a template and the Stylosanthes housekeeping gene PTB2 as an internal reference, PTB2 quantitative PCR primers (PTB2-RT-F: TGGGAAGCGATTAGAAGTCA (SEQ ID NO: 3); PTB2-RT-R: AATGGTTCCATGCTCCTCCA (SEQ ID NO: 4)) and SgHAD1 gene quantitative PCR primers (SgHAD1-RT-F: TGCCAAGCCTCATCCAGACC (SEQ ID NO: 5)) were designed. NO:5); SgHAD1-RT-R: CAGGCTTTGCTTCCATCAGTAGA (SEQ ID NO:6)); Fluorescence quantitative PCR was performed using the quantitative reagent ChamQ Universal SYBR qPCR Master Mix (Q711, Vazyme), and the instrument used was Applied Biosystems QuantStudio TM 7Flex System (Applied Biosystems, USA), refer to the reagent manual for specific operation steps;

[0029] The results are as follows Figure 1 As shown, Figure 1 A is the relative expression level of SgHAD1 in the roots of Stylosanthes guianaensis under control and aluminum treatment; Figure 1 B is the relative expression level of SgHAD1 in the leaves of S. guiana under control and aluminum treatment. Asterisks indicate significant differences between the control (-Al) and aluminum treatment (+Al) (Student's t-test), **: P < 0.01; ***: P < 0.001; Figure 1 A and Figure 1 B shows that the SgHAD1 gene of Stylosanthes guiana was upregulated in both leaves and roots by aluminum treatment.

[0030] Example 2 Cloning of the Aluminum Tolerant SgHAD1 Gene of Stylosanthes guianaensis

[0031] 1. The specific method for cloning the SgHAD1 gene is:

[0032] Take a fresh root sample of Stylosanthes guianensis, extract total RNA from the root sample according to the method for extracting total RNA of Stylosanthes guianensis in Example 1, and synthesize cDNA as a template;

[0033] Primers (SgHAD1-ORF-F: ATGACCGTCTCCTCTGAAAG-(SEQ ID NO: 7); SgHAD1-ORF-R: TCATACTTTTTTAGTACCAGCCTT)-(SEQ ID NO: 8) were designed, and the full-length CDS sequence of the SgHAD1 gene was amplified by PCR using cDNA as a template;

[0034] The PCR reaction system was: Phanta Flash Super-Fidelity DNA Polymerase (P521-d1, Vazyme) 20 μl, upstream and downstream primers 1 μl each, cDNA template 2 μl, ddH2O 16 μl; the PCR program was: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 25 s, for a total of 35 cycles; then 72°C thorough extension for 5 min; 4°C storage;

[0035] The PCR product was purified using the FastPure Gel DNA Extraction Mini Kit (DC301-01, Vazyme) and sent to Sangon Biotech (Shanghai) Co., Ltd. Sanger sequencing was performed using the above-mentioned amplification primers to obtain the full-length CDS sequence of the SgHAD1 gene as shown in SEQ ID NO: 1, and its amino acid sequence as shown in SEQ ID NO: 2.

[0036] 2. Phylogenetic tree analysis of SgHAD1

[0037] MEGA software was used to align the full-length protein sequences of SgHAD1 and all 40 members of the Arabidopsis HAD family. The default parameters were set for the alignment, and then the maximum likelihood phylogenetic tree was constructed using the JTT model. The results are shown in Figure 2. Figure 2 The results showed that SgHAD1 had the highest homology with AtHAD15 (AtSgpp) protein in the Arabidopsis HAD protein family.

[0038] Example 3 Heterologous expression of the SgHAD1 gene of Stylosanthes guiana in Slender-stemmed Stylosanthes

[0039] 1. Construction of plant heterologous overexpression vector

[0040] Using the cDNA of Stylosanthes guiana synthesized in Example 2 as a template, primers (SgHAD1-OE-F: GATCTTCCAATACTCATGACCGTCTCCTCTGAAAG (SEQ ID NO: 9); SgHAD1-OE-R:

[0041] TGGATCCCCAATACTTCATACTTTTTTAGTACCAGCCTT (SEQ ID NO: 10)), the full-length CDS sequence of the SgHAD1 gene carrying the pCXSN vector linker was amplified by PCR; the PCR reaction system was Phanta Flash Super-Fidelity DNA Polymerase (P521-d1, Vazyme) 20μl, 1μl of upstream and downstream primers, 2μl of template, and 16μl of ddH2O. The PCR reaction program was 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 25 seconds, a total of 35 cycles; then 72℃ thorough extension for 5 minutes; 4℃ storage;

[0042] The pCXSN vector was digested with restriction endonuclease Xcm I, and the digestion system (50 μl) was as follows: 10 μl (5 μg) of pCXSN vector plasmid, 2.5 μl of Xcm I, 5 μl of endonuclease buffer, 30 μl of ddH2O, and incubated in a water bath at 37°C for 2 h. The pCXSN vector and the SgHAD1 gene fragment were connected using the homologous recombinase ClonExpress II One Step Cloning Kit (C112-01, Vazyme) with the purified PCR product and the digested vector. The ligated product was transformed into Escherichia coli DH5α (DL1001, Weidi Biotechnology) by heat shock method and sequenced. After sequencing was confirmed, the recombinant plasmid was extracted with FastPure Plasmid Mini Kit (DC201-01, Vazyme) to obtain the recombinant vector plasmid pCXSN-SgHAD1.

[0043] The recombinant vector plasmid pCXSN-SgHAD1 and the pCXSN empty plasmid (blank control) were transformed into Ar1193 Agrobacterium rhizogenes, respectively, and the transformed Ar1193 Agrobacterium rhizogenes was stored at -80°C for later use.

[0044] 2. Transformation of in vitro hairy roots of Stylophora slender

[0045] The specific steps for transformation of in vitro hairy roots of S. stylosanthes are as follows:

[0046] The Ar1193 Agrobacterium rhizogenes culture (glycerol culture, OD 600=1.0), spread on LB plates containing 50 mg / L Kan (Kan) and 50 mg / L Stre (Stre), invert and culture at 28°C for 2 days. When colonies grow, pick a single clone and add it to 5 mL of 50 mg L -1 Kan and 50mg L -1 Stre LB liquid medium, 28 ℃, 200rpm overnight culture activation. Take 60μl activated bacterial solution to 10mL containing 50mg L - 1 Kan and 50mg L -1 Stre in LB liquid medium and culture to OD 600 =1.0, centrifuge at 5000 rpm for 10 min, discard the supernatant, and resuspend the cells in LB liquid medium without antibiotics to OD 600 =0.6, the infection solution was prepared;

[0047] Select seeds of slender-stemmed stylophora with full grains, place them in a 2mL centrifuge tube, add an appropriate amount of sterile water, heat shock at 80℃ for 3min, aspirate the sterile water in the clean bench, add an equal volume of 75% ethanol solution for disinfection for 3min, rinse with sterile water 3 times, disinfect with 0.1% mercuric chloride solution for 10min, and rinse with sterile water 6 times. Spread the disinfected seeds on sterilized filter paper soaked with sterile water, seal in a sterile culture dish, and germinate for 2d in the dark at 25℃;

[0048] Use tweezers to take out the 2-day-old stylosanthes seeds from the culture dish, use a scalpel to remove the hypocotyl about 3 mm below the cotyledon node, cut the two cotyledons in half along the cotyledon node, and make a wound on the cotyledon to obtain the cotyledon explants required for infection. Soak the cotyledon explants in the infection solution for 15 minutes, filter out the explants with sterile gauze, and place the infected explants on sterile filter paper to absorb the excess bacterial solution. Transfer the infected explants to the co-culture medium (MS + 2% sucrose + 3.5 g L -1 Plant gel) in the dark for 3 days; 200 mg L -1 The explants were washed with Timentin solution, and finally the excess water was sucked out and the explants were inserted into the induction medium (1 / 2MS + 8mg L -1 Hygromycin + 200mg L -1 Timentin + 2% sucrose + 3.5g L -1 The culture medium was replaced every 7 days in a light culture medium (25±1°C, 2000Lx, 16h light / 8h dark) until the hairy roots of the slender-stemmed stylosanthes grew out.

[0049] 3. Identification of positive hairy roots

[0050] 0.5 g of the fresh hairy root strains cultured above were taken and placed in a mortar, and then quickly ground into powder after adding liquid nitrogen. The hairy root DNA was extracted using the SteadyPure Plant Genomic DNA Extraction Kit (AG21026, Aikerui Biotech), and PCR identification was performed using this as a template. At the same time, PCR identification was performed using Agrobacterium transformed with the pCXSN-SgHAD1 plasmid for comparison;

[0051] Oligo 7 software was used to design gene-specific primers. The primers used for PCR detection of SgHAD1-positive transgenic hairy roots were as follows: forward primer SgHAD1-ORF-F (SgHAD1 full-length CDS amplification primer): ATGACCGTCTCCTCTGAAAG (SEQ ID NO: 7), rear primer pCXSN-R (pCXSN vector universal primer): GTAACATAGATGACACCGCG (SEQ ID NO: 11)); the detection primers of the housekeeping gene PTB2 of Stylosanthes used quantitative PCR primers (forward primer PTB2-RT-F: TGGGAAGCGATTAGAAGTCA (SEQ ID NO: 3), rear primer PTB2-RT-R: AATGGTTCCATGCTCCTCCA (SEQ ID NO: 4)); the detection primers of the rolB gene EST of the Ri plasmid of Agrobacterium rhizogenes (forward primer rolB-EST-F: GCTCTTGCAGTGCTAGATTT (SEQ ID NO: NO:12), rear primer rolB-EST-R: GAAGGTGCAAGCTACCTCTC (SEQ ID NO:13)); Hyg gene EST detection primers on pCXSN plasmid (front primer Hyg-EST-F: AGGGTGTCACGTTGCAAG (SEQ ID NO:14), rear primer Hyg-EST-R: AAGACCAATGCGGAGCATATAC (SEQ ID NO:15)); the above primers were synthesized by Qingke Biotechnology Co., Ltd.;

[0052] The PCR reaction system was 10 μl of 2× Rapid Taq Master Mix (P222-01, Vazyme), 0.5 μl of upstream and downstream primers, 2 μl of template, and 7 μl of ddH2O. The PCR reaction program was 95°C pre-denaturation for 3 minutes; 94°C denaturation for 15 seconds, 56°C annealing for 15 seconds, and 72°C extension for 15 seconds, for a total of 33 cycles; then 72°C thorough extension for 5 minutes; and storage at 4°C.

[0053] PCR identification results Figure 3As shown (M: DL2000 Marker; N: negative control, ddH2O as template; P: positive control, Agrobacterium transformed with pCXSN-SgHAD1 plasmid as template; CK: DNA of transgenic hairy roots without pCXSN as template; OE1-OE3: DNA extracted from transgenic hairy roots heterologously expressing pCXSN-SgHAD1 as template), from Figure 3 It can be seen that compared with the CK control group (pCXSN empty transgenic strain), specific bands can be amplified in the transgenic hairy root strains OE1~OE3 of slender-stemmed Stylosanthes heterologously expressing SgHAD1, indicating that these strains all carry the SgHAD1 gene fragment; the specific fragment of the Stylosanthes housekeeping gene PTB2 was amplified in both CK and the transgenic lines heterologously expressing SgHAD1, while the corresponding gene was not detected in P (Agrobacterium transferred into the pCXSN-SgHAD1 plasmid), indicating that the samples are reliable; in addition, specific fragments of the rolB gene and the Hyg gene can be amplified in both CK and the transgenic lines OE1~OE3 heterologously expressing SgHAD1, indicating that these genes have been integrated into the hairy root genome of slender-stemmed Stylosanthes, and the obtained hairy roots are all transgenic materials.

[0054] 4. Absolute quantitative detection of six metabolites in SgHAD1-positive transgenic hairy roots

[0055] The six metabolites of fructose-6-phosphate, glucose-6-phosphate, 3-phosphoglycerate, fructose 1,6-bisphosphate, fructose and glucose in the transgenic hairy roots obtained above were absolutely quantitatively detected by LC-MS / MS.

[0056] The results are as follows Figure 4 As shown ( Figure 4 A: fructose-6-phosphate content; Figure 4 B: glucose-6-phosphate content; Figure 4 C: fructose-1,6-bisphosphate content; Figure 4 D: 3-phosphoglyceric acid content; Figure 4 E: fructose content; Figure 4 F: glucose content measurement; CK: pCXSN empty transgenic hairy root; OE1-OE3: transgenic hairy root lines heterologously expressing SgHAD1; FW represents fresh weight; asterisks in the figure indicate significant differences between CK and OE1-OE3 (Student's t-test, *: P < 0.05; **: P < 0.01; ***: P < 0.001; ns indicates no significant difference). Figure 4 A~ Figure 4F It can be seen that compared with CK, the fructose-6-phosphate and glucose-6-phosphate contents of transgenic hairy root lines (OE1-OE3) heterologously expressing SgHAD1 were significantly reduced, but the fructose and glucose contents were significantly increased. In addition, there was no difference in the contents of 3-phosphoglycerate and fructose 1,6-bisphosphate between CK and OE1-OE3. The above results indicate that in transgenic hairy roots heterologously expressing SgHAD1, the protein encoded by SgHAD1 plays a role in hydrolyzing fructose-6-phosphate and glucose-6-phosphate and releasing fructose and glucose.

[0057] 5. Expression and purification of SgHAD1 protein

[0058] Using the cDNA of Stylosanthes guianaensis as a template, primers were designed

[0059] SgHAD1-GST-F:

[0060] GATCCCCGAATTCCCGGATGACCGTCTCCTCTGAAAG (SEQ ID NO: 16); SgHAD1-GST-R:

[0061] CGCTCGAGTCGACCCGGTCATACTTTTTTAGTACCAGCCTTG (SEQ ID NO: 17), amplify the full-length CDS of SgHAD1 carrying the PGEX6P3 vector linker; use the restriction endonuclease Sma I to digest the PGEX6P3 vector; connect the digested PGEX6P3 vector and the SgHAD1 gene by homologous recombination to construct the recombinant protein expression vector PGEX6P3-SgHAD1 with the SgHAD1 sequence fused to the GST tag;

[0062] The constructed PGEX6P3-SgHAD1 vector was transformed into Escherichia coli BL21 (EC1001, Weidi Biotechnology) by heat shock method to obtain recombinant bacteria, which were added into liquid LB medium to form recombinant bacterial liquid; 1 ml of BL21 recombinant bacterial liquid (OD 600 =1.0) to 200 ml LB liquid medium and culture in a shaking incubator at 37°C until OD 600The concentration of 0.8 was then added to 0.8mM IPTG and transferred to a 28°C shaker for continued cultivation for 6 hours. The bacterial solution was centrifuged at 6000rpm for 10 minutes, the supernatant was removed, and the bacteria were collected. The precipitate was resuspended with 20ml Binding buffer (140mM NaCl, 2.7mM KCl, 10mM Na2HPO4, 1.8mM KH2PO4, 5mM DTT), the bacteria were broken with an ultrasonic disruptor, the supernatant was collected by centrifugation, and then the GST fusion protein purification kit (70601-K10, BEAVER) was used for protein purification. The operation steps were referred to the product manual to obtain the GST: SgHAD1 fusion protein; the purified GST: SgHAD1 fusion protein was subjected to SDS-PAGE detection, and the protein purity was analyzed with the unpurified total protein (collected centrifugal supernatant) as a reference;

[0063] The results are as follows Figure 5 As shown, compared with the total protein channel, the purified protein channel showed a clear and single protein band with a molecular weight of about 53KD, indicating that the GST:SgHAD1 fusion protein was successfully induced to express in Escherichia coli and the target protein with good purification effect was obtained.

[0064] 6. Analysis of SgHAD1 protease characteristics

[0065] Using bovine serum albumin as the standard, the concentration of the purified GST:SgHAD1 fusion protein was determined by the Coomassie brilliant blue method; then 2 mM p-nitrophenyl phosphate, fructose-6-phosphate, glucose-6-phosphate, fructose-1,6-bisphosphate and 3-phosphoglycerate substrates were prepared respectively using 50 mM sodium acetate solution (pH = 5.6) as the solvent, and then 5 mM MgCl2 sodium acetate solution was prepared, and then added according to the following reaction system: substrate 50 μl + protein sample 0.5 μg + MgCl2 sodium acetate solution, the total system is 100 μl. The control reaction system: substrate 50 μl + sodium acetate solution + MgCl2 sodium acetate solution, the total system is 100 μl; the added reaction system was placed at 37°C for 15 minutes, and the phosphorus content in the reaction product was determined using an inorganic phosphorus test kit (C006-1-1, Nanjing Jiancheng Bioengineering Institute), and the enzyme activity was calculated by formula (1);

[0066]

[0067] The relative enzyme activity was calculated by formula (2):

[0068]

[0069] The results are as follows Figure 6As shown, compared with the SgHAD1 protease activity under the universal substrate - p-nitrophenyl phosphate (p-NPP) as the substrate, the relative activity of SgHAD1 under fructose-6-phosphate (F6P) as the substrate is 146.61%, and the relative activity of SgHAD1 under glucose-6-phosphate (G6P) as the substrate is 157.58%. The SgHAD1 gene has no hydrolysis activity for the two substrates fructose-1,6-bisphosphate and 3-phosphoglycerate, indicating that the SgHAD1 gene mainly catalyzes the dephosphorylation reaction of fructose-6-phosphate and glucose-6-phosphate.

[0070] Example 4 Effect of heterologous expression of SgHAD1 gene on the tolerance of transgenic hairy roots of Slender-stemmed Stylosanthes to aluminum toxicity stress

[0071] The specific method for aluminum treatment of transgenic hairy roots of slender-stemmed stylophora is as follows: take the transgenic hairy roots that grow well and have the same culture period in Example 3, cut them 2 cm from the root tip with a surgical blade, and then neatly spread the 2 cm long hairy roots on the aluminum stress treatment medium (1 / 6MS + 10 g L -1 Sucrose + 10g L -1 The cells were cultured in the dark on agar + 250 μM AlCl3, pH = 4.2) for 7 days. The hairy root transgenic line expressing the pCXSN empty vector was used as the control group (CK), and three independent hairy root transgenic lines heterologously expressing SgHAD1 (OE1, OE2, OE3) were used as the experimental groups. The growth of hairy roots was observed, and the root length of each transgenic line was counted.

[0072] The results are as follows Figure 7 As shown ( Figure 7 A: Transgenic hairy roots were grown in the presence of 250 μmol L -1 Root system diagram after cultivation on AlCl3 medium; Figure 7 B: Root length statistics of transgenic hairy root lines treated with aluminum toxicity (CK: hairy root transgenic line expressing pCXSN empty vector; OE1-OE3: hairy root transgenic lines heterologously expressing SgHAD1; Figure 7 The asterisk in B indicates significant differences between CK and OE1~OE3 (Student's t-test), ***: P<0.001. Each scattered point on the bar graph represents a single root length measurement value, and each line has 15 replicates). Figure 7 It can be concluded from A that the root length of the transgenic lines (OE1, OE2, and OE3) heterologously expressing SgHAD1 on the aluminum stress medium was significantly higher than that of CK. Figure 7It can be concluded from Figure B that under aluminum stress, the average root length of CK was 4.95 cm, the average root length of OE1 was 8.08 cm, the average root length of OE2 was 7.87 cm, and the average root length of OE3 was 8.35 cm. Therefore, it was shown that heterologous expression of SgHAD1 improved the aluminum toxicity tolerance of transgenic hairy roots (OE1, OE2, OE3) of slender-stemmed stylosanthes.

[0073] In summary, the present invention reduces the fructose-6-phosphate and glucose-6-phosphate contents in slender-stem stylosanthes by heterologous expression of the SgHAD1 gene, significantly increases the fructose and glucose contents, and thus improves its tolerance to aluminum toxicity stress. Therefore, the adaptability of crops to aluminum toxicity stress in acidic soil can be improved through transgenic technology based on the SgHAD1 gene, which has important guiding significance for the subsequent cultivation of new germplasm of aluminum-resistant crops suitable for production.

[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An application of the SgHAD1 gene of Stylosanthes guianaensis in improving the tolerance of plants to aluminum toxicity stress, characterized in that: The CDS sequence of the Guyana Stylosanthes SgHAD1 gene is shown in SEQ ID NO: 1, the amino acid sequence of the protein encoded by the Guyana Stylosanthes SgHAD1 gene is shown in SEQ ID NO: 2, and the plant is Slender-stemmed Stylosanthes.

2. A method for improving plant tolerance to aluminum toxicity stress, characterized in that: By using transgenic technology, the SgHAD1 gene of Guiana Stylosa is introduced into the genome of other plants to be enhanced, and through the heterologous expression of the SgHAD1 gene, the other plants to be enhanced acquire the SgHAD1 gene and the aluminum toxicity stress resistance function possessed by the protein encoded by the gene; the sequence of the SgHAD1 gene is shown in SEQ ID NO: 1, and the sequence of the SgHAD1 protein is shown in SEQ ID NO: 2; the plant to be enhanced is slender-stemmed Stylosa.

3. The method for improving plant aluminum toxicity stress tolerance according to claim 2, characterized in that: The method for improving plant aluminum toxicity stress tolerance specifically comprises the following steps: The amplified SgHAD1 gene is used to construct a plant expression vector, which is then transferred into other plants to be enhanced through Agrobacterium-mediated method to obtain transgenic plants with improved tolerance to aluminum toxicity stress.

Images