Primer probe set, kit and method for detecting influenza A (H1N1) virus

Abstract

The present invention relates to a primer-probe set, a kit, and a method for detecting influenza A (H1N1) virus. The primer-probe set comprises: an HA forward primer, whose nucleotide sequence is shown in SEQ ID NO. 1; an HA reverse primer, whose nucleotide sequence is shown in SEQ ID NO. 2; an HA probe, whose nucleotide sequence is shown in SEQ ID NO. 3; an NA forward primer, whose nucleotide sequence is shown in SEQ ID NO. 4; an NA reverse primer, whose nucleotide sequence is shown in SEQ ID NO. 5; an NA probe, whose nucleotide sequence is shown in SEQ ID NO. 6; an internal standard forward primer, whose nucleotide sequence is shown in SEQ ID NO. 7; an internal standard reverse primer, whose nucleotide sequence is shown in SEQ ID NO. 8; and an internal standard probe, whose nucleotide sequence is shown in SEQ ID NO. 9. The present invention provides accurate detection results and high sensitivity.

Description

Technical Field

[0001] The present application relates to the field of molecular detection technology, and in particular to a primer probe set, a kit, and a method for detecting influenza A (H1N1) virus. Background Art

[0002] Influenza A belongs to the Orthomyxoviridae family and contains a genome composed of eight negative-strand RNA segments encoding 11 proteins. Influenza A subtype classification is primarily based on the antigenicity of two major cell surface glycoproteins: hemagglutinin (HA) and neuraminidase (NA). Sixteen HA and nine NA subtypes have been identified.

[0003] The novel influenza A(H1N1) (2009) virus contains genetic fragments from three influenza viruses: swine flu, avian flu, and human flu. It is a novel swine flu virus (2009 pandemic strain). The influenza A(H1N1) (2009) virus can be transmitted directly from pigs to humans and can also spread from person to person. Infected pigs or humans are the primary source of infection, but asymptomatic carriers can also be contagious. Humans can also spread the virus through three routes: contact (when contaminated hands touch a face mask), droplet contact (when infectious droplets are projected onto mucous membranes), and airborne (through inhalation of infectious airborne particles). The incubation period is similar to that of seasonal influenza, estimated at one to seven days. Environmental contamination with the influenza A(H1N1) (2009) virus is also a potential source of infection.

[0004] Currently, existing test kits for detecting influenza A (H1N1) virus have problems such as high false positive rate, use of exogenous internal standard system, long amplification time and low sensitivity. Summary of the Invention

[0005] The purpose of the embodiments of the present application is to provide a primer probe set, a kit and a method for detecting influenza A (H1N1) virus. The detection results of the present application are accurate and highly sensitive.

[0006] In order to solve the above technical problems, the present invention provides a primer probe set, a kit and a method for detecting influenza A (H1N1) virus, which adopts the following technical solutions:

[0007] A primer probe set for detecting influenza A (H1N1) virus, comprising:

[0008] HA forward primer, the nucleotide sequence of which is shown in SEQ ID NO.1;

[0009] HA reverse primer, the nucleotide sequence of which is shown in SEQ ID NO.2;

[0010] HA probe, the nucleotide sequence of which is shown in SEQ ID NO.3;

[0011] NA forward primer, the nucleotide sequence of which is shown in SEQ ID NO.4;

[0012] NA reverse primer, the nucleotide sequence of which is shown in SEQ ID NO.5;

[0013] NA probe, the nucleotide sequence of which is shown in SEQ ID NO.6;

[0014] Internal standard forward primer, the nucleotide sequence of which is shown in SEQ ID NO.7;

[0015] an internal standard reverse primer, the nucleotide sequence of which is shown in SEQ ID NO.8; and

[0016] The nucleotide sequence of the internal standard probe is shown in SEQ ID NO.9.

[0017] Furthermore, the nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO. 1 is GGGAAAGAAGTCCTCGTYCT;

[0018] The nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.2 is CMGGCTTGAACTTCTTGCTG;

[0019] The nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.3 is TGGGGCATTCACCATCCATCTACTAGTGCT;

[0020] The nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.4 is GTYTGCAGGGATAACTGGCA;

[0021] The nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.5 is TACTGGACCACAACTGCCTGTC;

[0022] The nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.6 is TGGCTCGAATCGACCGTGGGTGT;

[0023] The nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.7 is AAGAAGGTGGTGAAGCAGGC;

[0024] The nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.8 is GAGTGGGTGTCGCTGTTGAAG;

[0025] The nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO. 9 is CAAGGGCATCCTGGGCTACACTGAGC.

[0026] Furthermore, the 5' end of the HA probe is labeled with FAM, and the 3' end is labeled with BHQ1.

[0027] Furthermore, the 5' end of the NA probe is labeled with VIC, and the 3' end is labeled with BHQ1.

[0028] Furthermore, the 5' end of the internal standard probe is labeled with CY5, and the 3' end is labeled with BHQ2.

[0029] In order to solve the above technical problems, the present invention also provides a kit for detecting influenza A (H1N1) virus, which adopts the following technical solution:

[0030] A kit for detecting influenza A (H1N1) virus, comprising a PCR reaction solution, wherein the PCR reaction solution comprises the above-mentioned primer probe set.

[0031] Furthermore, the PCR reaction solution also includes dNTPs, UDG enzyme, C-MMLV enzyme, hot start Taq antibody enzyme and magnesium ions;

[0032] Wherein, the dNTPs include dATP, dGTP, dCTP, and dUTP.

[0033] Furthermore, the concentrations of the primers and probes in the primer-probe set are both 0.1 pmol / μL-0.3 pmol / μL.

[0034] Furthermore, the concentration of the dNTPs is 10-50 mmol / L, the concentration of the UDG enzyme is 1-10 U / μL, the concentration of the C-MMLV enzyme is 100-200 U / μL, the concentration of the hot-start Taq antibody enzyme is 10-50 U / μL, and the concentration of the magnesium ion is 0.1-2 mmol / L.

[0035] In order to solve the above technical problems, the present invention also provides a method for detecting influenza A (H1N1) virus, which adopts the following technical solution:

[0036] A method for detecting influenza A (H1N1) using the above kit comprises the following steps:

[0037] Performing nucleic acid extraction on the sample to be tested to obtain nucleic acid of the sample to be tested;

[0038] The PCR reaction solution is divided into multiple PCR tubes, and the corresponding sample nucleic acid to be tested, negative quality control product and positive quality control product are added respectively, and centrifuged;

[0039] Place the sample in a PCR amplification instrument, perform PCR amplification, read the fluorescence, and obtain the test results.

[0040] Compared with the prior art, the embodiments of the present application have the following beneficial effects:

[0041] The present application designs specific probes in the conserved regions of the selected HA and NA gene segments of the novel influenza A (H1N1) genome to detect two targets in order to improve the accuracy of detection. Among them, the HA and NA probes do not cross-react with the internal standard probes, and the HA and NA probes do not cross-react with other pathogens of similar species to the novel influenza A (H1N1) virus or that cause similar symptoms. The present application uses three different fluorescently labeled probes to achieve detection using three channels and three fluorescent channels during the detection process. At the same time, an endogenous system is used to monitor the sampling, extraction, amplification and other processes to avoid false negatives. The present application uses the RT-PCR one-step method to perform the reverse transcription reaction and real-time fluorescence PCR amplification in one reaction to optimize the reaction amplification procedure and reduce the amplification time. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] In order to more clearly illustrate the solutions in this application, a brief introduction will be given below to the drawings required for use in the description of the embodiments of this application. Obviously, the drawings described below are some embodiments of this application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0043] Figure 1 is a flow chart of an embodiment of a method for detecting influenza A H1 N1 according to the present application;

[0044] Figure 2 This is a graph showing the test results of an IVA H1 N1 positive quality control product of the method for detecting influenza A H1 N1 of the present application;

[0045] Figure 3 is the IVA H1 N1 negative control test result of the method for detecting influenza A H1 N1 of the present application;

[0046] Figure 4 This is a graph showing the results of the inspection of the enterprise minimum detection limit reference material for the method for detecting influenza A H1 N1 in this application;

[0047] Figure 5 This is a graph showing the test results of the test sample 1 of the method for detecting influenza A H1 N1 of the present application;

[0048] Figure 6 This is a graph showing the test results of the test sample 2 of the method for detecting influenza A H1 N1 of the present application;

[0049] Figure 7 This is a graph showing the test results of the test sample 3 of the method for detecting influenza A H1 N1 of the present application;

[0050] Figure 8 This is a graph showing the test results of the national negative reference product for the test kit for detecting influenza A (H1 N1) virus of the present application;

[0051] Figure 9 This is a graph showing the test results of the national positive reference product for the test kit for detecting influenza A (H1N1) virus of the present application;

[0052] Figure 10 This is a graph showing the minimum detection limit reference test result of the test kit for detecting influenza A (H1N1) virus of the present application;

[0053] Figure 11 This is a graph showing the precision reference test results of the test kit for detecting influenza A (H1N1) virus of the present application;

[0054] Figure 12 This is a graph showing the test results of three batches of quality control products of the test kit for detecting influenza A (H1N1) virus of the present application. DETAILED DESCRIPTION

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this application belongs. The terms used in the specification of the application are for the purpose of describing specific embodiments only and are not intended to limit this application. The terms "including" and "having" and any variations thereof in the specification and claims of this application and the above-mentioned drawings are intended to cover non-exclusive inclusions. The terms "first", "second", etc. in the specification and claims of this application or the above-mentioned drawings are used to distinguish different objects, not to describe a specific order.

[0056] References herein to "embodiments" mean that a particular feature, structure, or characteristic described in connection with the embodiments may be included in at least one embodiment of the present application. The appearance of this phrase in various places in the specification does not necessarily refer to the same embodiment, nor does it constitute an independent or alternative embodiment that is mutually exclusive of other embodiments. It is understood, both explicitly and implicitly, by those skilled in the art that the embodiments described herein may be combined with other embodiments.

[0057] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified.

[0058] In order to enable those skilled in the art to better understand the solution of the present application, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the accompanying drawings.

[0059] The present application provides a primer-probe set for detecting influenza A (H1N1) virus, the primer-probe set comprising: an HA forward primer, whose nucleotide sequence is shown in SEQ ID NO.1; an HA reverse primer, whose nucleotide sequence is shown in SEQ ID NO.2; an HA probe, whose nucleotide sequence is shown in SEQ ID NO.3; an NA forward primer, whose nucleotide sequence is shown in SEQ ID NO.4; an NA reverse primer, whose nucleotide sequence is shown in SEQ ID NO.5; an NA probe, whose nucleotide sequence is shown in SEQ ID NO.6; an internal standard forward primer, whose nucleotide sequence is shown in SEQ ID NO.7; an internal standard reverse primer, whose nucleotide sequence is shown in SEQ ID NO.8; and an internal standard probe, whose nucleotide sequence is shown in SEQ ID NO.9.

[0060] Among them, the nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.1 is GGGAAAGAAGTCCTCGTYCT; the nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.2 is CMGGCTTGAACTTCTTGCTG; the nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.3 is TGGGGCATTCACCATCCATCTACTAGTGCT; the nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.4 is GTYTGCAGGGATAACTGGCA; the nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.5 is TACTGGACCACAACTGCCTGTC; the nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.6 is TGGCTCGAATCGACCGTGGGTGT; the nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.7 is AAGAAGGTGGTGAAGCAGGC; the nucleotide sequence from 5' to 3' end corresponding to SEQ ID NO.8 is GAGTGGGTGTCGCTGTTGAAG; The nucleotide sequence from 5' to 3' end corresponding to NO.9 is CAAGGGCATCCTGGGCTACACTGAGC.

[0061] In this embodiment, the sequence corresponding to SEQ ID NO.1 contains Y, and the sequence corresponding to SEQ ID NO.2 contains M, wherein Y represents C or T, and M represents A or C. This application designs specific primers to detect two targets in the conserved regions of the HA and NA gene segments of the novel influenza A (H1N1) genome to improve the accuracy of detection. Specifically, NCBI searches for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and the novel influenza A (H1N1) virus genome, downloads the GAPDH genome, and the HA and NA gene segments of the novel influenza A (H1N1) genomes from various years and regions, and after alignment using BioEdit, obtains relatively conserved regions, and designs specific primers and probes at the conserved sequences. The HA and NA primers do not cross-react with the internal standard primers, and do not cross-react with other pathogens of similar species to the novel influenza A (H1N1) virus or that cause similar symptoms.

[0062] Furthermore, the HA probe is labeled with FAM at its 5' end and BHQ1 at its 3' end. The NA probe is labeled with VIC at its 5' end and BHQ1 at its 3' end. The internal standard probe is labeled with CY5 at its 5' end and BHQ2 at its 3' end. The details are shown in Table 1.

[0063] In this embodiment, the present application uses three different fluorescently labeled probes to achieve detection using three channels and three fluorescent channels during the detection process. At the same time, the endogenous system is used to monitor the sampling, extraction, amplification and other processes to avoid false negatives.

[0064] Table 1 Nucleotide sequences of primer probe sets

[0065]

[0066]

[0067] The present application also provides a kit for detecting influenza A (H1N1) virus, wherein the kit comprises a PCR reaction solution, and the PCR reaction solution comprises the above-mentioned primer probe set.

[0068] As an option in the present application, the PCR reaction solution further includes dNTPs, UDG enzyme, C-MMLV enzyme, hot-start Taq antibody enzyme and magnesium ions; wherein the dNTPs include dATP, dGTP, dCTP and dUTP.

[0069] As an option in this application, the concentration of the dNTPs is 10-50 mmol / L, the concentration of the UDG enzyme is 1-10 U / μL, the concentration of the C-MMLV enzyme is 100-200 U / μL, the concentration of the hot-start Taq antibody enzyme is 10-50 U / μL, and the concentration of the magnesium ion is 0.1-2 mmol / L.

[0070] The PCR reaction solution also includes an enzyme protective agent.

[0071] The PCR reaction solution also includes a buffer solution, the magnesium ions (Mg 2+ ) is provided by the buffer Buffer.

[0072] In this embodiment, the present application changes the dTTP in the original dNTPs to dUTP, adds a certain concentration of product contaminants, and adds UDG enzyme (uracil DNA glycosylase) to reduce false positives. The present application replaces the enzyme diluent with an enzyme-based protective agent to solve problems such as refrigerated transportation and room temperature transportation; the enzyme-based protective agent is a reagent developed by our company. Among them, product contaminants refer to PCR products that have been amplified. Due to the high temperature causing the tube cover to loosen or the careless operation causing the tube cover to open, a large amount of high-concentration products may be generated to contaminate the unamplified system. The role of UDG enzyme is to eliminate the influence of PCR products at a temperature of 50°C before PCR amplification to achieve accurate results and avoid false positives.

[0073] As an option in the present application, the concentrations of the primers and probes in the primer-probe set are both 0.1 pmol / μL-0.3 pmol / μL.

[0074] In this embodiment, the designed primer probe set was added to the reaction system, and the concentrations of the HA forward primer, HA reverse primer, NA forward primer, and NA reverse primer were all 0.1 pmol / μL-0.3 pmol / μL, and the concentrations of the HA probe and the NA probe were 0.1 pmol / μL-0.3 pmol / μL; the optimal concentrations of the internal standard forward primer and the internal standard reverse primer were 0.1 pmol / μL-0.3 pmol / μL, and the optimal concentration of the internal standard probe was 0.1 pmol / μL-0.3 pmol / μL;

[0075] The kit of the present application also includes an IVA H1N1 negative quality control product and an IVA H1N1 positive quality control product.

[0076] In addition, the reagents in the kit can be freeze-dried into freeze-dried powder for storage, which is convenient for transportation and storage.

[0077] The present application also provides a method for detecting influenza A (H1N1) using the above-mentioned kit, referring to Figure 1, shows a flow chart of an embodiment of a method for detecting influenza A (H1N1) virus according to the present application. The method comprises the following steps:

[0078] S1: Perform nucleic acid extraction on the sample to be tested to obtain nucleic acid of the sample to be tested;

[0079] S2: The PCR reaction solution is divided into multiple PCR tubes, and the corresponding sample nucleic acid to be tested, negative quality control product and positive quality control product are added to each tube, and centrifuged;

[0080] S3: Place the sample in a PCR amplification instrument, perform PCR amplification, read the fluorescence, and obtain the test results.

[0081] In this embodiment, the present invention can be used to detect influenza A (H1N1) virus in throat swab samples. The minimum detection limit of the present invention is 200 copies / mL, with high sensitivity and good specificity. The present invention increases the sample volume of the nucleic acid to be tested, and the sample volume is 8-10 μL.

[0082] This application uses the one-step RT-PCR method, performing reverse transcription reaction and real-time fluorescence PCR amplification in one reaction to optimize the reaction amplification program and reduce the amplification time. Currently, the reaction time of the existing test kit is 15 minutes, which is shortened to 2 minutes in this application. At the same time, this application accelerates the temperature rise and fall speed of the PCR amplifier, with a temperature rise and fall rate of 3 to 6°C / s, and the annealing temperature time is set to 10s.

[0083] The specific testing process of this application is as follows:

[0084] Step 1: PCR reagent preparation (reagent preparation area)

[0085] 1. When using the bulk kit, the PCR reaction solutions include PCR Reaction Solution A and PCR Reaction Solution B. Remove PCR Reaction Solution A and PCR Reaction Solution B from the kit, thaw at room temperature, and vortex to mix. Centrifuge at 8,000 rpm for a few seconds before use. Prepare N PCR reaction tubes, where N = the number of samples to be tested + IVA H1N1 negative control + IVA H1N1 positive control. Prepare the IVA H1N1 single-reaction amplification system as shown in Table 2.

[0086] Table 2 IVA H1N1 single reaction amplification system

[0087] Components PCR reaction solution A PCR reaction solution B Total volume Dosage 17μL 3μL 20 μL

[0088] After mixing, centrifuge briefly to allow all the liquid on the tube wall to be centrifuged to the bottom of the tube, and then dispense 20 μL of the amplification system into PCR tubes.

[0089] Among them, PCR reaction solution A (17 μL) includes buffer solution (providing Mg 2+ ), the aforementioned primer and probe sets, and DEPC water; PCR reaction solution B (3 μL) includes dNTPs, UDG enzyme, C-MMLV enzyme, hot-start Taq antibody enzyme, and enzyme protectant. DEPC water is a colorless ultrapure water (grade 1) treated with DEPC (diethylpyrocarbonate) and sterilized by high temperature and high pressure.

[0090] 2. When using a single-tube, single-person test kit, directly use the IVA H1N1 PCR reaction tube in the test kit and add the sample directly without mixing the reagents. The single-tube, single-person specification of this application uses eight connected tubes, each tube contains PCR reaction solution A, solid capping agent and PCR reaction solution B. In each tube, PCR reaction solution A is in the lower layer of the solid capping agent, and PCR reaction solution B is in the upper layer of the solid capping agent. When adding the nucleic acid of the sample to be tested and the nucleic acid of the quality control product, directly use the gun tip of the sample gun to pierce the solid capping agent in the tube, so that the PCR reaction solution A and the PCR reaction solution B are mixed, and amplified after centrifugation.

[0091] Step 2: Sample processing and nucleic acid extraction (sample preparation area)

[0092] Extract 200 μL of the sample to be tested for nucleic acid. Existing nucleic acid extraction or purification reagents (e.g., Filing Numbers: Yuesui Medical Device Preparation 20170583, Yuesui Medical Device Preparation 20201539, Yuesui Medical Device Preparation 20170669) can be used. Please follow the instructions in the kit manual for specific steps.

[0093] The IVA H1N1 positive quality control and IVA H1 N1 negative quality control in this kit are processed simultaneously with the samples to be tested and are used to monitor the environment and control the quality of the PCR detection reagents.

[0094] Step 3: Add sample (sample preparation area)

[0095] 1. When using the bulk kit: Add 10 μL each of the extracted sample nucleic acid, IVA H1N1 negative control, and IVA H1N1 positive control to the corresponding PCR reaction tubes. Securely cap the tubes, centrifuge briefly at 8,000 rpm, and transfer to the amplification detection area.

[0096] 2. When using a single-tube, single-dose kit: Centrifuge for 15 seconds. Use a pipette tip to pierce the paraffin in the center of the IVA H1N1 PCR reaction tube. Add 10 μL each of the extracted nucleic acid from the sample to be tested, the IVA H1N1 negative control, and the IVA H1N1 positive control. Securely cap the tube, centrifuge briefly at 8,000 rpm, and transfer to the amplification detection area.

[0097] Step 4: PCR amplification (amplification of the detection region)

[0098] 1. Program parameters: On the program parameters page, the amplification parameters are as follows:

[0099] Table 3 Program parameters

[0100]

[0101] And set the PCR reaction volume to 30 μL in "Reaction volume l".

[0102] 2. Dye parameters: Click the dye parameter page, select the current program dye settings (channel 1 FAM, channel 2 VIC, channel 4 CY5), then select the sample well, and select the sample type: negative control, positive control, unknown sample, etc.

[0103] 3. Start amplification: After confirming that the PCR reaction tube is properly placed in the host, click the start button to start the PCR cycle.

[0104] 4. Monitor the progress: Switch to the program running page to display the actual situation of the PCR curve as the cycle increases. If the marker is FAM, VIC or CY5, only the changes of the corresponding probe will be displayed.

[0105] 5. Save results: After the program ends, it will be automatically saved to the file path.

[0106] Step 5: Result analysis (refer to the instruction manual of each instrument for settings)

[0107] The results are automatically saved after the reaction is completed. Adjust the Start value, End value, and Threshold value of the Baseline according to the analyzed image (users can adjust the Start value between 3 and 15, and the End value between 5 and 20 according to actual conditions. Set the Threshold Value in the Log graph window so that the threshold line is in the exponential phase of the amplification curve and the amplification curve of the negative control product is flat or below the threshold line). Click Analyze to automatically obtain the analysis results and read the test results in the "Report" window.

[0108] Step 6: Quality Control

[0109] IVA H1N1 negative control: FAM and VIC channels have no obvious amplification curves and no Ct values, while CY5 channel has an amplification curve with a Ct value ≤ 35;

[0110] IVA H1N1 positive quality control product: IVA H1N1 positive quality control product is positive for influenza A (H1N1) virus nucleic acid, with an amplification curve in the FAM channel and a Ct value ≤ 35, an amplification curve in the VIC channel and a Ct value ≤ 35, and an amplification curve in the CY5 channel and a Ct value ≤ 35;

[0111] The above requirements must be met simultaneously in the same experiment; otherwise, the experiment will be invalid and must be repeated.

[0112] The test results are as follows Figures 2 to 7 shown. Figure 2 This is a graph showing the test results of an IVAH1N1 positive quality control product of the method for detecting influenza A (H1N1) of the present application; Figure 3 is the IVAH1 N1 negative control test result of the method for detecting influenza A (H1N1) of the present application; Figure 4 This is a graph showing the results of the inspection of the enterprise minimum detection limit reference material for the method for detecting influenza A H1 N1 in this application; Figure 5 This is a graph showing the test results of the test sample 1 of the method for detecting influenza A H1 N1 of the present application; Figure 6 This is a graph showing the test results of the test sample 2 of the method for detecting influenza A H1 N1 of the present application; Figure 7 This is a diagram showing the test results of the test sample 3 of the method for detecting influenza A H1 N1 of the present application.

[0113] This application also provides experimental data of the above-mentioned test kit for detecting influenza A H1N1 virus

[0114] 1. National reference products, as shown in Table 4:

[0115] Table 4 National references

[0116]

[0117] The minimum detection limit of reference substance S (0.5 mL stock solution after reconstitution) was 1.8 × 10 7 copies / mL, quantified using digital PCR; the virus titer of S (0.5 mL of stock solution after reconstitution) was 1.3 × 10 7 TCID 50 / mL. The virus titer of the precision reference product CV (2.5mL stock solution after reconstitution) is 7.2×10 5 TCID 50 / mL.

[0118] 2. National negative reference test results, as shown in Table 5 and Figure 8 As shown, Figure 8 This is a graph showing the test results of the national negative reference product for the test kit for detecting influenza A (H1N1) virus of this application;

[0119] Table 5 National negative reference test results

[0120]

[0121] 3. Test results of national positive reference materials, as shown in Table 6 and Figure 9 As shown, Figure 9 This is a graph showing the test results of the national positive reference product for the test kit for detecting influenza A (H1N1) virus of this application;

[0122] Table 6 National positive reference test results

[0123]

[0124] 3. The test results of the reference product with the minimum detection limit are shown in Table 7 and Figure 10 As shown, Figure 10 This is a graph showing the minimum detection limit reference test result of the test kit for detecting influenza A (H1N1) virus of the present application;

[0125] Table 7 Test results of minimum detection limit reference substances

[0126]

[0127]

[0128] 4. Test results of precision reference materials are shown in Table 8 and Figure 11 As shown, Figure 11 This is a graph showing the precision reference test results of the test kit for detecting influenza A (H1N1) virus of this application;

[0129] Table 8 Precision reference test results

[0130]

[0131] 5. The test results of three batches of quality control products are shown in Table 9 and Figure 12 As shown, Figure 12 This is a graph showing the test results of three batches of quality control products for the test kit for detecting influenza A (H1N1) virus of this application;

[0132] Table 9 Test results of three batches of quality control products

[0133]

[0134] It should be understood that although the steps in the flowcharts of the accompanying drawings are shown in sequence as indicated by the arrows, these steps are not necessarily executed in the order indicated by the arrows. Unless otherwise specified herein, there is no strict order restriction on the execution of these steps, and they can be executed in other orders. Moreover, at least some of the steps in the flowcharts of the accompanying drawings may include multiple sub-steps or multiple stages, and these sub-steps or stages are not necessarily executed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be executed in turn or alternately with other steps or at least a portion of the sub-steps or stages of other steps.

[0135] Obviously, the embodiments described above are only some of the embodiments of the present application, rather than all of the embodiments. The preferred embodiments of the present application are given in the accompanying drawings, but they do not limit the patent scope of the present application. The present application can be implemented in many different forms. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive. Although the present application has been described in detail with reference to the aforementioned embodiments, for those skilled in the art, it is still possible to modify the technical solutions described in the aforementioned specific embodiments, or to make equivalent replacements for some of the technical features therein. Any equivalent structure made using the contents of the present application specification and the accompanying drawings, directly or indirectly used in other related technical fields, is also within the scope of patent protection of the present application.

Claims

1. A primer probe set for detecting influenza A (H1N1) virus, characterized in that: The primer probe set includes: HA forward primer, the nucleotide sequence of which is shown in SEQ ID NO.1; HA reverse primer, the nucleotide sequence of which is shown in SEQ ID NO.2; HA probe, the nucleotide sequence of which is shown in SEQ ID NO.3; NA forward primer, the nucleotide sequence of which is shown in SEQ ID NO.4; NA reverse primer, the nucleotide sequence of which is shown in SEQ ID NO.5; NA probe, the nucleotide sequence of which is shown in SEQ ID NO.6; Internal standard forward primer, the nucleotide sequence of which is shown in SEQ ID NO.7; An internal standard reverse primer, the nucleotide sequence of which is shown in SEQ ID NO.8; and The nucleotide sequence of the internal standard probe is shown in SEQ ID NO.

9.

2. The primer probe set for detecting influenza A (H1N1) virus according to claim 1, characterized in that: The 5' end of the HA probe is labeled with FAM, and the 3' end is labeled with BHQ1.

3. The primer probe set for detecting influenza A (H1N1) virus according to claim 1, characterized in that: The 5' end of the NA probe is labeled with VIC, and the 3' end is labeled with BHQ1.

4. The primer probe set for detecting influenza A (H1N1) virus according to claim 1, characterized in that: The 5' end of the internal standard probe is labeled with CY5, and the 3' end is labeled with BHQ2.

5. A kit for detecting influenza A (H1N1) virus, characterized in that: The kit comprises a PCR reaction solution, and the PCR reaction solution comprises the primer probe set according to any one of claims 1 to 4.

6. The kit for detecting influenza A (H1N1) virus according to claim 5, characterized in that: The PCR reaction solution also includes dNTPs, UDG enzyme, C-MMLV enzyme, hot start Taq antibody enzyme and magnesium ions; Wherein, the dNTPs include dATP, dGTP, dCTP and dUTP.

7. The kit for detecting influenza A (H1N1) virus according to claim 5, characterized in that: The concentrations of the primers and probes in the primer-probe set are both 0.1 pmol / μL-0.3 pmol / μL.

8. The kit for detecting influenza A (H1N1) virus according to claim 6, characterized in that: The concentration of the dNTPs is 10-50 mmol / L, the concentration of the UDG enzyme is 1-10 U / μL, the concentration of the C-MMLV enzyme is 100-200 U / μL, the concentration of the hot-start Taq antibody enzyme is 10-50 U / μL, and the concentration of the magnesium ion is 0.1-2 mmol / L.

Images